448 results on '"La Torre L"'
Search Results
2. Incidence of medullary thyroid carcinoma and Hirschsprung disease based on the cosmos database
3. Standardization of radiograph readings during bowel management week
4. Photovoltaic power resource at the Atacama Desert under climate change
5. An event-based adaptation of the relay feedback experiment for frequency response identification of stable processes
6. Do adult patients with congenital colorectal conditions know their diagnosis?
7. Error traps and culture of safety in Hirschsprung disease
8. Flipping the Remote Lab with Low Cost Rapid Prototyping Technologies
9. Acrylonitrile, an advantageous precursor to synthesize nitrogen doped carbon nanotubes
10. Detección temprana de Deterioro Cognitivo Leve en personas mayores durante la pandemia: protocolo cribado online
11. An event-based adaptation of the relay feedback experiment for frequency response identification of stable processes
12. Experimental Energy Performance Assessment of a Simplified Building: Study of Robustness of Different Analysis Approaches under Different Test Conditions
13. Detección temprana de Deterioro Cognitivo Leve en personas mayores durante la pandemia: protocolo cribado online.
14. Remote Control Laboratory Using EJS Applets and TwinCAT Programmable Logic Controllers
15. Flipping the Remote Lab with Low Cost Rapid Prototyping Technologies
16. Two Web-Based Laboratories of the FisL@bs Network: Hooke's and Snell's Laws
17. Fetal hemoglobin regulating genetic variants identified in homozygous (HbSS) and heterozygous (HbSA) subjects from South Mexico
18. Molecular analysis of complex cases of alpha- and beta-thalassemia in Mexican mestizo patients with microcytosis and hypochromia reveals two novel alpha0-thalassemia deletions - -Mex1 and - -Mex2
19. Three novel HBB mutations, c.‐140C>G (‐90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 ‐20 bp), and c.315+2T>G (IVS2: 2 T>G). Update of the mutational spectrum of β‐Thalassemia in Mexican mestizo patients
20. Sequence analysis of exons 30 and 31 of LAMA3 gene variants and its association with human papillomavirus infection predisposition: no evidence was found.
21. Incisional Hernia: Plastic Aspects, Component Separation, Technical Details & Pediatrics
22. EasyJava Simulations meets TwinCAT: Remote Real-Time Control Experiments using Programmable Logic Controllers
23. Enhancing Virtual and Remote Labs to Perform Automatic Evaluation
24. Detección temprana de Deterioro Cognitivo Leve en personas mayores durante la pandemia: protocolo cribado online.
25. Annular versus Nonannular Variability of the Northern Hemisphere Atmospheric Circulation
26. Social determinants in the access to health care for Chagas disease: A qualitative research on family life in the 'Valle Alto' of Cochabamba, Bolivia
27. Decrease in Nuclear Feulgen-Positive Material (DNA) upon Aging in in Vitro Storage of Bovine Spermatozoa
28. Baroclinic Rossby wave forcing and barotropic Rossby wave response to stratospheric vortex variability
29. Ion Beam Fabrication of Graphitic Structures in Single-Crystal Diamond for Electrically-Stimulated Luminescence
30. Fetal hemoglobin regulating genetic variants identified in homozygous (HbSS) and heterozygous (HbSA) subjects from South Mexico.
31. Analysis of the precipitation and cloudiness associated with COLs occurrence in the Iberian Peninsula
32. Interannual variability of cut-off low systems over the European sector: The role of blocking and the Northern Hemisphere circulation modes
33. Non-Typhi, non-Paratyphi Salmonella related hospitalisations in Spain: trends, comorbidities, risk factors for worse prognosis and hospital costs. Eur J Clin Microbiol Infect Dis
34. Wave energy associated with the variability of the stratospheric polar vortex
35. Successive positive contrast in one-way avoidance behavior with Roman low-avoidance rats
36. Interannual Variability of the Annual Cycle of Temperature over Northern Africa
37. Two Approaches for Determining Extreme Years of Global Atmospheric Temperature
38. The Use of Equivalent Temperature to Analyse Climate Variability
39. Mutational spectrum of the iduronate-2-sulfatase gene in Mexican patients with Hunter syndrome.
40. Survey of occupational risks in the agricultural sector of northeastern Buenos Aires, Argentina.
41. Solar influence on Northern Annular Mode spatial structure and QBO modulation
42. Comparison of the performance of a high voltage generator insulated by gas or liquid dielectric
43. Successive negative contrast in one-way avoidance learning in female roman rats
44. Towards the quantification of trace metals in pottery shards for discriminating different workshops in Southern Italy
45. Characterization of variable regions of the Gp120 protein from HIV-1 subtype C virus variants obtained from individuals at different disease stages in Sub-Saharan Africa
46. He+ Irradiation of Quartz for the Identification of Ceramic Forgeries Aged by Radiation
47. Epidemiology of congenital Chagas disease 6 years after implementation of a public health surveillance system, Catalonia, 2010 to 2015
48. MeV ion beam fabrication of diamond biosensors for action potentials detection
49. A systematic scoping review to approach the construct of gender discrimination
50. Training on health communication and social media: European public health residents’ perceptions
Catalog
Books, media, physical & digital resources
Discovery Service for Jio Institute Digital Library
For full access to our library's resources, please sign in.