Search

Benchmarks and metrics related to laboratory test utilization are based on evidence-based medical literature that may suffer from a positive publication bias. Guidelines are only as good as the data reviewed to create them. Disruptive technologies require time for appropriate use to be established before utilization review will be meaningful. Metrics include monitoring the use of obsolete tests and the inappropriate use of lab tests. Test utilization by clients in a hospital outreach program can be used to monitor the impact of new clients on lab workload. A multi-disciplinary laboratory utilization committee is the most effective tool for modifying bad habits, and reviewing and approving new tests for the lab formulary or by sending them out to a reference lab., (Copyright © 2013 Elsevier B.V. All rights reserved.)

Rapid detection of nasal colonization with methicillin-resistant Staphylococcus aureus (MRSA) followed by appropriate infection control procedures reduces MRSA infection and transmission. We compared the performance and workflow of two Food and Drug Administration-approved nucleic acid amplification assays, the LightCycler MRSA Advanced Test and the Xpert MRSA test, with those of directly plated culture (MRSASelect) using 1202 nasal swabs collected at three U.S. sites. The sensitivity of the LightCycler test (95.2%; 95% CI, 89.1% to 98.4%) and Xpert assay (99%; 95% CI, 94.8% to 100%) did not differ compared with that of culture; the specificity of the two assays was identical (95.5%; 95% CI, 94.1% to 96.7%) compared with culture. However, sequencing performed on 71 samples with discordant results among the three methods confirmed the presence of MRSA in 40% of samples that were positive by both molecular methods but negative by culture. Workflow analysis from all sites including batch runs revealed average hands-on sample preparation times of 1.40, 2.35, and 1.44 minutes per sample for the LightCycler, Xpert, and MRSASelect methods, respectively. Discrete event simulation analysis of workflow efficiencies revealed that the LightCycler test used less hands-on time for the assay when greater than eight batched samples were run. The high sensitivity and specificity, low hands-on time, and efficiency gains using batching capabilities make the LightCycler test suitable for rapid batch screening of MRSA colonization., (Copyright © 2012 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.)

Point-of-care testing (POCT) is defined as analytic testing performed outside the central laboratory using a device or devices that can be easily transported to the vicinity of the patient. This article discusses rules and regulations concerning POCT, especially those covering provider-performed microscopy (PPM). Types of PPM are also covered, including the fern test, tests for the presence on fecal leukocytes and pinworms, and examinations of urine sediment and seminal fluid. The coordination of PPM within a hospital is also covered.

Turnaround time for molecular diagnostic tests is critical in detecting infectious agents, in determining a patient's ability to metabolize a drug or drug class, and in detecting minimal residual disease. These applications would benefit from the development of a point-of-care device for nucleic acid extraction, amplification, and detection. The ideal device would have a low cost per test, use a disposable unit use device for all steps in the assay, be portable, and provide a result that requires no interpretation. The creation of such a device requires miniaturization of current technologies and the use of microfluidics, microarrays, and small-diameter capillary tubes to reduce reagent volumes and simplify heat conduction by convection during nucleic acid amplification. This ideal device may be available in 3 to 5 years and will revolutionize and expand the global availability of molecular diagnostic assays.

The following abstracts are compiled from Check Sample exercises published in 2008. These peer-reviewed case studies assist laboratory professionals with continuing medical education and are developed in the areas of clinical chemistry, cytopathology, forensic pathology, hematology, microbiology, surgical pathology, and transfusion medicine. Abstracts for all exercises published in the program will appear annually in AJCP.

Context: The field of molecular pathology is expanding in complexity. To achieve competency, vigilance is required., Objective: To review the advances in clinically useful molecular biologic techniques and to identify their applications in clinical practice, as presented at the 13th Annual William Beaumont Hospital DNA Symposium., Data Sources: The 4 manuscripts submitted were reviewed and their major findings were compared with the literature on the same or related topics., Study Selection: Manuscripts address the use of molecular or immunophenotyping by flow cytometry to evaluate the origin or presence of sepsis, respectively; the use of imatinib mesylate to treat chronic myeloid leukemia and the nature of resistance to imatinib; and the use of 9 and 10 fluorochromes during clinical flow cytometric studies., Data Synthesis: The epidemiologic evaluation of a septic outbreak may be monitored using molecular techniques that track the relatedness of isolates. A potential biomarker for the presence of early sepsis is CD64. Intracellular signal transduction pathways are altered in malignancy. Imatinib mesylate inhibits the BCR-ABL kinase created by translocation of the long arms of chromosomes 9 and 22 in chronic myeloid leukemia. Resistance to imatinib may be secondary to mutation in the BCR-ABL kinase domain or residual leukemic stem cells that imatinib does not kill. The use of 9 or 10 fluorochromes simultaneously during flow cytometry has many clinical advantages; however, software for data analysis is needed., Conclusion: The current postgenomic era will continue to emphasize the use of microarrays and database software for genomic, transcriptomic, proteomic, nutrigenomic, and pharmacogenomics screening to search for a useful clinical assay. The number of molecular pathologic techniques will expand as additional disease-associated mutations are defined.

Fatty acid synthase (FAS) regulates the production of fatty acids and plays a role in regulating apoptosis. Hoechst 33342-induced apoptosis in BC3H-1 myocytes was used as a model to explore intracellular changes in FAS protein (Western blot) and FAS mRNA (RT-PCR). Total lipid and individual phospholipid synthesis was inhibited by a lethal dose of Hoechst 33342 (20 microg/ml) while total lipid and phospholipid degradation ([1-14C]-acetate pulse chase method) were not. Hoechst 33342 at 20 microg/ml reduced the concentration of FAS protein, which was followed more than 6 hr later by a reduction in FAS mRNA. In conclusion, the inhibition of fatty acid synthesis induced by 20 microg/ml of Hoechst 33342 is attributed to the degradation of FAS protein by activated caspases rather than by inhibition of FAS enzyme activity or FAS mRNA synthesis.

The field of molecular diagnostics has greatly decreased the time it takes to identify infectious agents and to test their antimicrobial resistance. Portable devices are currently in development that can easily identify a variety of nucleic acid targets (either DNA or RNA) from multiple sample types in under an hour. This is done by a variety of methods including real-time polymerase chain reaction, probe-based assays, bioluminescence real-time amplification, and microarray or micro-pump technologies. These self-contained systems require only minimal training and perform all steps of the assay from extraction through detection with little or no operator intervention.

Context: Warfarin is a widely used anticoagulant with efficacy in treatment and prevention of thrombosis. Patient management, however, is difficult because of interindividual variation in response to standard doses due to significant differences in metabolic rates. Warfarin metabolism is under genetic control, involving primarily the CYP2C9 gene encoding the enzyme that catalyzes the conversion of warfarin to inactive metabolites., Objective: Several polymorphisms of CYP2C9 have been reported; the variant alleles *2 and *3 have decreased enzymatic activity. The objective of this case study is to investigate the relationship between CYP2C9 genotype and warfarin anticoagulation., Design: A case of deep vein thrombosis treated with the standard warfarin dose is investigated for intensity of anticoagulation and CYP2C9 genotype; the case illustrates the relationship between CYP2C9 variant and overanticoagulation with subsequent bleeding complication., Results: The patient's genotype, CYP2C9*1*3, correlated with an exaggerated anticoagulant response during the initiation of warfarin therapy at standard dose, and a bleeding episode ensued. Based on heterozygosity for the *3 variant allele, it was recommended that the patient be maintained on a low-dose warfarin regimen., Conclusions: The practical implications of identifying genetic risk factors that lead to overanticoagulation are multiple. Genotype knowledge of the CYP2C9 variant alleles may help the clinician to individualize warfarin therapy with the ultimate goals of shortening the initial period of induction therapy, reaching a stable maintenance dose earlier, and minimizing bleeding complications in patients who are high responders and need lower warfarin doses.

Context: The pyrimidine nucleoside analog, cytosine arabinoside (Ara-C), is an effective therapeutic agent for acute leukemia. The phosphorylated triphosphate, cytosine arabinoside triphosphate, competes with deoxycytosine triphosphate as a substrate for incorporation into DNA. Once incorporated into DNA, it inhibits DNA polymerase and topoisomerase I and modifies the tertiary structure of DNA., Objective: To determine if the substitution of Ara-C for cytosine in double-stranded oligonucleotides that contain 4 specific transcription factor binding sites (TATA, GATA, C/EBP, and AP-2alpha) alters transcription factor binding to their respective DNA binding elements., Design: Transcription factors were obtained from nuclear extracts from human promyelocytic leukemia HL-60 cells. [32P]-end-labeled double-stranded oligonucleotides that contained 1 or 2 specific transcription factor binding sites with or without Ara-C substitution for cytosine were used to assess transcription factor binding by electrophoretic mobility shift assay., Results: The substitution of Ara-C for cytosine within and outside the transcription factor binding element (AP-2alpha, C/EBP), outside the binding element only (GATA, TATA), or within the binding element only (AP-2alpha) all result in a reduction in transcription factor binding to their respective DNA binding element., Conclusion: The reduction of the binding capacity of transcription factors with their respective DNA binding elements may depend on structural changes within oligonucleotides induced by Ara-C incorporation. This altered binding capacity of transcription factors to their DNA binding elements may represent one mechanism for Ara-C cytotoxicity secondary to inhibition of transcription of new messenger RNAs and, subsequently, translation of new proteins.

Objective: To review the advances in clinically useful molecular biologic techniques and to identify their applications, as presented at the 12th Annual William Beaumont Hospital DNA Symposium., Data Sources: The 7 manuscripts submitted were reviewed and their major findings were compared with literature on the same or related topics., Study Selection: Manuscripts address the use of molecular techniques in the detection of severe acute respiratory syndrome (SARS) and bacterial ribosome mutations, which may lead to ribosome-targeted drug resistance; pharmacogenomics as a clinical laboratory service and example of warfarin dosing using CYP2C9 mutation analysis; definition of the potential of cytosine arabinoside incorporation into DNA to disrupt transcription using an in vitro model of oligonucleotides; use of laser capture microdissection to isolate solid tumor cells free of nontumor cells; and molecular methods used to classify lymphomas., Data Synthesis: Two current issues related to the use of molecular tests in the clinical laboratories are (1) decentralization of molecular-based testing to a variety of nonmolecular laboratories and (2) need for wider acceptance of molecular-based testing through its incorporation in clinical practice guidelines. Molecular methods have had a major impact on infectious disease through the rapid identification of new infectious agents, SARS, and the characterization of drug resistance. Pharmacogenomics identifies the genetic basis for heritable and interindividual variation in response to drugs. The incorporation of the nucleoside analog, cytosine arabinoside, into DNA leads to local perturbation of DNA structure and reduces the ability of transcription factors to bind to their specific DNA binding elements as measured by electrophoretic mobility shift assays. Laser capture microdissection of tumor cells can provide an adequate number of cells for whole genome amplification. Gene expression microassay profiles of various lymphomas have modified classification systems and predict prognosis and response to therapy., Conclusions: The current -omics era will continue to emphasize the use of microarrays and database software for genomic, transcriptomic, and proteomic screening to search for a useful clinical assay. The number of molecular pathologic techniques will expand as additional disease-associated mutations are defined.

Glycosphingolipids are ubiquitous membrane constituents that are subdivided in neutral or acidic fractions (gangliosides and sulfatides). Their analysis requires extraction and separation by thin-layer chromatography or high-performance liquid chromatography. Ganglioside composition changes occur in response to variations in cellular morphology and function. Glycosphingolipids are implicated in the pathogenesis of various diseases, including glycosphingolipidoses, peripheral neuropathies caused by anti-ganglioside antibodies, and secretory diarrhea. Gangliosides play a role in the induction of apoptosis. For example, ceramide-induced apoptosis is associated with increased synthesis of a ganglioside, GD3. Gangliosides are also potential diagnostic markers and therapeutic targets for cancer.

Abstract. Hoechst 33342's effects on apoptosis and mitochondrial membrane potential (delta psi) were investigated in a myelogenous leukemia cell line, HL-60. Delta psi was detected with 2 lipophilic cationic fluorochromes: 3,3'-dihexyloxacarbocyanine iodide [DiOC6(3)] or 5,5',6,6'-tetrachloro-1,1',3,3'-tetraethylbenzimidazolylcarbocyanine iodide (JC-1). Mitochondrial mass was measured with nonyl acridine orange (NAO). Protonophore carbonyl cyanide m-chlorophenylhydrazone (CCCP) depolarized mitochondria in control experiments. Cell viability was determined by propidium iodide uptake. Hoechst 33342 at 10-20 mg/L decreased fluorescence for DiOC6(3) at 0.5 hr. The fluorescence partially normalized at 3 hr and then progressively decreased at 5-24 hr, resulting in cell shrinkage and death. Mitochondrial mass decreased 40-70% by 1 hr and 70-90% at 24 hr. A lower concentration of Hoechst 33342, 5 mg/L, reduced the delta psi at 0.5 hr, but delta psi returned to control values after 3 hr. Mitochondrial mass decreased 30-40% and then partially normalized, and cell viability was > 92% at 24 hr. Protonophore carbonyl cyanide m-chlorophenylhydrazone lowered delta psi with little cell death. Thus, at high concentration, Hoechst 33342 induces depolarization of delta psi and subsequent apoptosis. Lack of apoptosis at low concentration of Hoechst 33342, despite depolarization of delta psi, indicates that mitochondrial membrane depolarization alone is insufficient to induce apoptosis.

Background: Hoechst 33342 and Hoechst 33258 bind to the minor groove of DNA. Hoechst 33342 induces apoptosis in a variety of cell types by a mechanism that is associated with disruption of the formation of the TATA box-binding protein/DNA complex., Objective: To further investigate the role of Hoechst 33342 in gene regulation using BC3H-1 myocytes transfected with 4 different pGL3 luciferase reporter vectors constructed with or without the SV40 promoter and/or enhancer regions or with 2 synthetic Renilla luciferase vectors (phRL-null and phRL-TK)., Methods: Luciferase messenger RNA content was measured by reverse transcriptase-polymerase chain reaction, and luciferase activity was measured by luminometry. The ability of transcription factors in nuclei prepared from BC3H-1 myocytes to bind to a [32P]-labeled 24-base pair oligonucleotide containing the TATA box-binding element was determined by a gel mobility shift assay., Results: In vivo, 4.4 and 8.9 microM of Hoechst 33342 (sublethal doses) increased luciferase enzyme activity in cells transfected with each of the 4 pGL3 luciferase reporter vectors and both of the Renilla luciferase vectors. Hoechst 33258 had no effect on luciferase enzyme activity. In vitro, Hoechst 33342 increased transcription factor binding to the 24-mer oligonucleotide containing the TATA box-binding element, which would be favorable to increased RNA polymerase II efficiency., Conclusion: Hoechst 33342 stimulates luciferase activity by a pathway that is independent of the integrity of the promoters in the luciferase gene expression vectors used (pGL3 basic, pGL3 control, pGL3 enhancer, and pGL3 promoter vectors, phRL-null, or phRL-TK).

Oxalyl thiolesters (RS-CO-COOH) may represent negative intracellular messengers for insulin action. Using a reverse-phase, ion-pair high pressure liquid chromatographic technique, total intracellular oxalyl thiolesters were measured in insulin-sensitive BC3H-1 myocytes after the addition of insulin. The total oxalyl thiolester concentration increased to a maximum of 2.9 times the basal concentration by 30 min after the addition of 100 microU/ml insulin and decreased to 1.8 times by 180 min. Insulin's stimulation of pyruvate dehydrogenase as measured by lactate oxidation ([1-14C]-lactate --> 14CO2) in intact BC3H-1 myocytes reached a maximum at 15-30 min and returned to basal activity during the 60-90 min measurement interval. These results suggest that oxalyl thiolesters are increased in concentration following insulin-induced signal transduction to reverse insulin-stimulated metabolic events.

Apoptosis and necrosis represent two distinct types of cell death. Apoptosis possesses unique morphologic and biochemical features which distinguish this mechanism of programmed cell death from necrosis. Extrinsic apoptotic cell death is receptor-linked and initiates apoptosis by activating caspase 8. Intrinsic apoptotic cell death is mediated by the release of cytochrome c from mitochondrial and initiates apoptosis by activating caspase 3. Cancer chemotherapy utilizes apoptosis to eliminate tumor cells. Agents which bind to the minor groove of DNA, like camptothecin and Hoechst 33342, inhibit topoisomerase I, RNA polymerase II, DNA polymerase and initiate intrinsic apoptotic cell death. Hoechst 33342-induced apoptosis is associated with disruption of TATA box binding protein/TATA box complexes, replication protein A/single-stranded DNA complexes, topoisomerase I/DNA cleavable complexes and with an increased intracellular concentration of E2F-1 transcription factor and nitric oxide concentration. Nitric oxide and transcription factor activation or respression also regulate the two apoptotic pathways. Some human diseases are associated with excess or deficient rates of apoptosis, and therapeutic strategies to regulate the rate of apoptosis include inhibition or activation of caspases, mRNA antisense to reduce anti-apoptotic factors like Bcl-2 and survivin and recombinant TRAIL to activate pro-apoptotic receptors, DR4 and DR5.

Objectives: To review the advances in clinically useful molecular biological techniques and to identify their applications in clinical practice, as presented at the Tenth Annual William Beaumont Hospital DNA Symposium., Data Sources: The 11 manuscripts submitted were reviewed and their major findings were compared with literature on the same topic., Study Selection: Manuscripts address creative thinking techniques applied to DNA discovery, extraction of DNA from clotted blood, the relationship of mitochondrial dysfunction in neurodegenerative disorders, and molecular methods to identify human lymphocyte antigen class I and class II loci. Two other manuscripts review current issues in molecular microbiology, including detection of hepatitis C virus and biological warfare. The last 5 manuscripts describe current issues in molecular cardiovascular disease, including assessing thrombotic risk, genomic analysis, gene therapy, and a device for aiding in cardiac angiogenesis., Data Synthesis: Novel problem-solving techniques have been used in the past and will be required in the future in DNA discovery. The extraction of DNA from clotted blood demonstrates a potential cost-effective strategy. Cybrids created from mitochondrial DNA-depleted cells and mitochondrial DNA from a platelet donor have been useful in defining the role mitochondria play in neurodegeneration. Mitochondrial depletion has been reported as a genetically inherited disorder or after human immunodeficiency virus therapy. Hepatitis C viral detection by qualitative, quantitative, or genotyping techniques is useful clinically. Preparedness for potential biological warfare is a responsibility of all clinical laboratorians. Thrombotic risk in cardiovascular disorders may be assessed by coagulation screening assays and further defined by mutation analysis for specific genes for prothrombin and factor V Leiden. Gene therapy for reducing arteriosclerotic risk has been hindered primarily by complications introduced by the vectors used to introduce the therapeutic genes. Neovascularization in cardiac muscle with occluded vessels represents a promising method for recovery of viable tissue following ischemia., Conclusions: The sequence of the human genome was reported by 2 groups in February 2001. The postgenomic era will emphasize the use of microarrays and database software for genomic and proteomic screening in the search for useful clinical assays. The number of molecular pathologic techniques and assays will expand as additional disease-associated mutations are defined. Gene therapy and tissue engineering will represent successful therapeutic adjuncts.

Replication protein A (RPA) is a single-stranded DNA-binding protein which plays a role in DNA replication, repair, and recombination. We used gel mobility shift, super gel mobility shift, and Western blot to determine the fate of RPA during Hoechst 33342-induced apoptosis in HL-60 cells. Multiple bands were detected by gel mobility shift after the incubation of single-stranded gamma-(32)P-labeled oligo(dT)(30) with the nuclear extracts of HL-60 cells. Super gel mobility shift results indicated that only the highest molecular weight protein/oligo(dT)(30) complexes bound with anti-human RPA-32 and/or anti-human RPA-70 antibodies forming RPA/oligo(dT)(30) complexes. After the treatment of HL-60 cells with 15 microg/ml Hoechst 33342 for 3 h, the bands of RPA/oligo(dT)(30) complexes were decreased and bands of the lowest molecular weight protein/oligo(dT)(30) complexes were significantly increased when compared to the control group. These low-molecular-weight bands did not bind with RPA-32 or RPA-70 antibodies. Western blotting results showed that both RPA-32 and RPA-70 were decreased significantly in a time-dependent manner after 1 h of incubation with Hoechst 33342. These results demonstrate that in HL-60 cells, Hoechst 33342-induced apoptosis is associated with a rapid loss of the binding capacity of RPA to oligo(dT)(30) as well as immunoactive RPA-70 and RPA-32., (Copyright 2001 Academic Press.)

The category of provider-performed microscopy was defined in the Federal Register to provide a unique regulatory approach for bright-field and phase-contrast microscopy performed by a physician, dentist, or midlevel practitioner examining labile specimens. A CLIA certificate for this category of testing is available, which also permits the performance of waived tests. Because these provider-performed microscopy procedures do not have quality-control materials available, special challenges are encountered in establishing and monitoring such testing within a hospital. Vigilance is required to maintain a provider-performed microscopy program within a hospital.

Objective: To review the advances in clinically useful molecular biological techniques and their applications in clinical practice as presented at the Ninth Annual William Beaumont Hospital DNA Symposium., Data Sources: The 10 manuscripts submitted were reviewed and their major findings were compared with literature on the same topic., Study Selection: One manuscript reviewed the development of pharmacogenetics, 3 described analytic approaches to detect aneuploidy or cancer, 1 described transcription factor E2F-1 increase during apoptosis, 2 reported on genetic and pharmacologic factors that influence platelet aggregation, 2 described molecular methods for detecting long QT syndrome or mycobacteria, and 1 reported a modification in collection of buccal DNA., Data Synthesis: Genomic and proteomic approaches to develop clinically useful assays have been successful. Aneuploidy can be easily detected by comparative genomic hybridization, which does not require cell culture like cytogenetics. Mutations have been characterized for a variety of hereditary cancer syndromes, 2 inherited long QT syndromes, and thromboembolism. PlA1 and PlA2 polymorphisms in platelets are associated with a difference in aggregation inhibition by estrogen, another example of genotypic pharmacogenetics. Protein expression differences may define colorectal cancer stage and explain apoptotic signal transduction. Mycobacterial detection by nucleic acid amplification and simplified buccal DNA collection demonstrate cost-effective strategies., Conclusion: The working draft of the Human Genome Project is completed and the number of clinically useful molecular pathologic techniques and assays will expand as additional disease-associated mutations are defined. Expanded use of database software for genomic and proteomic screening should increase the efficiency of clinical useful assay development.

Context: Hoechst 33342 induces apoptosis, inhibits topoisomerase I, and disrupts TATA box-binding protein/TATA box element binding in BC3H-1 myocytes and HL-60 cells. In contrast, Hoechst 33258 does not have any of these actions., Objective: To determine if Hoechst 33342 or Hoechst 33258 treatment of BC3H-1 myocytes or HL-60 cells is associated with the intracellular accumulation of the nuclear transcription factor E2F-1, known to induce apoptosis., Methods: The gel mobility shift assay was used to study the effect of the 2 compounds on the binding capacity of nuclear proteins extracted from the 2 cell lines to a 30-base pair double-stranded oligonucleotide that contained an E2F-1-binding element. The DNA sequence of the protein-binding region was determined by the protection footprinting method and the Maxam-Gilbert guanosine plus adenosine chemical sequencing reaction., Results: Nuclear extracts from each cell line treated with 26.7 micromol/L Hoechst 33342 or Hoechst 33258 for 3 to 24 hours were incubated with [32P]-labeled 30-base pair oligonucleotide (5'GGCGCGGAGACTTGGAGAAATTTGGCGCGG3'). Three protein and DNA bands were altered by Hoechst 33342, but not by Hoechst 33258: band I, increased, then decreased in both cell lines; band II (2 adjacent bands) markedly decreased in both cell lines; band III markedly increased only in HL-60 cells. Footprinting and sequencing demonstrated that the nuclear protein-binding sequence was TTTGGCGC, an E2F-1 binding site. Hoechst 33342 treatment increased the concentration of E2F-1 protein after a 3-hour incubation in both cell lines., Conclusion: Hoechst 33342-induced apoptosis is associated with intracellular accumulation of E2F-1 protein, another step in this specific apoptotic pathway.

Objectives: To review the advances in clinically useful molecular biological techniques and to identify their applications in clinical practice, as presented at the Eighth Annual William Beaumont Hospital Symposium., Data Sources: The 10 manuscripts submitted were reviewed, and their major findings were compared with literature on the same topic., Study Selection: Two manuscripts addressed specimen (nucleic acid) stability, 2 described novel analytic approaches, 3 discussed detection of B- or T-cell clonality in lymphoproliferative disorders, and 3 reported the frequency of a variety of genetic polymorphisms found in cardiac disorders., Data Synthesis: DNA from dried blood spots is stable and may be purified rapidly for amplification and mutation analysis. RNA is much less stable, and a variety of methods may be used to reduce ribonuclease degradation of enteroviral RNA. False-negative reactions may be reduced by genomic amplification of ligated padlock probes by cascade rolling circle or polymerase chain reaction. A multiplex polymerase chain method using fluorescence-labeled products that separate both the wild-type and mutant hemochromatosis gene alleles by capillary gel electrophoresis represents another approach for detecting the 2 major missense mutations (C282Y and H63D) in hemochromatosis. Southern blotting and polymerase chain reaction have been used to detect B- and T-cell clonality in lymphoproliferative diseases, including mantle cell lymphoma and lymphoma of the breast. Genetic polymorphisms in a variety of coagulation factors and platelet glycoprotein IIIa are associated with ischemic heart disease., Conclusions: As the Human Genome Project continues to define disease-associated mutations, the number of clinically useful molecular pathologic techniques and assays will expand. Clinical outcome analysis is still required to document a decrease in the patient's length of stay to offset the cost of introducing molecular biological assays in the routine clinical pathology laboratory.

Human cells contain deoxyribonucleic acid in mitochondria and nuclei. Human diseases may be caused by mutations in mitochondrial DNA, nuclear DNA or both. The volume of work performed in the diagnostic molecular pathology laboratory will continue to grow as more disease-related mutations are discovered. Many factors will influence the diagnostic molecular pathology laboratory in the 21st century, such as future clinical laboratory organization, amplification methods, specimen integrity, ethical guidelines and opportunities to expand service. In the evaluation of a patient suspected of a mitochondrial DNA mutation, care must be exercised in the selection of a primer for amplification and of the specimen to be examined for the mutation. The uneven distribution of normal and abnormal mitochondrial DNA within the various tissues (heteroplasmy) may result in a normal mitochondrial DNA sequence if the wrong tissue is examined. The presence of mitochondrial-like sequences (pseudogenes) within nuclear DNA may result in amplification of nuclear genes if generic primers are used to duplicate a mitochondrial DNA gene. Diabetes mellitus is a heterogeneous disease with mutations occurring in a variety of proteins leading to either prereceptor, receptor or postreceptor defects. In this example, the diagnostic molecular pathology laboratory may be asked to define the specific genotype a specific patient with this common phenotype may possess.

Hoechst 33342 and Hoechst 33258 bind to adenine-thymine rich regions of the minor groove of DNA. Hoechst 33342, but not Hoechst 33258, induces BC3H-1 myocyte cell death and DNA fragmentation into an internucleosomal pattern characteristics of apoptosis. Hoechst 33342 has been shown to inhibit endogenous nuclear topoisomerase I activity. Another enzymatic activity utilizing the minor groove of DNA, the initiation of RNA polymerase II activity by formation of a TATA box binding protein/TATA box promoter complex, is shown to be altered using a gel mobility shift assay. A [32P]-labeled 24-oligonucleotide containing a TATA box element formed one molecular weight complex in control and Hoechst 33258 treated cells. The presence of Hoechst 33342 (26.7 microM) decreased the amount of the control complex and increased the presence of lower molecular weight species suggesting degradation of nuclear TBP and/or release of other transcription factors from the complex creating a smaller sized molecular complex which retains TATA box binding capacity. These results suggest that the pathway utilized to induce apoptosis in BC3H-1 myocytes may also involve the alteration of normal TBP/DNA complex formation and reduction in the initiation of new transcription.

Objectives: Existing handheld glucose meters are glucose oxidase (GO)-based. Oxygen side reactions can introduce oxygen dependency, increase potential error, and limit clinical use. Our primary objectives were to: a) introduce a new glucose dehydrogenase (GD)-based electrochemical biosensor for point-of-care testing; b) determine the oxygen-sensitivity of GO- and GD-based electrochemical biosensor test strips; and c) evaluate the clinical performance of the new GD-based glucose meter system in critical care/hospital/ambulatory patients., Design: Multicenter study sites compared glucose levels determined with GD-based biosensors to glucose levels determined in whole blood with a perchloric acid deproteinization hexokinase reference method. One site also studied GO-based biosensors and venous plasma glucose measured with a chemistry analyzer. Biosensor test strips were used with a handheld glucose monitoring system. Bench and clinical oxygen sensitivity, hematocrit effect, and precision were evaluated., Setting: The study was performed at eight U.S. medical centers and one Canadian medical center., Patients: There were 1,248 patients., Results: The GO-based biosensor was oxygen-sensitive. The new GD-based biosensor was oxygen-insensitive. GD-based biosensor performance was acceptable: 2,104 (96.1%) of 2,189 glucose meter measurements were within +/-15 mg/dL (+/-0.83 mmol/L) for glucose levels of < or = 100 mg/dL (< or = 5.55 mmol/L) or within +/-15% for glucose levels of > 100 mg/dL, compared with the whole-blood reference method results. With the GD-based biosensor, the percentages of glucose measurements that were not within the error tolerance were comparable for different specimen types and clinical groups. Bracket predictive values were acceptable for glucose levels used in therapeutic management., Conclusions: The performance of GD-based, oxygen-insensitive, handheld glucose testing was technically suitable for arterial specimens in critical care patients, cord blood and heelstick specimens in neonates, and capillary and venous specimens in other patients. Multicenter findings benchmark the performance of bedside glucose testing devices. With the new +/-15 mg/dL --> 100 mg/dL --> +/-15% accuracy criterion, point-of-care systems for handheld glucose testing should score 95% (or better), as compared with the recommended reference method. Physiologic changes, preanalytical factors, confounding variables, and treatment goals must be taken into consideration when interpreting glucose results, especially in critically ill patients, for whom arterial blood glucose measurements will reflect systemic glucose levels.

Hoechst 33342, a bisbenzimidazole dye, binds to adenine/thymine rich regions in the minor groove of deoxyribonucleic acid (DNA). This dye induces apoptosis in BC3H-1 myocytes. The mechanism of Hoechst 33342-induced apoptosis was investigated. Inhibitors of ribonucleic acid (RNA) synthesis, protein synthesis, and serine or cysteine proteases failed to prevent BC3H-1 myocyte death induced by Hoechst 33342. Apoptosis may be dependent on increased p53 expression. Hoechst 33342 had no effect on p53 expression in BC3H-1 myocytes. Lactate oxidation, a monitor of mitochondrial function, was altered by Hoechst 33342 in dose dependent manner. Also, nuclear extracts were used to assay endogenous topoisomerase I activity which was inhibited by Hoechst 33342 treatment of BC3H-1 myocytes. Therefore, Hoechst 33342 appears to initiate apoptosis in BC3H-1 myocytes by a pathway which is independent of de novo RNA and protein synthesis. However, the dye does initiate mitochondrial dysfunction and inhibition of nuclear topoisomerase I as two important steps in the apoptotic pathway.

Bisbenzimidazoles (Hoechst 33342 and Hoechst 33258) are cell permeable, adenine-thymine binding fluorescent dyes used to stain deoxyribonucleic acid (DNA) during the evaluation of cell cycle, induction of apoptosis by various ligands and cell viability by flow cytometry. These dyes inhibit topoisomerase I activity in vitro, like camptothecin. In this study, Hoechst 33342 is shown to induce apoptosis at concentration of 10 micrograms/mL or greater after 3 hours incubation in Dulbecco's Modified Eagle Medium characterized by rounded cell morphology, half-moon nuclei with condensed chromatin and a DNA fragmentation ladder of 180 base pair multiples. Hoechst 33258 at the same molarity or seven times greater molarity did not induce apoptosis. If the BC3H-1 myocytes were incubated in RPMI-1640 media, two times the concentration of Hoechst 33342 (20 micrograms/mL) was required to initiate apoptosis. Staining of unfixed cells with Hoechst 33342 may induce apoptosis in the absence of ligands. Therefore, Hoechst 33342 concentration and staining interval should be tested before ligands which may induce apoptosis are evaluated.

The use of molecular diagnostic testing is increasing in the clinical setting; therefore, data regarding DNA stability in clinical specimens are essential for correct test performance and interpretation. This study was designed to determine DNA stability in peripheral blood and solid tissue under different storage conditions. DNA quality and yield were assayed by spectrophotometric absorbance, gel electrophoresis, and suitability for Southern hybridization and polymerase chain reaction (PCR), the most widely employed clinical DNA analyses. A second goal of the study was to evaluate DNA stability during storage at 4 degrees C for 1 month to 3 years. The data show that freezing or refrigeration of separated leukocytes is preferable for short- to intermediate-term storage and freezing is preferable for solid tissue. DNA degradation varying from slight to severe is seen inconsistently with such specimens, probably due to sampling of unevenly frozen-tissue areas. Depending on the degree of DNA degradation, analysis may still be possible by PCR and in some cases even by Southern hybridization. Once isolated, DNA was stable at 4 degrees C for at least 3 years. These results suggest a more flexible approach to specimen requirements for molecular pathology, as some samples that would routinely be rejected gave interpretable results.

Nitric oxide is generated from L-arginine by the action of nitric oxide synthase, an enzyme encoded by three different genes. Nitric oxide is involved in an expanding number of phenomena. This involvement may be documented by direct detection using spectrophotometric or electrochemical methods or more often by indirect methods. Indirect methods for detection of nitric oxide effects include localization of nitric oxide synthase enzyme by immunochemistry or messenger ribonucleic acid (mRNA) by in situ hybridization, bioassays, inhibition of nitric oxide synthase activity, iron responsive element binding protein activity, and production of nitrate/nitrite, L-citrulline, or cyclic guanosine monophosphate (cGMP). Careful evaluation of potential pitfalls associated with these indirect methods of detecting nitric oxide effects prior to their use will prevent misinterpretation of results.

Reliably diagnosing endometriosis traditionally requires surgery. To evaluate a possible non-surgical method, a case-control series of unexplained infertility patients undergoing diagnostic laparoscopy were scored by clinical criteria and reactivity to human carbonic anhydrase II by Western blotting. The CA II autoantibodies were found in none of the fertile controls, 38 percent of infertile controls, 55 percent of stage 1, 50 percent of stage 2, 73 percent of stage 3, and 85 percent of stage 4 endometriosis patients. Advanced endometriosis was associated with more intense reactivity. Combining clinical and antibody scores for infertile groups showed a positive association with disease stage with positive predictive values of 76 to 95 percent, negative predictive values of 90 to 60 percent, and a likelihood ratio of 18.3. It is concluded by us that CA II immunoreactivity, clinical, and combined scores all identified stages 2 to 4 endometriosis patients. However, based on predictive values and likelihood ratios, the combined score is best at identifying endometriosis non-surgically.

The success of the newest discipline in the diagnostic clinical pathology laboratory, molecular pathology, is dependent on proper collection and storage of both the original and processed (nucleic acid) specimen. This issue will grow in importance as test volumes increase in the diagnostic molecular pathology laboratory. This review is a distillation of a literature review by the Patient Preparation and Specimen Handling Committee of the College of American Pathologists. It describes specific collection, storage, and anticoagulant or preservative requirements based on the diagnostic molecular technique and/or specimen type used for analysis. This review serves as a guide for clinical laboratories interested in appropriate collection and storage of specimens to be used in nucleic acid-based analysis.

Mitochondrial DNA is a circular double-stranded macromolecule. Each strand contains 16 569 base pairs. Mutations in mitochondrial DNA, including base substitutions in tRNA or rRNA genes, deletions, duplications, or base substitutions in genes for protein subunits, lead to specific diseases. The ratio of mutated to normal mitochondrial DNA may vary from tissue to tissue (heteroplasmy) in mitochondrial DNA diseases. Therefore, the source of the specimen is important in the evaluation of mitochondrial DNA mutations. Detection method selection is also critical. For example, single-strand conformation polymorphism is not as specific for tRNA mutations as is gene sequencing or amplification of a specific gene by polymerase chain reaction. Care in both specimen collection and analytic method are important in the successful evaluation of patients with a potential mitochondrial DNA disease.

There are two categories of autoantibodies to specific enzymes: immunoglobulin-complexed enzymes and circulating autoantibodies directed to enzymes in tissue or tissues. Immunoglobulin-complexed enzymes may result in elevated serum enzyme activity. They are found more frequently in elderly patients and have limited clinical significance. Immunoglobulin association with the enzyme must be demonstrated to distinguish this macroenzyme from other high molecular weight enzyme complexes. Autoantibodies to specific enzymes or regulators of enzyme activity do possess specific disease associations. The titers or presence of these autoantibodies may predict morbidity or response to therapy. These autoantibodies may be detected by Western blotting, enzyme-linked immunosorbent assays, tissue immunofluorescence, radioimmunoassay, immunoprecipitation flow cytometry or inhibition of enzyme activity. For example, anti-pyruvate dehydrogenase inhibits the activity of purified enzyme, but not relatively intact mitochondrial preparations. Most evidence suggests that the production of autoantibodies to specific enzymes represents an epiphenomenon secondary to tissue damage rather than a primary event in the pathogenetic pathway.

Diagnostic molecular pathology is expanding rapidly with the aid of the Human Genome Project and the development of potentially user-friendly molecular diagnostic methods. The diagnostic molecular pathology laboratory of the future must be prepared to purify DNA or RNA from a variety of sources and to investigate the sequence of the target genome of interest using automated amplification and hybridization detection systems. There will be a shift in the emphasis from phenotypic to genotypic diagnosis, and the diagnostic molecular pathology laboratory of the early twenty-first century will perform 5% to 10% of the volume of all laboratory testing.

Oxalyl thiolesters, a group of putative intracellular regulators, have been shown to be in vitro inhibitors of some cytosolic enzymes which are stimulated by insulin. In this study, the effects of insulin and oxalyl thiolesters on pyruvate dehydrogenase, beta-oxidation, and acyl-CoA hydrolase activities in mitochondria from rat epididymal adipocytes are compared. Using glutathione, CoASH, cysteine, and cysteamine as thiol sources, oxalyl thioesters were synthesized, purified, and quantitated. Mitochondria were isolated from rat epididymal adipocytes, some of which were incubated with or without insulin. Mitochondrial activities were determined by radioisotopic assay subsequent to control, insulin, or oxalyl thiolester incubation. Under the conditions used in this study, pyruvate dehydrogenase activity was increased 28% subsequent to 10-min incubation of adipocytes with 400 microU/ml insulin; in contrast, preincubation of adipocyte mitochondria with S-oxalylglutathione resulted in a dose-dependent 11-19% inhibition of pyruvate dehydrogenase. S-oxalylglutathione also attenuated the spermine-induced activation of pyruvate dehydrogenase. Insulin treatment resulted in a small but significant increase in beta-oxidation of palmitic acid while 100 microM S-oxalylglutathione mediated a 40% decrease in palmitate oxidation. Palmitoyl-CoA hydrolase activity was decreased 14% by insulin treatment; however, S-oxalylglutathione caused a 14-50% increase in hydrolase activity. The other oxalyl thiolesters were not as effective or as consistent as S-oxalylglutathione in modulation of the mitochondrial activities; free thiols and oxalic acid did not modulate the activities. In summary, pyruvate dehydrogenase, palmitate beta-oxidation, and palmitoyl-CoA hydrolase activities in adipocyte mitochondria were modulated in approximately equal but opposite directions by insulin and S-oxalylglutathione. These findings support the suggestion that oxalyl thiolesters may function as an intracellular signal recruited to return insulin to normal levels.

Blockade of adenosine receptors by 3-isobutyl-1-methylxanthine or degradation of endogenous adenosine with adenosine deaminase increased the phosphatidylcholine concentration in isolated rat adipocyte plasma membranes, an effect which was suppressed by the phosphatidylethanolamine methyltransferase inhibitor, S-adenosyl-L-homocysteine, and reversed by the adenosine analogue, N6-(L-phenylisopropyl)-adenosine. For example, the addition of N6-(L-phenylisopropyl)-adenosine to adenosine deaminase pretreated plasma membranes rapidly lowered the concentration of phosphatidylcholine by 171 nmol/mg at 30 seconds compared to control. Insulin-induced stimulation of phospholipid methylation in membranes treated with 3-isobutyl-1-methylxanthine or adenosine deaminase was achieved only after the addition of N6-(L-phenylisopropyl)-adenosine. These results suggest that adenosine receptor occupancy inhibits phospholipid methylation, is required for insulin stimulation of phospholipid methylation, and may perhaps activate a phosphatidylcholine-specific phospholipase C or phospholipase D.

Background/aims: Bile duct epithelia contain an abundance of carbonic anhydrase. Antibodies to this enzyme have been described in autoimmune disorders. Serum from patients with immune-mediated liver diseases was studied to determine whether antibodies to carbonic anhydrase II and/or pyruvate dehydrogenase could distinguish autoimmune cholangitis as immunologically distinct from primary biliary cirrhosis., Methods: Antibody assays to carbonic anhydrase II (Western blot) and pyruvate dehydrogenase (flow cytometry) were performed on the sera of patients with autoimmune cholangitis (6), primary biliary cirrhosis (12), primary sclerosing cholangitis (12), autoimmune hepatitis (12), and control (Gilbert syndrome; 8)., Results: Reactivity to carbonic anhydrase II was detected in 5 of 6 patients with autoimmune cholangitis, 1 of 12 patients with primary biliary cirrhosis, 1 of 12 patients with autoimmune hepatitis, and no other patients. Individuals with autoimmune cholangitis were more likely than the other patients to be reactive to carbonic anhydrase II (P < 0.001). Patients with primary biliary cirrhosis were more reactive to pyruvate dehydrogenase compared with all other groups (P < 0.001)., Conclusions: An antibody to human carbonic anhydrase II is frequently detected in the sera of patients with autoimmune cholangitis and is uncommon or not present in other cholangiopathies. These data provide evidence that autoimmune cholangitis and primary biliary cirrhosis represent distinct entities with unique patterns of immunoreactivity.

Tyrphostins inhibit tyrosine kinases and have little effect on the activity of serine/threonine kinases. Pyruvate dehydrogenase kinase inactivates pyruvate dehydrogenase by phosphorylating serine residues within the multienzyme complex. This serine/theronine kinase represents a new family of protein kinases, and one (tyrphostin 47) of two tyrphostins tested appeared to activate the pyruvate dehydrogenase kinase as determined by [1-14C]-lactate oxidation to 14CO2. Experiments designed to determine if the tyrphostins altered pyruvate dehydrogenase activity in mitochondria prepared from rat epididymal adipocytes using [1-14C]-pyruvate as the substrate demonstrated a dose dependent increase in enzyme activity in the presence of tyrphostin 47, but not in tyrphostin 23. This apparent stimulation of pyruvate dehydrogenase activity was attributed to tyrphostin 47's ability to nonenzymatically decarboxylate [1-14C]-pyruvate, the substrate for the pyruvate dehydrogenase assay. Neither tyrphostin directly altered pyruvate dehydrogenase kinase activity. Therefore, assays utilizing [1-14C]-pyruvate and tyrphostin 47 are subject to analytical interference.

Sera from 16 of 23 (69.6%) patients with endometriosis, a potential autoimmune disease, and 2 of 17 (11.8%) control individuals had autoantibodies against the bovine carbonic anhydrase (CA) molecular weight marker, as determined by the Western blot technique. The reactivity of these antibodies to purified human CA I, human CA II, and two preparations of bovine CA II were investigated. Of the 16 endometriosis patients who were reactive to the bovine CA molecular weight marker, 14 were reactive to at least one purified human CA isoenzyme tested, 8 were reactive to at least one purified bovine CA II, and 2 did not react with any of the CA isoenzymes tested. Variation in cross-reactivity between species and in the biochemical characteristics of various CA isoenzyme preparations may partially explain these findings. Autoantibodies to CA isoenzymes have recently been reported in other autoimmune diseases. Further investigation is required to determine the significance of CA autoantibody production in patients with endometriosis.

The change in transmembrane potential of rat adipocytes was measured using the fluorescent probe 3,3'-diethylthiadicarbocyanine iodide, diS-C2-(5). The method was calibrated by altering the potassium ion concentration while keeping the sum of potassium and sodium ions at a constant concentration of 153 mM (Bailey et al: Bioelectrochem. Bioenergetics 21:333-42, 1989). Two insulin-mimetic agents, phospholipase C from Clostridium perfringens and concanavalin A, induced a dose dependent hyperpolarization of rat epididymal adipocytes, like insulin. Removal of endogenous adenosine with adenosine deaminase or adenosine receptor blockade with isobutylmethylxanthine following the initiation of insulin-induced hyperpolarization resulted in depolarization. These same agents induced hyperpolarization of -6 to -8 mV when added without insulin. The replacement of adenosine with its analogue, N6-phenylisopropyladenosine, plus insulin depolarized the cells toward the transmembrane potential established by insulin, -2.0 mV. These studies suggest that adenosine receptor occupancy is required to maintain insulin-induced hyperpolarization.

Nitric oxide is generated from the terminal guanidino nitrogen of L-arginine yielding citrulline. This reaction is catalyzed by two major types of nitric oxide synthase: inducible and constitutive. Nitric oxide is a gaseous mediator responsible for a variety of physiologic phenomena. Its short half-life in biologic systems has created problems in its direct determination. Many experiments depend on the use of inhibitors of nitric oxide synthase to provide indirect evidence for the involvement of nitric oxide. Spectroscopic and electrochemical methods are the best for the direct measurement of nitric oxide; however, the advantages and disadvantages of each technique should be considered carefully before a specific method is selected.

The HemoCue beta-glucose photometer (Angelholm, Sweden) was evaluated for use in monitoring blood glucose in both diabetic and nondiabetic patients undergoing open heart surgery. Because occasional discrepancies were noted in patients with low total proteins when the Reflotron (Boehringer Mannheim, Indianapolis, IN) was used for this purpose, the effects of protein and hematocrit on glucose results from both instruments were investigated and compared with plasma values from a Paramax 720 ZX (Baxter Healthcare, Irvine, CA). Linear-regression analysis of the HemoCue results (y) versus Paramax (x) yielded y = 0.956x + 0.35, r2 = 0.980, with Sy/x = 0.57 mmol/L (10.3 mg/dL). Results from the Reflotron (y) versus Paramax (x) yielded y = 1.075x - 0.10, r2 = 0.964, with Sy/x = 0.99 mmol/L (17.8 mg/dL). Bias plots of (HemoCue-Paramax) or (Reflotron-Paramax) versus glucose, hematocrit, or protein showed no effect of glucose on the results from either instrument and no effect of protein or hematocrit on the HemoCue findings. The Reflotron, however, showed a positive bias of up to 3.5 mmol/L (63 mg/dL) at protein concentrations between 30-40 g/L (3.0-4.0 g/dL) and a possible positive bias at low hematocrit levels.

To screen fibroblasts for defects in lactate/pyruvate oxidation, cells were grown to confluence in 25-cm2 flasks, rinsed, and incubated in glucose-free media containing 25 microM L-lactate and 0.1 microCi [D,L-1-14C]lactate. Lactate oxidation was measured as the amount of lactate oxidized in nmol of 14CO2 generated/mg protein/min. Fibroblasts from patients with mitochondrial or peroxisomal disorders had decreased lactate oxidation compared to the control (CON): CON, 1.9 +/- 0.13 nmol/mg/min; neonatal adrenoleukodystrophy (NALD), 0.45 +/- 0.01 (P < 0.001); rhizomelic chondrodysplasia punctata (RCDP), 0.13 +/- 0.002 (P < 0.001); mitochondrial defect of unknown etiology (MIT), 0.77 +/- 0.003 (P < 0.001); pyruvate dehydrogenase (PDH) deficiency, 0.98 +/- 0.02 (P < 0.001). This method is useful for screening fibroblasts for defects in lactate oxidation in patients with mitochondrial or peroxisomal disorders. Confirmation of the site of the defect may then be investigated with specific assays, e.g., PDH, in cellular homogenates: CON, 0.93 +/- 0.02 nmol/mg/min; NALD, 0.55 +/- 0.02; RCDP, 0.44 +/- 0.02; MIT, 0.53 +/- 0.03; PDH deficiency, 0.19 +/- 0.02.