Search

The list of 19 species of Pyraloid moths new to the fauna of Omsk Region is given. 13 of them are new to the West Siberia and 5 are recorded from the Asian part of Russia for the first time, namely, Insalebria serraticornella (Zeller, 1839), Pseudophycita deformella (Möschler, 1866), Epischnia prodromella (Hübner, 1799), Ratasa alienalis (Eversmann, 1844), Pyrausta rectefascialis Toll, 1936. The second record of Krombia bimedia (Filipjev, 1924) in Russia is given., The study of the second author was performed in the frames of the state research project No.122031100272-3., {"references":["Filipjev NN (1924) Microheterocera des Minussinsk Bezirks. I. Jahrbuch des Martjanov'schen Staatsmuseums 2 (3): 1–61. [In Russian]","Knyazev SA (2022) Catalogue of Lepidoptera of Omsk Region (Russia). Microlepidoptera. Families: Eriocraniidae, Nepticulidae, Opostegidae, Adelidae, Prodoxidae, Incurvariidae, Psychidae, Tineidae, Roeslerstammiidae, Bucculatricidae, Gracillariidae, Yponomeutidae, Argyresthiidae, Plutelliidae, Acrolepiidae, Glyphipterigidae, Ypsolophidae, Lyonetiidae, Bedelliidae, Ethmiidae, Depressariidae, Elachistidae, Parametriotidae, Scythrididae, Chimabachidae, Cryptolechiidae, Oecophoridae, Batrachedridae, Coleophoridae, Momphidae, Blastobasidae, Autostichidae, Cosmopterigidae, Gelechiidae, Pterophoridae, Epermeniidae, Choreutidae, Galacticidae, Tortricidae, Pyralidae, Crambidae. Acta Biologica Sibirica 8: 17–87. https://doi.org/10.5281/zenodo.7690616","Knyazev SA, Ivonin VV, Vasilenko SV (2016) New and interesting findings of butterflies and moths (Insecta, Lepidoptera) in Omsk and Novosibirsk Provinces. Amurian Zoological Journal 8 (4): 254–272. [In Russian]","Knyazev SA, Ivonin VV, Sinev SYu, Lvovsky AL, Dubatolov VV, Vasilenko SV, Ustjuzhanin PYa, Ponomaryov KB, Sal`nik AA (2017) New records of Lepidoptera from the South of West Siberian Plain. Ukrainian Journal of Ecology 7 (4): 169–173. http://dx.doi.org/10.15421/2017_177","Knyazev SA, Ivonin VV, Ustjuzhanin PYa, Vasilenko SV, Rogalyov VV (2019) New data on Lepidoptera of West Siberian Plain, Russia. Far Eastern Entomologist 386: 8–20. https://doi.org/10.25221/fee.386.2","Knyazev SA, Ponomarev KB (2019) The first record of Titanio normalis (Hübner, 1796) (Lepidoptera, Crambidae) in Asian part of Russia. Amurian Zoological Journal 11 (2): 141–143. [In Russian]","Knyazev SA, Sinev SYu, Dubatolov VV, Ustjuzhanin PYa (2014) Pyralid-moths (Lepidoptera, Pyraloidea) of Omsk Region. Amurian Zoological Journal 6 (4): 375–397. [In Russian]","Sinev SYu (Ed) (2019) Catalogue of the Lepidoptera of Russia. Edition 2. Zoological Institute RAS, St. Petersburg, 448 pp. [In Russian]"]}

An annotated check-list of the longicorn beetles of Omsk Region is given. The list based on literature data and collecting materials of authors. 41 species are new to the fauna of Omsk Region., The authors are grateful to O.N. Kholodov (Krasnyi Oktyabr`, Omsk region), A.A. Sal`nik (Ermak, Omsk region), V.G. Nikonova (Zaulitskaya) (Omsk) and V.V. Rogalev (Omsk) for providing materials from their collections; A.G. Moseiko (Saint-Petersburg) for the good company and help in organization of our expeditions in Omsk Region in 2021 and 2022.

The article presents 13 species of Noctuoidea superfamily from Omsk and Novosibirsk regions of Russia. 6 species are new to Omsk region, 8 species are new to Novosibirsk region. 4 species are new to the Russian part of the West Siberian Plain, among them, Schrankia balneorum (Alphéraky, 1880), Spodoptera exigua (Hübner, 1808), Leucochlaena fallax (Staudinger, 1870), Mythimna anderreggii (Boisduval, 1840)., Authors thank K.B. Ponomarev (Omsk), O.N. Kholodov (Krasnyi Oktyabr`, Omsk Region), A.A. Sal`nik (Ermak, Omsk Region) for the good company in collecting trips in Omsk Region in 2022 and materials provided for our research.

Here we present additional data and the information about new records of Lepidoptera (Geometridae, Sphingidae, Lymantriidae, Erebidae s.str., Noctuidae, Arctiidae) from the Khakassia Republic and the South of Krasnoyarsk region. 45 species are reported for the fauna of both regions for the first time and the 4 species reliably confirmed. In our work, we use research records, collection of personal materials during 1986−2021 (collecting) seasons. As in works before, we acknowledge availability for several species, which were recorded here earlier doubtly. In addition, comparisons of moths flight activity 100 years agо and contemporary are given., Authors thank their wives for many years of help and understanding during all the stages of our work; E. Akulov, V. Golovizin, (Krasnoyarsk) for the collecting materials provided for our study. We are also thank to dr. V.V. Shurkina (Abakan), deputy director of research State Natural Reserve "Khakassky", director and deputy director of research Ergaki Nature Park I.V. Gryazin (Ermakovskoye) for their support in our work on the territory of the above reserves. The first author acknowledged dr. T.A. Maksimova (Abakan) for kind field assistance in our trips. The work of A.Yu. Matov and I.A. Makhov was supported by theme of the state assignment No 122031100272-3 "Systematics, morphology, ecophysiology and evolution of insects".

The article presents the results of studying the fauna of Lepidoptera in the North Kazakhstan region in the field seasons of 2019-2021. The annotated list includes 219 species, including 37 species given for the first time for the North Kazakhstan region., Authors thank Kristina A. Mifodovskaya (Petropavlovsk, Kazakhstan) for the materials provided for our study. The work was supported by the Altai State University in the framework of the federal project "Priority-2030".

Nine species of Lepidoptera from the territory of Omsk and Novosibirsk Regions are reported. Four species are new to Omsk Region, among them, Panchrysia ornata (Bremer, 1864), Sympistis campicola Lederer, 1853, Pseudohadena argyllostigma (Varga & Ronkay, 1991), Orthosia cerasi (Fabricius, 1775). Six species are new to Novosibirsk region, among them Eupithecia carpophillata Staudinger, 1897, Idaea nitidata (Herrich-Schäffer, 1861), Sympistis campicola Lederer, 1853, Sidemia spilogramma (Rambur, 1871), Polia malchani (Draudt, 1934), Sideridis lampra Schawerda, 1913.

Dyspessa ulgen Yakovlev, Shapoval, Ivonin, Knyazev & Kuftina, sp. nov. (Figs. 4 A���B) Type. Holotype. Male, sample ID���YK500, GenBank accession number for mitochondrial cytochrome c oxidase subunit I (COI) gene is MN401259; NE Kazakhstan, Tarbagatai Mts. range, 6 km W Karabuirat Village, 1020 m, 47��21���N / 81��06���E, 02.06.2018, P. Gorbunov leg. (GenPr # 9, coll. Yakovlev / 2018), deposited in the Zoological Institute of the Russian Academy of Sciences (St. Petersburg). Paratypes: 12 females, field codes YK501 (Gen-Bank accession number for mitochondrial cytochrome c oxidase subunit I (COI) gene is MN401260), YK502, YK503, YK504, YK505, YK506, YK507, YK508, YK509, YK510, YK511, YK512, same data and locality (deposited in ZISP, MWM, and RYB private collection); 9 females, field codes YK513, YK514, YK515, YK516, YK517, YK518, YK519, YK520, YK521), Eastern Kazakhstan, Kalba Mts, 40 km NW Kokpekty, 49��00���N / 82��00���, 760 m, 19.06.2018, R. Yakovlev, V. Doroshkin, V. Rudoj & A. Naydenov leg. (in RYB private collection); 4 females, field codes YK522, YK523, YK524, YK525, Eastern Kazakhstan, Kalba Mts., 6 km NW Panteleymonovka vill., 1130 m, 49��12���N / 83��12���E, 14.06.2012, R. Yakovlev leg. (in RYB private collection); 1 female, field code YC051 (GenBank accession number for mitochondrial cytochrome c oxidase subunit I (COI) gene is MN401262), Russia, Altai Republic, Kosh-Agach distr., 5 km E Tebeler, Yustyt river valley, 1800 m, 24��� 25.06.2015, V. Ivonin leg. (private col-lection of Vadim Ivonin, Novosibirsk); 1 female, field code YC050 (GenBank accession number for mitochondrial cytochrome c oxidase subunit I (COI) gene is MN401261) E Kazahstan, Kurchum distr., 26 km SE of Barsk-Batyr vill., 1800 m, 48��29���N / 84��07���, 20.06.2014, A. Volynkin, S. Titov leg. (in RYB private collection); 3 females, field codes YK701, YK702, YK703, Russia, Altai Krai, Loktevsky distr., Aley river valley, 1 km N of Ust���yanka vill., 51��09���47.6���N / 81��35���45.8���E, 330 m, 17��� 18.05.2020, leg. A.E. Naydenov (in RYB private collection). Diagnosis. The new species is most similar to D. ulula (Fig. 4D), from which it differs by: - the dark wings (D. ulula is much paler, the basic background is yellowish, the pale spots are much more expressed); - the expressed stepped bending on the costal edge of the valve (in D. tristis (Fig. 5A) and D. saldaitisi (Fig. 5B) the finely serrated surface on the costal edge of the valve in medium third; in D. ulula (Fig. 5C), the costal edge of valve is smoothly rounded; in D. saissanica (Fig. 5D) the proximal end of the process on the costal edge of the valve is sharp; - the phallus strongly bent in the medium third (in D. ulula, the phallus is less curved). The new species also differs from D. saissanica, D. saldaitisi D. tristis, and D. ulula (Figs 4C, 4E, 4F,) by the well-expressed dark color of the wings. Genetically, the new species differs from most closely related D. ulula by at least 36 fixed nucleotide substitutions (p-distance is 5.5%) within the studied 658bp fragment of the mitochondrial COI gene. COI barcode sequence of the holotype, 658 base pairs. AACATTATATTTTATTTTTGGAATTTGATCCGGAATAGTAGGTACTTCCTTAAGTCTATTAATTC- GAGCTGAATTAGGAAATCCAGGATCTTTAATTGGTAATGATCAAATTTATAATACTATTGTGACAACT- CATGCTTTTATTATAATTTTTTTTATAGTAATGCCTATTATAATTGGGGGATTTGGTAATTGATTAG TGCCATTAATATTAGGAGCTCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGACTACTCCCCCCTTCTT- TA A C C C T T T TA AT T T C TA G G A G TAT T G T T G A A A AT G G A G C T G G A A C A G G AT G A A C A G T T- TA C C C T C C C C TAT C C T C TA ATAT C G C T C AT G G T G G A A G T T C A G T C G AT C TA G C TAT T T T T T C T TTACACTTAGCAGGAATTTCTTCCATCTTAGGAGCAATTAATTTTATTACCACTATCATTAATATAC- GCCCCTATAATATATCATTCGATCAAATACCCCTTTTTGTTTGAGCAGTTGGAATTACCGCATTAT- TACTTTTACTATCTCTTCCAGTATTAGCGGGAGCTATCACTATATTATTAACAGATCGAAATTTAAA TACTTCATTTTTTGACCCTGCGGGAGGGGGAGATCCAATTTTATACCAACATTTATTT Description. Male. (Fig. 4A) Length of forewing 10 mm. Antenna bipectinate, equal to half of the forewing length, antenna crest 1.5 times of antenna rod diameter. Thorax and abdomen are densely covered with pale grey scales. Forewing grey with a poorly developed pale pattern of pale cream spots along the costal edge in the discal cell, and two spots in the cubital area (one at wing base, second in the discal area). Fringe mottled, dark at veins, pale between veins. Hindwing ground colour and hindwing fringe grey, unicolorous. Female (Fig. 4B). Length of forewing 9��� 11 mm. Antenna bipectinate, equal to half of the forewing length, an-tenna crest 0.5 times of antenna rod diameter. Thorax and abdomen are densely covered with pale grey scales. Wing pattern resembles that of males. Female genitalia (Fig. 5F). Ovipositor long, papillae analis semicircular, anterior apophyses three times shorter than posterior apophyses, ostium aperture slit-shaped, narrow. Male genitalia (Fig. 5E). Uncus triangle, apically blunt; gnathos arms short, thick; gnathos small, poorly sclerotized; valve basally sclerotized, caudal end membranous, lanceolately narrowing, stepped bending on the costal edge of the valve (in medium third); transtilla process short, basally very wide, apically narrowing, apex semicircular; juxta tiny, with a pair of short rod-shaped lateral processes; saccus semicircular, robust; phallus equal to 3/4 of valve length, thin, apically narrowing, strongly bent in the medium third, vesica aperture in dorso-apical position, equal to 2/3 of phallus length, vesica without cornuti. Distribution. Kazakhstan (Eastern Kazakhstan Province), Russia (Altai Krai Province). Etymology. Ulgen������demiurge, the supreme deity in shamanism of Altaians, Khakas, and Shors., Published as part of Yakovlev, Roman V., Shapoval, Nazar A., Ivonin, Vadim V., Knyazev, Svyatoslav A., Kuftina, Galina N. & Masharskiy, Alexey E., 2020, A new species of Carpenter Moths (Lepidoptera, Cossidae) from Tarbagatai (NE Kazakhstan) and Altai (SW Siberia, Russia) Mountains, pp. 85-95 in Zootaxa 4896 (1) on pages 91-94, DOI: 10.11646/zootaxa.4896.1.3, http://zenodo.org/record/4359282

Perigrapha (Perigrapha) yasawii Volynkin, Titov & Knyazev, sp. n. (Figs 1���3, 11, 12) Type material. Holotype: male, 14.iv. 2014, S Kazakhstan, South Kazakhstan Region, 39 km WSW of Turkestan city, Syrdarya river valley, h= 180 m, N 43 �� 10.006 ���, E 67 �� 50.389 ���, at light. Volynkin A.V., Titov S.V. & Knyazev S.A. leg. Slide AV 1242 Volynkin (Coll. Zoological Institute, Russian Academy of Sciences, St. Petersburg, Russia [ZISP]). Paratypes: 26 males, with the same data as holotype (Colls A. Volynkin, Barnaul, Russia [AVB]; S. Knyazev, Omsk, Russia [SKO]; S. Titov, Pavlodar, Kazakhstan [STP]; ZISP); 1 male, Perovsk [S Kazakhstan, Kyzyl-Orda Region, vicinity of Kyzyl-Orda city], Syr-Darya reg., 2.iv. 1909, E. Miller [leg.] (Coll. ZISP). Slides AV 1230, AV 1243 Volynkin (males). Diagnosis. The new species belongs to P. circumducta complex of the P. i-cinctum ([Denis & Schifferm��ller], 1775) species-group including P. sechuana G. Ronkay, L. Ronkay & Hacker, 2010, P. circumducta circumducta (Lederer, 1855) and P. circumducta pallescens (Draudt 1934) (Hreblay 1996; Ronkay et al. 2001; Ronkay et al. 2010). P. yasawii sp. n. (Figs 1���3) differs externally from P. circumducta circumducta (Figs 4���6) by its somewhat smaller size (wingspan of P. circumducta circumducta 42���53 mm), broader pectination of male antennae, more concolorous brownish-grey ground colour of forewings (in P. c. circumducta ground colour varies from reddishbrown to blackish-brown), pale subbasal area, pale subterminal area with narrower dark field outwards the postmeidal line, somewhat smaller orbicular stigma, more rounded reniform stigma, much narrower suborbicular patch and more greyish hindwings; from P. circumducta pallescens (Figs 7, 8) by its smaller size, broader pectination of male antennae, brownish-grey ground colour of forewings, more concolorous subterminal area with narrower dark field outwards the postmeidal line, more rounded reniform stigma, much narrower suborbicular patch and more greyish hindwings; from P. sechuana (Figs 9, 10) by its smaller size, narrower forewings, concolorous brownish-grey ground colour of forewings (in P. sechuana ground colour reddish-brown), paler subbasal area, pale subterminal area with narrower dark field outwards the postmeidal line, somewhat smaller orbicular stigma, more rounded reniform stigma, much narrower suborbicular patch and less unicolorous, more greyish hindwings with paler basal area. The male genitalia of P. yasawii sp. n. (Figs 11, 12) differ from those of P. circumducta (Figs 13) by the proximally broader, almost quadrangular uncus, more quadrangular juxta, broader clasper with shorter harpe and broader proximal part of ampulla; from P. sechuana (Fig. 14) by proximally broader, almost quadrangular uncus, broader clasper with shorter harpe, less asymmetrical and apically more dilated distal parts of valvae, longer aedeagus and much longer, less dorsally recurved vesica. Description. Adult (Figs 1���3). Male. Wingspan 37���43 mm. Antennae bipectinate, with long branches. Head, thorax and abdomen brownish-grey. Ground colour of forewing pale brownish-grey, medial area dark, greyishbrown, paler near the costal margin; antemedial and postmedial lines thin, dark grey; antemedial line almost straight, slightly curved near the costal margin; postmedial line almost straight, only arcuate around the cell; subterminal line indistinct; terminal area darker than subterminal; terminal line blackish, divided into short spots; orbicular and reniform stigmata and suborbicular patch being connected with reniform stigma with merged edges, pale greyish-ochreous, bordered with blackish; cilia grey. Hindwing greyish-brown; discal spot and medial line indistinct, dark; cilia dark grey. Female unknown. Male genitalia (Figs 11, 12). Uncus short, almost quadrangular, apically slightly rounded; tegumen short, weak; penicular lobes weak, narrow; juxta long, almost quadrangular; vinculum short, V-shaped; valva long, relatively narrow; cuculli long, straight, narrow, without pollex-like extensions, asymmetrical; distal part of left cucullus longer, apically narrower than that of right cucullus; ampulla long, slender, moderately curved, apically pointed; clasper short, distally strongly broadened, harpe very short; aedeagus very long, curved; vesica long, twisted, with subconical medial diverticulum with very small field of weak and short spinules, and large terminal field of spinules on broad diverticulum. Distribution and bionomics. The new species is known from two localities in South Kazakhstan. P. y as a w i i sp. n. inhabits dry shrubby river valleys (Fig. 15). Etymology. The species name is dedicated to Khodja Ahmed Yasawi, a Turkic poet and Sufi, whose mausoleum is in Turkestan city, less than 40 km from the type locality., Published as part of Volynkin, Anton V., Titov, Sergey V. & Knyazev, Svyatoslav A., 2014, A new Perigrapha Lederer, 1857 from South Kazakhstan (Lepidoptera, Noctuidae), pp. 292-296 in Zootaxa 3856 (2) on pages 292-296, DOI: 10.11646/zootaxa.3856.2.8, http://zenodo.org/record/224978, {"references":["Ronkay, G., Ronkay, L., Gyulai, P. & Hacker, H. (2010) New Orthosiini (Lepidoptera, Noctuidae, Hadeninae) species and genera from the wide sense Himalayan region. Esperiana, 15, 127 - 221.","Hreblay, M. (1996) Neue palaarktische Taxa aus der Gattung Perigrapha Lederer, 1857 (Lepidoptera, Noctuidae). Esperiana, 4, 65 - 94.","Ronkay, L., Yela, J. L. & Hreblay, M. (2001) Hadeninae II. Noctuidae Europaeae, 5. Entomological Press, Soro, 1 - 452."]}

Volynkin, Anton V., Titov, Sergey V., Knyazev, Svyatoslav A. (2014): A new Perigrapha Lederer, 1857 from South Kazakhstan (Lepidoptera, Noctuidae). Zootaxa 3856 (2): 292-296, DOI: http://dx.doi.org/10.11646/zootaxa.3856.2.8

A new species of the genus Perigrapha, P. yasawii sp. n. is described from Syrdarya river valley, South Kazakhstan. The adults and male genitalia of the new and related species are illustrated.