Search

Introduction. Cytomegalovirus is the most common cause of infections in the post-transplantation period. A reliable and timely laboratory diagnosis of cytomegalovirus infection in patients on dialysis and in the post-transplantation period is significant because of the possibility of preventing or mitigating the effects of cytomegalovirus disease. The main objective of this study was to compare serological and molecular polymerase chain reaction methods to determine the presence of cytomegalovirus in the blood of dialysis patients. Material and Methods. The study included 28 dialysis patients, potential renal transplant recipients. All patients were evaluated for the presence of cytomegalovirus in the blood by a quantitative polymerase chain reaction method as well as in the serum for the presence of anti-cytomegalovirus Immunoglobulin G and Immunoglobulin M antibodies. Results. According to the comparative enzyme-linked immunosorbent assay for detecting antibodies in dialysis patients, 96.4% were once exposed to the virus, while 7.1% showed current infection not confirmed by polymerase chain reaction test. No statistically significant association was found between the positive finding of anti-cytomegalovirus Immunoglobulin M antibodies and the findings of the polymerase chain reaction cytomegalovirus method when Chi-square (?2) and Fisher?s correlation tests were conducted (p > 0.05). Conclusion. Due to 7.1% false positives results for the presence of anti-cytomegalovirus Immunoglobulin M antibodies in the serum of immunocompromised dialysis patients, not confirmed by polymerase chain reaction test, serological techniques are not reliable in detecting active cytomegalovirus infection causing positive finding of anti-cytomegalovirus Immunoglobulin M, so confirmation of cytomegalovirus deoxyribonucleic acid by polymerase chain reaction method is required.

Introduction. The alpha-1 antitrypsin deficiency is the best described genetic cause of chronic obstructive pulmonary disease. The study of the alpha-1 antitrypsin deficiency, as the most important genetic risk factor for chronic obstructive pulmonary disease, is an important step in developing a strategy for the prevention and treatment of this disease. The aim of the study was detection of homozygous and heterozygous deficient gene alleles (protease inhibitor Z and protease inhibitor S) for alpha-1 antitrypsin in the group of patients with chronic obstructive pulmonary disease with the predominance of lung emphysema, as well as determination of a positive correlation between the serum levels of alpha-1 antitrypsin and the corresponding alpha-1 antitrypsin genotype. Material and Methods. The study included 90 patients, mutually unrelated individuals, hospitalized due to lung emphysema. The control group included 10 subjects, with no clinical signs of lung emphysema, but with a family history of chronic obstructive pulmonary disease. We attempted to identify the most common deficient alleles (protease inhibitor Z and protease inhibitor S) and the concentration of alpha-1 antitrypsin in the serum of the examinees. The polymorphism between the two allelic forms, protease inhibitor Z and protease inhibitor S, was detected by real-time polymerase chain reaction. Results. Protease inhibitor MM genotype alpha-1 antitrypsin was present in all 90 patients with the diagnosis of pulmonary emphysema, and the serum levels of alpha-1 antitrypsin were within the range of reference values. In the control group, there were two cases with mutated protease inhibitor MZ genotype, and in these 2 subjects the serum level of alpha-1 antitrypsin was at the lower limit of reference values. Conclusion. In patients diagnosed with lung emphysema, protease inhibitor MM genotype of alpha-1 antitrypsin and normal serum alpha-1 antitrypsin levels, the genetically- determined deficiency of alpha-1 antitrypsin is not responsible for the development of chronic obstructive pulmonary disease.

Introduction. We are aware of the risk of late virological relapse (LVR) years after sustained viral response (SVR) by pegylated interferon and ribavirin alfa (PegIFN? + RBV) of chronic hepatitis C viral (HCV) infection. We presented three patients with LVR, treated by PegIFN? and ribavirin 5 years after the SVR was established. Case report. We analysed 129 (38.8% female, 61.2% male, mean age 37.02 ? SD 11.99) patients treated for chronic HCV with PegIFN? + RBV, with at least 5 years from the establishment of SVR. In addition to the biochemical parameters of liver function, the qualitative HCV RNA polymerase chain reaction (PCR) and the quantitative PCR HCV RNA test were made. Five years after establishing SVR in 2.3% (3/129) of patients, the relapse of HCV infection was registered by qualitative and quantitative PCR HCV RNA assay and all of these patients had additional autoimmune diseases: vasculitis, autoimmune hepatitis, and vasculitis of central nervous system. Conclusion. The existence, but low rate of LVR HCV infection was confirmed, dominantly in patients with additional autoimmune diseases. Due to this SVR after therapy by PegIFN? + RBV should be considered as an indicator of successful HCV suppresion, not its complete eradication.

Introduction. After analyzing a specific nucleotide sequence, located near the dopamine receptor D2 gene, rs1800497 polymorphism was detected, that affects dopamine D2 receptor expression, its density and affinity. This polymorphism is associated with many disorders such as: aggressive behavior, response to stress, sensation seeking, impulsivity, extraversion, anger, random memory, impaired cognitive function, brain glucose metabolism, obesity, pathologic gambling, substance addiction, depression, schizophrenia, that are related to modified gene expression, receptor density and affinity. Due to this association, a considerable interest in detecting a reliable dopamine receptor D2 gene allele was developed. The aim of this paper is optimization of real-time polymerase chain reaction in genotyping dopamine receptor D2 gene rs1800497 polymorphism. Material and Methods. Deoxyribonucleic acid was extracted from the blood of ten healthy individuals. Deoxyribonucleic acid samples were genotyped for dopamine receptor D2 gene rs1800497 (context sequence part containing targeted single nucleotide polymorphism CACAGCCATCCTCAAAGTGCTGGTC[A/G]AG?GCAGGCGCCCAGCTGGACGTCCA) by polymerase chain reaction. The TaqMan assays were used to determine single-nucleotide polymorphisms. The products of amplification were analyzed using Applied Biosystems 7500 fast real-time polymerase chain reaction instrument. Results. After a successful polymerase chain reaction, two alleles that differed in one nucleotide were detected in our samples. Conclusion. Even though it is financially more demanding, real-time polymerase chain reaction method is recommended for dopamine receptor D2 gene genotyping in routine diagnostics because it is simple, accurate, and fast.