Search

Background Oxidative stress is closely correlated with tumor development and progression, which can act as a latent treatment target for cancer. The purpose of this study was to identified the oxidative stress-related gene (OSRG) profile of cervical cancer and established a novel prognostic prediction model. Methods Differentially expressed OSRGs between cervical cancer and paired normal tissues were extracted from the GeneCards and GEPIA databases. Clinical information was collected from patients with cervical cancer in TCGA cohort. Univariate Cox analysis together with the LASSO algorithm were used to determine prognosis-related genes, construct an OSRG-signature, and derive risk scores. Kaplan–Meier (K-M) survival analysis and receiver operating characteristic (ROC) curves were used to verify the predictive ability of the risk scores. At the same time, the correlation between risk scores and tumor immune cell infiltration and chemosensitivity was observed. Results An 10-OSRG signature was constructed. Patients with cervical cancer were categorized as high-risk or low-risk through the median risk score derived from the 10-OSRG signature. As shown by survival analysis, the median overall survival (OS) time of high-risk patients was significantly shorter than that of low-risk patients. The ROC curves also demonstrated the usefulness of the 10-OSRG signature for predicting the prognosis of cervical cancer patients. The risk scores derived from the 10-OSRG signature and 5 clinical variables were used to develop a nomogram, which can be used to predict 1-, 3-, and 5-year survival rates in patients with cervical cancer. Immunological analysis suggested that the tumor killer immune cells in the low-risk group were higher than those in the high-risk group. The sensitivity of the two subgroups to various chemotherapy drugs were different. Conclusion A novel 10-OSRG signature was constructed and verified to forecast the prognosis of patients with cervical cancer and provide novel insights and directions for cervical carcinoma.

We previously identified the tumor suppressor geneWestern blotting was used to detect the protein levels of TOB1, LC3, AKT, mTOR, phosphorylated (p) AKT, and p-mTOR. A double fluorescent GFP-RFP-LC3 fusion protein was used to trace autophagy by laser confocal microscopy. Autophagosomes were observed by transmission electron microscopy.The conversion of LC3-I to LC3-II and the LC3-II/LC3-I ratio were significantly increased in AGS cells overexpressing TOB1 compared with control cells. Fluorescence imaging showed LC3 puncta at 48 h, and these puncta increased significantly at 72 h after TOB1 transfection compared with control tumor cells. The presence of autophagosomes in AGS cells was observed at 72 h after TOB1 transfection by transmission electron microscopy, and no autophagosomes were found in the control cells. Moreover, the levels of p-AKT and p -mTOR were lower in AGS cells than in control cancer cells.Our results provide novel insight that TOB1 might suppress gastric cancer by inducing autophagy, possibly through decreasing phosphorylation and the subsequent activation of the AKT/mTOR signaling pathway.

Background Polycystic kidney disease (PKD) is an inherited disease that is life‐threatening. Multiple cysts are present in the bilateral kidneys of PKD patients. The progressively enlarged cysts cause structural damage and loss of kidney function. Methods This study examined and analyzed 12 families with polycystic kidney disease. Whole exome sequencing (WES) or whole genome sequencing (WGS) of the probands was performed to detect the pathogenic genes. The candidate gene segments for lineal consanguinity in the family were amplified by the nest PCR followed by Sanger sequencing. The variants were assessed by pathogenic and conservational property prediction analysis and interpreted according to the American College of Medical Genetics and Genomics. Results Nine of the 12 pedigrees were identified the disease causing variants. Among them, four novel variants in PKD1, c.6930delG:p.C2311Vfs*3, c.1216T>C:p.C406R, c.8548T>C:p.S2850P, and c.3865G>A:p.V1289M (NM_001009944.2) were detected. After assessment, the four novel variants were considered to be pathogenic variants and cause autosomal dominant polycystic kidney disease in family. The detected variants were interpreted. Conclusion The four novel variants in PKD1, c.6930delG:p.C2311Vfs*3, c.1216T>C:p.C406R, c.8548T>C:p.S2850P, and c.3865G>A:p.V1289M (NM_001009944.2) are pathogenic variants and cause autosomal dominant polycystic kidney disease in family., This study examined and analyzed 12 families with polycystic kidney disease using whole exome sequencing or whole genome sequencing and several prediction tools. After assessment and interpretion, the four novel variants were considered to be pathogenic variants and cause autosomal dominant polycystic kidney disease in family. The present study enriched the knowledge of the pathogenicity for autosomal dominant polycystic kidney disease and would improve the understanding of this autosomal dominant disorder.

Gene amplification chiefly manifests as homogeneously stained regions (HSRs) or double minutes (DMs) in cytogenetically and extrachromosomal DNA (ecDNA) in molecular genetics. Evidence suggests that gene amplification is becoming a hotspot for cancer research, which may be a new treatment strategy for cancer. DMs usually carry oncogenes or chemoresistant genes that are associated with cancer progression, occurrence and prognosis. Defining the molecular structure of DMs will facilitate understanding of the molecular mechanism of tumorigenesis. In this study, we re‐identified the origin and integral sequence of DMs in human colorectal adenocarcinoma cell line NCI‐H716 by genetic mapping and sequencing strategy, employing high‐resolution array‐based comparative genomic hybridization, high‐throughput sequencing, multiplex‐fluorescence in situ hybridization and chromosome walking techniques. We identified two distinct populations of DMs in NCI‐H716, confirming their heterogeneity in cancer cells, and managed to construct their molecular structure, which were not investigated before. Research evidence of amplicons distribution in two different populations of DMs suggested that a multi‐step evolutionary model could fit the module of DM genesis better in NCI‐H716 cell line. In conclusion, our data implicated that DMs play a very important role in cancer progression and further investigation is necessary to uncover the role of the DMs.

Colorectal cancer (CRC) is the third most developing cancer worldwide and Lynch syndrome (LS) accounts for 3–4% of CRC. Genetic alteration in any of DNA mismatch repair (MMR) gene is the major cause of LS that disrupt the normal upstream and downstream MMR events. Germline mutation of MLH1 in heterozygous state have an increased risk for CRC. Defective MMR pathway mostly results in microsatellite instability (MSI) that occurs in high percentage of CRC associated tumors. Here, we reported a patient with LS like metastatic CRC (mCRC) associated with other related cancers. Whole exome sequencing (WES) of the proband was performed to identify potential causative gene. Genetic screening validated by Sanger sequencing identified a heterozygous missense mutation in exon 12 of MLH1 (c.1151T>A, p.V384D). The clinical significance of identified variant was elucidated on the basis of clinicopathological data, computational predictions and various in vitro functional analysis. In silico predictions classified the variant to be deleterious and evolutionary conserved. In vitro functional studies revealed a significant decrease in protein expression because of stability defect leading to loss of MMR activity. Mutant residue found in MutL transducer domain of MLH1 that localized in the nucleus but translocation was not found to be significantly disturbed. In conclusion, our study give insight into reliability of combinatorial prediction approach of in silico and in vitro expression analysis. Hence, we highlighted the pathogenic correlation of MLH1 variant with LS associated CRC as well as help in earlier diagnosis and surveillance for improved management and genetic counselling.

Chemotherapy is one of the main therapeutic strategies used for gastrointestinal tract adenocarcinomas (GTAs), but resistance to anticancer drugs is a substantial obstacle in successful chemotherapy. Accumulating evidence shows that non-coding RNAs, especially long non-coding RNAs (lncRNAs) and microRNAs (miRNAs), can affect the drug resistance of tumor cells by forming a ceRNA regulatory network with mRNAs. The efficiency of the competing endogenous RNAs (ceRNAs) network can be affected by the number and integrality of miRNA recognition elements (MREs). Dynamic factors such as RNA editing, alternative splicing, single nucleotide polymorphism (SNP), RNA-binding proteins and RNA secondary structure can influence the MRE activity, which may in turn be involved in the regulation of chemoresistance-associated ceRNA network by prospective approaches. Besides activities in a single tumor cell, the components of the tumor micoenvironment (TME) also affect the ceRNA network by regulating the expression of non-coding RNA directly or indirectly. The alternation of the ceRNA network often has an impact on the malignant phenotype of tumor including chemoresistance. In this review, we focused on how MRE-associated dynamic factors and components of TME affected the ceRNA network and speculated the potential association of ceRNA network with chemoresistance. We also summarized the ceRNA network of lncRNAs, miRNAs, and mRNAs which efficiently triggers chemoresistance in the specific types of GTAs and analyzed the role of each RNA as a "promoter" or "suppressor" of chemoresistance.

Background Synpolydactyly type 1 (SPD1), also known as syndactyly type II, is an autosomal dominant limb deformity generally results in webbing of 3rd and 4th fingers, duplication of 4th or 5th toes. It is most commonly caused by mutation in HOXD13 gene. In this study, a five-generation Chinese family affected with SPD1 disease were collected. We tried to identify the pathogenic variations associated with SPD1 involved in the family. Methods We used the whole genome sequencing (WGS) to identify the pathogenic variant in this family which was later confirmed by PCR-Sanger sequencing. The genetic variation were evaluated with the frequencies in the 1000 Genome Project and Exome Aggregation Consortium (ExAC) dataset. The significance of variants were assessed using different mutation predictor softwares like Mutation Taster, PROVEAN and SIFT. The classification of variants was assessed according to American College of Medical Genetics and Genomics (ACMG) guidelines. Results Our results showed the mutation of 24-base pair duplication (c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC) in exon one of HOXD13 in heterozygous form which was predicted to result in eight extra alanine (A) residues in N-terminal domain of HOXD13 protein. The mutation was detected in all affected members of the family. Conclusion Based on our mutation analysis of variant c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC in HOXD13 and its cosegregation in all affected family members, we found this variant as likely pathogenic to this SPD1 family. Our study highlights variable expressivity of HOXD13 mutation. Our results also widen the spectrum of HOXD13 mutation responsible for SPD1.

Polycystic kidney disease (PKD) is a life‑threatening inherited disease with a morbidity of 1:500‑1,000 worldwide. Numerous progressively enlarging cysts are observed in the bilateral kidneys of patients with PKD, inducing structural damage and loss of kidney function. The present study analyzed one family with PKD. Whole exome sequencing of the proband was performed to detect the pathogenic gene present in the family. Candidate gene segments for lineal consanguinity in the family were amplified by nest polymerase chain reaction, followed by Sanger sequencing. One novel duplication variant (NM_001009944.2:c.9359dupA:p.Y3120_E3121delinsX) and one missense mutation (c.G9022A:p.V3008M) were detected in PKD1. Additionally, the pathogenic substitutions in PKD1 published from the dataset were analyzed. Following analysis and confirmation, the duplication variant NM_001009944.2:c.9359dupA:p.Y3120_E3121delinsX in PKD1, within the polycystin‑1, lipoxygenase, α‑toxin domain, was considered to be the pathogenic factor in the examined family with autosomal dominant PKD. Additionally, based on the analysis of 4,805 pathogenic substitutions in PKD1 within various regions, the presence of the missense mutation in the N‑terminal domain of polycystin‑1 may present high pathogenicity in ADPKD.

Additional file 1: Table S1. Mutations in limb development genes found in WGS

The location of populations. The six minority populations from Hezhen, Daur, Manchu, Korea, Mongolian and Ewenki are located in Heilongjiang Province (around 45°44’N126°39′E). CHB indicates Han Chinese in Beijing (around39°55’N116°27′E). CHS indicates Southern Han Chinese located in Sichuan province (around 30°22’N103°26′E). CDX indicates Chinese Dai in Xishuangbanna (around 22°3’N100°49′E). Greenlandic Inuit population live in area around 71°43’N42°24’W. Northeast Siberian population live in the northeast of Russia (around 78°50’N112°50′E). (DOCX 109 kb)

The frequencies of three polymorphisms in 11 populations Table S2 The P values for rs7115739 compared between six minorities in northern China and three populations in southern China. (DOCX 16Â kb)