Search

Several antiepileptic drugs (AEDs) have US Food and Drug Administration (FDA) approval for use as mood stabilizers in bipolar disorder (BD), but not all BD patients respond to these AED mood stabilizers (AED-MSs). To identify genetic polymorphisms that contribute to the variability in AED-MS response, we performed a discovery genome-wide association study (GWAS) of 199 BD patients from the Mayo Clinic Bipolar Disorder Biobank. Most of these patients had been treated with the AED-MS valproate/divalproex and/or lamotrigine. AED-MS response was assessed using the Alda scale, which quantifies clinical improvement while accounting for potential confounding factors. We identified two genome-wide significant single-nucleotide polymorphism (SNP) signals that mapped to the THSD7A (rs78835388, P = 7.1E-09) and SLC35F3 (rs114872993, P = 3.2E-08) genes. We also identified two genes with statistically significant gene-level associations: ABCC1 (P = 6.7E-07; top SNP rs875740, P = 2.0E-6), and DISP1 (P = 8.9E-07; top SNP rs34701716, P = 8.9E-07). THSD7A SNPs were previously found to be associated with risk for several psychiatric disorders, including BD. Both THSD7A and SLC35F3 are expressed in excitatory/glutamatergic and inhibitory/γ-aminobutyric acidergic (GABAergic) neurons, which are targets of AED-MSs. ABCC1 is involved in the transport of valproate and lamotrigine metabolites, and the SNPs in ABCC1 and DISP1 with the strongest evidence of association in our GWAS are strong splicing quantitative trait loci in the human gut, suggesting a possible influence on drug absorption. In conclusion, our pharmacogenomic study identified novel genetic loci that appear to contribute to AED-MS treatment response, and may facilitate precision medicine in BD., (© 2020 The Authors. Clinical Pharmacology & Therapeutics published by Wiley Periodicals LLC on behalf of American Society for Clinical Pharmacology and Therapeutics.)

This study aimed to understand prescribing practices during acute psychiatric hospitalization in a large cohort of patients ( N = 569) with borderline personality disorder (BPD) at a tertiary care psychiatry unit from January 1, 2013, through January 1, 2015. The mean number of hospitalizations per patient was 1.5 (range, 1-7). The odds of being prescribed antidepressants, antipsychotics, mood stabilizers, hypnotics, or anxiolytics were higher at discharge than at admission. The rate of psychotropic prescriptions was also higher at discharge than at admission (incidence rate ratio, 1.9). This pattern was true for the combined psychotropic and nonpsychotropic ("medical") prescriptions. Further guidelines are needed regarding optimal psychosocial, medical, and psychopharmacological care of patients with BPD during acute psychiatric hospitalizations.

We conducted a large genome-wide association study (GWAS) of the immune responses to primary smallpox vaccination in a combined cohort of 1,653 subjects. We did not observe any polymorphisms associated with standard vaccine response outcomes (e.g., neutralizing antibody, T cell ELISPOT response, or T cell cytokine production); however, we did identify a cluster of SNPs on chromosome 5 (5q31.2) that were significantly associated (p-value: 1.3 x 10 -12 - 1.5x10 -36 ) with IFNα response to in vitro poxvirus stimulation. Examination of these SNPs led to the functional testing of rs1131769, a non-synonymous SNP in TMEM173 causing an Arg-to-His change at position 232 in the STING protein-a major regulator of innate immune responses to viral infections. Our findings demonstrate differences in the ability of the two STING variants to phosphorylate the downstream intermediates TBK1 and IRF3 in response to multiple STING ligands. Further downstream in the STING pathway, we observed significantly reduced expression of type I IFNs (including IFNα) and IFN-response genes in cells carrying the H232 variant. Subsequent molecular modeling of both alleles predicted altered ligand binding characteristics between the two variants, providing a potential mechanism underlying differences in inter-individual responses to poxvirus infection. Our data indicate that possession of the H232 variant may impair STING-mediated innate immunity to poxviruses. These results clarify prior studies evaluating functional effects of genetic variants in TMEM173 and provide novel data regarding genetic control of poxvirus immunity., (Copyright © 2020 Kennedy, Haralambieva, Ovsyannikova, Voigt, Larrabee, Schaid, Zimmermann, Oberg and Poland.)

Importance: Obesity is a worsening epidemic worldwide. Effective and accessible weight loss programs to combat obesity on a large scale are warranted, but a need for frequent face-to-face care might impose a limitation., Objective: To evaluate whether individuals following a weight loss program based on a mobile application, wireless scale, and nutritional program but no face-to-face care can achieve clinically significant weight loss in a large cohort., Design: Retrospective observational analysis. Setting . China from October 2016 to December 2017. Participants . Mobile application users with a minimum of 2 weights (baseline and ≥35 days). Intervention . A commercial (Weijian Technologies) weight loss program consisting of a dietary replacement, self-monitoring using a wireless home scale, and frequent guidance via mobile application. Main Outcome . Mean weight change around 42, 60, 90, and 120 days after program initiation with subgroup analysis by gender, age, and frequency of use., Results: 251,718 individuals, with a mean age of 37.3 years (SD: 9.86) (79% female), were included with a mean weight loss of 4.3 kg (CI: ±0.02) and a mean follow-up of 120 days (SD: 76.8 days). Mean weight loss at 42, 60, 90, and 120 d was 4.1 kg (CI: ±0.02), 4.9 kg (CI: ±0.02), 5.6 kg (CI: ±0.03), and 5.4 kg (CI: ±0.04), respectively. At 120 d, 62.7% of participants had lost at least 5% of their initial weight. Both genders and all usage frequency tertiles showed statistically significant weight loss from baseline at each interval ( P < 0.001), and this loss was greater in men than in women (120 d: 6.5 vs. 5.2 kg; P < 0.001). The frequency of recording (categorized as high-, medium-, or low-frequency users) was associated with greater weight loss when comparing high, medium, and low tertile use groups at all time intervals investigated (e.g., 120 d: -8.6, -5.6, and -2.2 kg, respectively; P < 0.001)., Conclusions: People following a commercially available hybrid weight loss program using a mobile application, wireless scale, and nutritional program without face-to-face interaction on average achieved clinically significant short- and midterm weight loss. These results support the implementation of comparable technologies for weight control in a large population., Competing Interests: Drs. Amir and Lilach Lerman are serving as consultants to Weijian Technologies Inc., Hangzhou, China., (Copyright © 2020 Conor Senecal et al.)

Introduction: Severe obesity is a growing epidemic that causes significant morbidity and mortality, and is particularly difficult to reverse. Efficacious and cost-effective interventions are needed to combat this epidemic. This study hypothesized that obese people (body mass index (BMI) ≥35 kg/m 2 ) using a remote weight-loss program combining a mobile application, wireless scales, and low-calorie meal replacement would experience clinically significant weight loss., Methods: This study was a retrospective observational analysis of 8275 individuals with a baseline BMI ≥35 kg/m 2 who used a remote weight-loss program combining mobile applications, frequent self-weighing, and calorie restriction via meal replacement for a minimum of 35 days. Weight changes were evaluated at multiple intervals (42, 60, 90, and 120 days), and weight loss was evaluated for all and for pre-specified subgroups based on demographic features and frequency of self-weighing., Results: Mean weight loss at 42 days ( N  = 6781) was 8.1 kg (margin of error (MOE) = 0.126 kg) with 73.6% of users experiencing >5% total body weight loss. Both men (9.1 kg; MOE = 0.172 kg; 7.9% from baseline) and women (7.1 kg; MOE = 0.179 kg; 7.2% from baseline) experienced significant weight loss. At the 120-day interval ( N  = 2914), mean weight loss was 14 kg (MOE = 0.340 kg), 13% total body weight loss from baseline, and 82.3% of participants had lost >5% of their initial body weight. The decrease in body-fat percent correlated well with weight loss ( R  = 0.92; p  < 0.001)., Conclusions: In a large cohort of individuals with class II or III obesity, a remote weight-loss program combining mobile applications, daily self-weighing, and calorie restriction via meal replacement resulted in dramatic weight loss among subjects who were active users when evaluated through a retrospective observational analysis., (© The Author(s) 2020.)

Background: Opioid use is a significant national crisis impacting individuals struggling with addiction and their families. The majority of individuals who abuse opioids are of child-rearing age, and critical knowledge gaps remain regarding how this abuse impacts their offspring. Fortunately, treatment for opioid use disorders is available. The primary goal of this study was to evaluate both physical and psychiatric diagnoses of children who have at least 1 parent participating in a buprenorphine-assisted treatment program., Methods: This retrospective study is based on chart review (January 1, 2010, through June 30, 2018). Children with parents receiving care in a buprenorphine clinic were identified and matched on sex, race, and age in a ratio of 1:5 with controls from the general pediatric clinic population. Data related to health outcomes were extracted from the medical records., Results: Compared to controls (n = 120), children of parents receiving buprenorphine-assisted treatment (n = 24) were more likely to have been born premature (odds ratio [OR] = 3.3, P = .035), had jaundice after birth (OR = 2.7, P = .034), had enuresis/encopresis (P < .001), and had been the victims of abuse or neglect (OR = 19.7, P = .0005). Children of parents with opioid use disorders were also more likely to utilize emergency services (ie, being seen in the emergency department for fussiness; OR = 4.0, P = .046) and were less likely to be covered by private insurance compared to state-funded insurance (OR = 0.2, P = .0013)., Conclusions: Parental opioid use disorder impacts children. More research is needed to better describe long-term effects of treatment of parental opioid use on their offspring and to help design addiction treatment programs to support whole family units., (© Copyright 2019 Physicians Postgraduate Press, Inc.)

Purpose: To conduct a pooled analysis assessing the association of blood transfusion with risk of non-Hodgkin lymphoma (NHL)., Methods: We used harmonized data from 13 case-control studies (10,805 cases, 14,026 controls) in the InterLymph Consortium. Odds ratios (OR) and 95% confidence intervals (CI) were calculated using unconditional logistic regression, adjusted for study design variables., Results: Among non-Hispanic whites (NHW), history of any transfusion was inversely associated with NHL risk for men (OR 0.74; 95% CI 0.65-0.83) but not women (OR 0.92; 95% CI 0.83-1.03), p heterogeneity  = 0.014. Transfusion history was not associated with risk in other racial/ethnic groups. There was no trend with the number of transfusions, time since first transfusion, age at first transfusion, or decade of first transfusion, and further adjustment for socioeconomic status, body mass index, smoking, alcohol use, and HCV seropositivity did not alter the results. Associations for NHW men were stronger in hospital-based (OR 0.56; 95% CI 0.45-0.70) but still apparent in population-based (OR 0.84; 95% CI 0.72-0.98) studies., Conclusions: In the setting of a literature reporting mainly null and some positive associations, and the lack of a clear methodologic explanation for our inverse association restricted to NHW men, the current body of evidence suggests that there is no association of blood transfusion with risk of NHL.

Objective: To study the changes in overall outcome of patients with myelodysplastic syndromes (MDSs) after approval of several treatments., Patients and Methods: We identified 54,953 MDS cases in the National Cancer Data Base diagnosed from January 1, 2004, through December 31, 2013, using International Classification of Diseases for Oncology, 3rd edition, codes 9980, 9982-9983, 9985-9987, 9989, 9991-9992. Overall survival and different subgroups were studied over 3 periods of diagnoses (2004-2006, 2007-2009, and 2010-2013)., Results: Median age at diagnosis was 76 years. The most common subtype was MDS-unclassifiable, which represented 55.6% of all cases. We found that males, older patients, patients with refractory anemia with excess blasts, Medicare insurance recipients, and those treated at nonacademic centers had the worse survival (P<.001). Overall survival did not improve over time, except in younger patients (<40 years old)., Conclusion: In the past decade, overall outcome of MDS did not improve despite the advent of new therapies. More studies are needed to understand the impact of newly approved treatments on the outcome of patients with MDS., (Copyright © 2019 Mayo Foundation for Medical Education and Research. Published by Elsevier Inc. All rights reserved.)

Objective: Cannabis is the most commonly used non-alcohol intoxicant in the general population. There are no consistent guidelines on the implications of cannabis abuse and dependence (CAD) in kidney transplant candidates. The aims of this study were to characterize kidney transplant candidates with comorbid CAD and examine the implications of CAD on transplant candidacy., Method: This was a retrospective cohort study of kidney transplant candidates meeting diagnostic criteria for CAD at a tertiary center from 2012 to 2016. Candidates were reviewed for psychiatric and substance use disorders (SUDs), family history, and medical variables. The cohort was divided by severity of CAD and transplant listing status for comparisons. Statistical analysis included Kruskal-Wallis tests for continuous variables and Fisher's Exact Test for categorical variables., Results: Sixty-one of 2067 (3%) kidney transplant candidates met criteria for CAD, and 13/61 (21%) underwent transplantation. Of 61, 58% smoked cannabis daily, 47% had alcohol dependence history, 31% had other illicit drug dependencies, 38% were smokers, 60% had a SUD family history, and 42% and 27% had depressive and anxiety disorders, respectively. Severity of CAD was inversely associated with transplant listing; those with cannabis abuse were more often listed than those with dependence (67% vs 33%, p = .02) by study end. Three case presentations illustrate cannabis-related issues., Conclusion: In this cohort, kidney transplant candidates with comorbid CAD have high prevalence of other substance use disorders, psychiatric comorbidities, and strong family histories of addictions that resemble other SUD populations. These findings have implications for pre-transplant screening and treatment and post-transplant monitoring., (Copyright © 2019 Elsevier Inc. All rights reserved.)

The development and wide-spread use of mumps vaccine resulted in a dramatic and sustained decrease in the incidence of mumps disease; however, since 2000, an increase in the size and number of mumps outbreaks in the United States and other countries has sparked renewed interest in the durability of mumps-specific immunity elicited by mumps vaccination. The most likely explanation for mumps cases in previously immunized persons may be secondary vaccine failure, or waning immunity. In the current study, we examined changes in markers of measles and mumps immunity at two timepoints, approximately 7 and 17 years after two-dose MMR-II® vaccination, in a cohort of 98 healthy adults. Our results indicate that mumps IgG titers exhibited a large and significant decline during this time period, while mumps neutralizing Ab titers were relatively stable. There was a similar discrepancy with measles-specific immune responses. For both pathogens, neutralizing antibody titers were fairly low and, given the length of time since vaccination, may have already declined. These data suggest that specific immune outcomes may wane at different rates and highlight our currently incomplete understanding of protective immune responses to mumps and measles., (Copyright © 2019 Elsevier Ltd. All rights reserved.)

Background and Objectives: A high proportion of persons in institutionalized settings such as the criminal justice system and psychiatric hospitals have substance use disorders (SUDs). We explored the association between substance use, demographics, and criminal justice involvement in a population of patients placed on involuntary 72-h holds in a psychiatric facility., Methods: We retrospectively identified patients aged 18 through 57 years who had been placed on 72-h holds during an acute psychiatric hospitalization during a 1-year period. Data were analyzed with standard descriptive statistics, and data collection was reviewed by 2 randomly assigned psychiatrists., Results: We identified 336 patients placed on 72-h holds during an acute psychiatric stay. Of these, more than two-thirds (68.5%; n = 230) had an SUD. Compared with patients not using substances, those with SUDs were significantly more likely to be younger (p = .003), male (p = .005), and unmarried (p < .001) and to have criminal justice involvement before (p < .001) and after hospitalization (p < .001). The rate of unemployment was similarly high in both users (67.4%) and nonusers (69.2%)., Discussion and Conclusions: Most patients on involuntary psychiatric holds have comorbid SUDs. These patients are more likely to have interacted with the criminal justice system and less likely to have social support in the form of marriage. Unemployment was common among all patients., Scientific Significance: When SUDs are not treated by the criminal justice or mental health system, rehospitalization and criminal recidivism may result. (Am J Addict 2018;27:574-577)., (© 2018 American Academy of Addiction Psychiatry.)

Bipolar disorder (BD) is highly heterogeneous in symptomatology. Narrowing the clinical phenotype may increase the power to identify risk genes that contribute to particular BD subtypes. This study was designed to test the hypothesis that genetic overlap between schizophrenia (SZ) and BD is higher for BD with a history of manic psychosis. Analyses were conducted using a Mayo Clinic Bipolar Biobank cohort of 957 bipolar cases (including 333 with history of psychosis during mania, 64 with history of psychosis only during depression, 547 with no history of psychosis, and 13 with unknown history of psychosis) and 778 controls. Polygenic risk score (PRS) analysis was performed by calculating a SZ-PRS for the BD cases and controls, and comparing the calculated SZ risk between different psychosis subgroups and bipolar types. The SZ-PRS was significantly higher for BD-I cases with manic psychosis than BD-I cases with depressive psychosis (Nagelkerke's R 2  = 0.021; p = 0.045), BD-I cases without psychosis (R 2  = 0.015; p = 0.007), BD-II cases without psychosis (R 2  = 0.014; p = 0.017), and controls (R 2  = 0.065; p = 2 × 10 -13 ). No other significant differences were found. Our results show that BD-I with manic psychosis is genetically more similar to SZ than any other tested BD subgroup. Further investigations on genetics of distinct clinical phenotypes composing major psychoses may help refine the current diagnostic classification system.

Bipolar disorder (BD) is associated with binge eating behavior (BE), and both conditions are heritable. Previously, using data from the Genetic Association Information Network (GAIN) study of BD, we performed genome-wide association (GWA) analyses of BD with BE comorbidity. Here, utilizing data from the Mayo Clinic BD Biobank (969 BD cases, 777 controls), we performed a GWA analysis of a BD subtype defined by BE, and case-only analysis comparing BD subjects with and without BE. We then performed a meta-analysis of the Mayo and GAIN results. The meta-analysis provided genome-wide significant evidence of association between single nucleotide polymorphisms (SNPs) in PRR5-ARHGAP8 and BE in BD cases (rs726170 OR = 1.91, P = 3.05E-08). In the meta-analysis comparing cases with BD with comorbid BE vs. non-BD controls, a genome-wide significant association was observed at SNP rs111940429 in an intergenic region near PPP1R2P5 (p = 1.21E-08). PRR5-ARHGAP8 is a read-through transcript resulting in a fusion protein of PRR5 and ARHGAP8. PRR5 encodes a subunit of mTORC2, a serine/threonine kinase that participates in food intake regulation, while ARHGAP8 encodes a member of the RhoGAP family of proteins that mediate cross-talk between Rho GTPases and other signaling pathways. Without BE information in controls, it is not possible to determine whether the observed association reflects a risk factor for BE in general, risk for BE in individuals with BD, or risk of a subtype of BD with BE. The effect of PRR5-ARHGAP8 on BE risk thus warrants further investigation.

Single nucleotide polymorphisms (SNPs) in FCγ-receptor genes FCGR3A (rs396991) and FCGR2A (rs1801274) influence the affinity of the Fc portion of anti-CD20 immunoglobulin G1 monoclonal antibody. Their roles in diffuse large B-cell lymphoma (DLBCL) treated with rituximab in combination with anthracycline-based chemotherapy remain controversial. To address this question, we genotyped FCGR2A and FCGR3A SNPs in two prospective DLBCL cohorts from Lymphoma Study Association trials (N = 554) and Iowa/Mayo Specialized Program Of Research Excellence (N = 580). Correlations with treatment response and hematological toxicity were assessed in Lymphoma Study Association. Correlation with event-free survival (EFS) and overall survival (OS) was performed in both cohorts, followed by a meta-analysis to increase power. Our study shows the absence of correlation between these SNPs and treatment response. Grades 3 and 4 febrile neutropenia during treatment was more frequently observed in FCGR3A VV (39%) than VF (29%) and FF (32%) carriers (p = 0.04). Our analysis for EFS and OS shows that FCGR3A was not associated with outcome. In a meta-analysis using an ordinal model, FCGR2A (per R allele) was associated with a better EFS (hazard ratio = 0.87; 95%CI, 0.76-0.99; p = 0.04) and OS (hazard ratio = 0.86; 95%CI, 0.73-1.00; p = 0.05) which was not altered after adjustment for the International Prognostic Index. Overall, our data demonstrate that patients with DLBCL with the low-affinity FCγRIIA RR had an unexpectedly better outcome than FCγRIIA H carriers. Whether rituximab efficacy is improved in FCγRIIA RR patients due a clearance reduction or other functions of FCγRIIA in DLBCL should be investigated (clinicaltrials.gov identifiers: NCT00135499, NTC00135499 NCT00140595, NCT00144807, NCT00144755, NCT01087424, and NCT00301821). Copyright © 2016 John Wiley & Sons, Ltd., (Copyright © 2016 John Wiley & Sons, Ltd.)

Identifying genetic polymorphisms that explain variations in humoral immunity to live measles virus vaccine is of great interest. Immunoglobulin GM (heavy chain) and KM (light chain) allotypes are genetic markers known to be associated with susceptibility to several infectious diseases. We assessed associations between GM and KM genotypes and measles vaccine humoral immunity (neutralizing antibody titers) in a combined cohort (n=1796) of racially diverse healthy individuals (age 18-41years). We did not discover any significant associations between GM and/or KM genotypes and measles vaccine-induced neutralizing antibody titers. African-American subjects had higher neutralizing antibody titers than Caucasians (1260mIU/mL vs. 740mIU/mL, p=7.10×10 -13 ), and those titers remained statistically significant (p=1.68×10 -09 ) after adjusting for age at enrollment and time since last vaccination. There were no statistically significant sex-specific differences in measles-induced neutralizing antibody titers in our study (p=0.375). Our data indicate a surprising lack of evidence for an association between GM and KM genotypes and measles-specific neutralizing antibody titers, despite the importance of these immune response genes., (Copyright © 2017 Elsevier Ltd. All rights reserved.)

Population-based studies have revealed 2-10% measles vaccine failure rate even after two vaccine doses. While the mechanisms behind this remain unknown, we hypothesized that host genetic factors are likely to be involved. We performed a genome-wide association study of measles specific neutralizing antibody and IFNγ ELISPOT response in a combined sample of 2872 subjects. We identified two distinct chromosome 1 regions (previously associated with MMR-related febrile seizures), associated with vaccine-induced measles neutralizing antibody titers. The 1q32 region contained 20 significant SNPs in/around the measles virus receptor-encoding CD46 gene, including the intronic rs2724384 (p value = 2.64 × 10 -09 ) and rs2724374 (p value = 3.16 × 10 -09 ) SNPs. The 1q31.1 region contained nine significant SNPs in/around IFI44L, including the intronic rs1333973 (p value = 1.41 × 10 -10 ) and the missense rs273259 (His73Arg, p value = 2.87 × 10 -10 ) SNPs. Analysis of differential exon usage with mRNA-Seq data and RT-PCR suggests the involvement of rs2724374 minor G allele in the CD46 STP region exon B skipping, resulting in shorter CD46 isoforms. Our study reveals common CD46 and IFI44L SNPs associated with measles-specific humoral immunity, and highlights the importance of alternative splicing/virus cellular receptor isoform usage as a mechanism explaining inter-individual variation in immune response after live measles vaccine.

Understanding how genetics influences inter-individual variation of antibody titers in response to measles vaccination is vital to understanding possible sources of vaccine failure as well as improved vaccine development. Although it is recognized that both the human leukocyte antigen (HLA) genes and the immunoglobulin allotype genes play significant roles in immune response, there is significant variation in antibody titers that is not explained by these genes. To obtain a more complete estimate of the role of the entire genome, we used a large panel of single nucleotide polymorphisms to estimate the heritability of antibody response to measles vaccine. Based on 935 subjects with European ancestry, we estimated the heritability to be 49% (standard error 0.17). We also estimated the heritability attributable to each chromosome, and found a large range in chromosome-specific heritabilities. Notably, chromosome 1 had the largest estimate (28%), while chromosome 6, which harbors HLA, had an estimated heritability of 13%. Compared with a prior study of twins in the same community, which resulted in a heritability estimate of 88.5%, our study suggests there are either many rare genetic variants, or many common genetic variants of small effect sizes that contribute to variations of antibody titers in response to measles vaccine., (Copyright © 2017 Elsevier Ltd. All rights reserved.)

Human antibody response to measles vaccine is highly variable in the population. Host genes contribute to inter-individual antibody response variation. The killer cell immunoglobulin-like receptors (KIR) are recognized to interact with HLA molecules and possibly influence humoral immune response to viral antigens. To expand on and improve our previous work with HLA genes, and to explore the genetic contribution of KIR genes to the inter-individual variability in measles vaccine-induced antibody responses, we performed a large population-based study in 2,506 healthy immunized subjects (ages 11 to 41 years) to identify HLA and KIR associations with measles vaccine-induced neutralizing antibodies. After correcting for the large number of statistical tests of allele effects on measles-specific neutralizing antibody titers, no statistically significant associations were found for either HLA or KIR loci. However, suggestive associations worthy of follow-up in other cohorts include B*57:01, DQB1*06:02, and DRB1*15:05 alleles. Specifically, the B*57:01 allele (1,040 mIU/mL; p = 0.0002) was suggestive of an association with lower measles antibody titer. In contrast, the DQB1*06:02 (1,349 mIU/mL; p = 0.0004) and DRB1*15:05 (2,547 mIU/mL; p = 0.0004) alleles were suggestive of an association with higher measles antibodies. Notably, the associations with KIR genotypes were strongly nonsignificant, suggesting that KIR loci in terms of copy number and haplotypes are not likely to play a major role in antibody response to measles vaccination. These findings refine our knowledge of the role of HLA and KIR alleles in measles vaccine-induced immunity., Competing Interests: Dr. Poland is the chair of a Safety Evaluation Committee for novel investigational vaccine trials being conducted by Merck Research Laboratories. Dr. Poland offers consultative advice on vaccine development to Merck & Co. Inc., CSL Biotherapies, Avianax, Dynavax, Novartis Vaccines and Therapeutics, Emergent Biosolutions, Adjuvance, Microdermis, Seqirus, NewLink, Protein Sciences, GSK Vaccines, and Sanofi Pasteur. Drs. Poland and Ovsyannikova hold two patents related to measles and vaccinia peptide research. Dr. Kennedy has received funding from Merck Research Laboratories to study waning immunity to measles and mumps vaccine. These activities have been reviewed by the Mayo Clinic Conflict of Interest Review Board and are conducted in compliance with Mayo Clinic Conflict of Interest policies. This research has been reviewed by the Mayo Clinic Conflict of Interest Review Board and was conducted in compliance with Mayo Clinic Conflict of Interest policies. This does not alter our adherence to PLOS ONE policies on sharing data and materials.

In addition to host genetic and environmental factors, variations in immune responses to vaccination are influenced by demographic variables, such as race and sex. The influence of genetic race and sex on measles vaccine responses is not well understood, yet important for the development of much-needed improved measles vaccines with lower failure rates. We assessed associations between genetically defined race and sex with measles humoral and cellular immunity after measles vaccination in three independent and geographically distinct cohorts totaling 2872 healthy racially diverse children, older adolescents, and young adults. We found no associations between biological sex and either humoral or cellular immunity to measles vaccine, and no correlation between humoral and cellular immunity in these study subjects. Genetically defined race was, however, significantly associated with both measles vaccine-induced humoral and cellular immune responses, with subjects genetically classified as having African-American ancestry demonstrating significantly higher antibody and cell-mediated immune responses relative to subjects of Caucasian ancestry. This information may be useful in designing novel measles vaccines that are optimally effective across human genetic backgrounds., Competing Interests: These activities have been reviewed by the Mayo Clinic Conflict of Interest Review Board and are conducted in compliance with Mayo Clinic Conflict of Interest policies. This research has been reviewed by the Mayo Clinic Conflict of Interest Review Board and was conducted in compliance with Mayo Clinic Conflict of Interest policies., (Copyright © 2016. Published by Elsevier Ltd.)

The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

Two recently developed fine-mapping methods, CAVIAR and PAINTOR, demonstrate better performance over other fine-mapping methods. They also have the advantage of using only the marginal test statistics and the correlation among SNPs. Both methods leverage the fact that the marginal test statistics asymptotically follow a multivariate normal distribution and are likelihood based. However, their relationship with Bayesian fine mapping, such as BIMBAM, is not clear. In this study, we first show that CAVIAR and BIMBAM are actually approximately equivalent to each other. This leads to a fine-mapping method using marginal test statistics in the Bayesian framework, which we call CAVIAR Bayes factor (CAVIARBF). Another advantage of the Bayesian framework is that it can answer both association and fine-mapping questions. We also used simulations to compare CAVIARBF with other methods under different numbers of causal variants. The results showed that both CAVIARBF and BIMBAM have better performance than PAINTOR and other methods. Compared to BIMBAM, CAVIARBF has the advantage of using only marginal test statistics and takes about one-quarter to one-fifth of the running time. We applied different methods on two independent cohorts of the same phenotype. Results showed that CAVIARBF, BIMBAM, and PAINTOR selected the same top 3 SNPs; however, CAVIARBF and BIMBAM had better consistency in selecting the top 10 ranked SNPs between the two cohorts. Software is available at https://bitbucket.org/Wenan/caviarbf., (Copyright © 2015 by the Genetics Society of America.)

Single-nucleotide polymorphisms (SNPs) in candidate immune response genes were evaluated for associations with measles- and rubella-specific neutralizing antibodies, interferon (IFN)-γ, and interleukin (IL)-6 secretion in two separate association analyses in a cohort of healthy immunized subjects. We identified six SNP associations shared between the measles-specific and rubella-specific immune responses, specifically neutralizing antibody titers (DDX58), secreted IL-6 (IL10RB, IL12B), and secreted IFN-γ (IFNAR2, TLR4). An intronic SNP (rs669260) in the antiviral innate immune receptor gene, DDX58, was significantly associated with increased neutralizing antibody titers for both measles and rubella viral antigens post-MMR vaccination (p values 0.02 and 0.0002, respectively). Significant associations were also found between IL10RB (rs2284552; measles study p value 0.006, rubella study p value 0.00008) and IL12B (rs2546893; measles study p value 0.005, rubella study p value 0.03) gene polymorphisms and variations in both measles- and rubella virus-specific IL-6 responses. We also identified associations between individual SNPs in the IFNAR2 and TLR4 genes that were associated with IFN-γ secretion for both measles and rubella vaccine-specific immune responses. These results are the first to indicate that there are SNP associations in common across measles and rubella vaccine immune responses and that SNPs from multiple genes involved in innate and adaptive immune response regulation may contribute to the overall human antiviral response.

Recent population-based studies have demonstrated the genetic heritability of rubella vaccine response and assessed that the HLA system may explain about 20% of the inter-individual variance in humoral immune response to this vaccine. Our earlier studies compared HLA allelic associations with rubella vaccine-specific antibodies between two smaller cohorts of healthy Rochester, MN, children (346 and 396 subjects) after two doses of rubella-containing vaccine. This study found that specific HLA alleles were consistently associated with rubella-specific antibody titers (B*27:05, DPA1*02:01, and DPB1*04:01 alleles). The current study examined HLA associations in an independent larger cohort of 1012 healthy San Diego, CA, subjects (age 19-40 years) after rubella vaccine in order to replicate our previous findings in the Rochester subjects. Two HLA associations of comparable magnitudes were consistently observed between B*27:05 (median NT50 Rochester cohort 48.9, p=0.067; San Diego cohort 54.8, p=0.047) and DPB1*04:01 (median NT50 Rochester cohort 61.6, p<0.001; San Diego cohort 70.8, p=0.084) alleles and rubella virus-neutralizing antibody titers. Additional HLA alleles resulted in consistent effects on IL-6 production in both cohorts, but did not meet criteria for statistical significance. Our data suggest these HLA alleles play a role in rubella vaccine-induced immunity and provide the basis for future studies that may explain the mechanism(s) by which these HLA polymorphisms affect immune responses to rubella vaccine., (Copyright © 2014 Elsevier Ltd. All rights reserved.)

Background: Viral attachment and cell entry host factors are important for viral replication, pathogenesis, and the generation and sustenance of immune responses after infection and/or vaccination, and are plausible genetic regulators of vaccine-induced immunity., Methods: Using a tag-SNP approach in candidate gene study, we assessed the role of selected cell surface receptor genes, attachment factor-related genes, along with other immune genes in the genetic control of immune response variations after live rubella vaccination in two independent study cohorts., Results: Our analysis revealed evidence for multiple associations between genetic variants in the PVR, PVRL2, CD209/DC-SIGN, RARB, MOG, IL6 and other immune function-related genes and rubella-specific neutralizing antibodies after vaccination (meta p-value <0.05)., Conclusion: Our results indicate that multiple SNPs from genes involved in cell adhesion, viral attachment, and viral entry, as well as others in genes involved in signaling and/or immune response regulation, play a role in modulating humoral immune responses following live rubella vaccination.

Rubella remains a social and economic burden due to the high incidence of congenital rubella syndrome (CRS) in some countries. For this reason, an accurate and efficient high-throughput measure of antibody response to vaccination is an important tool. In order to measure rubella-specific neutralizing antibodies in a large cohort of vaccinated individuals, a high-throughput immunocolorimetric system was developed. Statistical interpolation models were applied to the resulting titers to refine quantitative estimates of neutralizing antibody titers relative to the assayed neutralizing antibody dilutions. This assay, including the statistical methods developed, can be used to assess the neutralizing humoral immune response to rubella virus and may be adaptable for assessing the response to other viral vaccines and infectious agents.

Obesity is a risk factor for complicated influenza A/H1N1 disease and poor vaccine immunogenicity. Leptin, an adipocyte-derived hormone/cytokine, has many immune regulatory functions and therefore could explain susceptibility to infections and poor vaccine outcomes. We recruited 159 healthy adults (50-74 years old) who were immunized with inactivated TIV influenza vaccine that contained A/California/7/2009/H1N1 virus. We found a strong correlation between leptin concentration and BMI (r=0.55, p<0.0001), but no association with hemagglutination antibody inhibition (HAI), B-cell, or granzyme B responses. We found a slight correlation between leptin concentration and an immunosenescence marker (TREC: T-cell receptor excision circles) level (r=0.23, p=0.01). We found eight SNPs in the LEP/LEPR/GHRL genes that were associated with leptin levels and four SNPs in the PTPN1/LEPR/STAT3 genes associated with peripheral blood TREC levels (p<0.05). Heterozygosity of the synonymous variant rs2230604 in the PTPN1 gene was associated with a significantly lower (531 vs. 259, p=0.005) TREC level, as compared to the homozygous major variant. We also found eight SNPs in the LEP/PPARG/CRP genes associated with variations in influenza-specific HAI and B-cell responses (p<0.05). Our results suggest that specific allelic variations in the leptin-related genes may influence adaptive immune responses to influenza vaccine., (Copyright © 2013 Elsevier Ltd. All rights reserved.)

Although vaccination campaigns have significantly reduced the global burden of rubella disease, there are still regional outbreaks and cases of congenital rubella syndrome. Rubella vaccination elicits a strong humoral as well as cellular response. The relationship between these two measures in response to rubella vaccine is poorly understood. We have previously reported no correlation between rubella-virus-specific cytokine secretion and IgG antibody levels after rubella vaccination. In the current study, we extend our previous work to report correlations between secreted cytokines and functional neutralizing antibodies after rubella vaccination in four distinct cohorts. There was evidence of significant differences (p < 0.05) in rubella-virus-specific humoral and cellular responses between cohorts. When investigating relationships between rubella-vaccine-specific humoral and cellular immunity, we observed a significant correlation between neutralizing antibodies and IFN-γ (r(s) = 0.21, p = 0.0004). We also observed correlations in subjects with extreme humoral immune phenotypes and IFN-γ levels in two of the four cohorts (r(s) = 0.32, p = 0.01; r(s) = 0.36, p = 0.01, respectively). These findings indicate that there is a high level of heterogeneity in rubella-specific immune responses between study populations. We believe that the novel correlation discovered between IFN-γ and neutralizing antibody titers will give future insight into the functional mechanisms of immunity induced by rubella virus and other live viral vaccines.

Background: Cytokines are important immune mediators of classical Hodgkin lymphoma (CHL) pathogenesis, and circulating levels at diagnosis may help predict prognosis. Germline single nucleotide polymorphisms (SNPs) in immune genes have been correlated with cytokine production and function., Methods: We investigated whether selected germline SNPs in IL10 (rs1800890, rs1800896, rs1800871, rs1800872), TNFA (rs1800629), IL6 (rs1800795), ILRN (rs419598), INFG (rs2430561) and CCL17 (rs223828) were associated with circulating levels of related cytokines at diagnosis and progression-free survival (PFS) in CHL. Patients were from France (GELA, N=464; median age=32years) and the United States (Iowa/Mayo Specialized Program Of Research Excellence [SPORE], N=239; median age=38years); 22% of 346 CHL cases with EBV tumor status were positive., Results: There was no association with any of the SNPs with cytokine levels. Overall, there was no association of any of the SNPs with PFS. In exploratory analyses by EBV status, TNFA rs1800629 (HRAA/AG=2.41; 95%CI, 1.17-4.94) was associated with PFS in EBV-negative GELA patients, with similar trends in the SPORE patients (HRAA/AG=1.63; 95%CI, 0.61-4.40). In a meta-analysis of the two studies, TNFA (HRAA/AG=2.11; 95%CI, 1.18-3.77; P=0.01) was statistically significant, and further adjustment for the international prognostic system did not alter this result., Conclusions: This study showed that germline variation in TNFA was associated with CHL prognosis for EBV-negative patients, which will require confirmation. These results support broader studies on the differential impact of genetic variation in immune genes on EBV-positive vs. EBV-negative CHL pathogenesis., (Copyright © 2013 Elsevier Ltd. All rights reserved.)

We assessed the effects of sex, race and ethnicity on smallpox vaccine-induced immune responses in 1071 armed forces members after primary Dryvax(®) smallpox vaccination, including 790 males and 281 females; 580 Caucasians, 217 African-Americans, and 217 Hispanics. Analysis of vaccinia-specific cytokine responses revealed that Caucasians had higher total IFNγ ELISPOT responses (median 57 spot-forming units/SFUs per 200,000 cells, p=0.01) and CD8(+)IFNγ ELISPOT responses (12 SFUs, p<0.001) than African-Americans (51 and 4 SFUs, respectively) and Hispanics (47 and 8 SFUs, respectively). Similarly, Caucasians secreted higher levels of vaccinia-specific IL-2 (p=0.003) and IFNα (p<0.001) compared to other racial/ethnic groups. Males had higher total IFNγ ELISPOT responses (median 55 SFUs) compared to females (41 SFUs, p<0.001). We observed statistically significant sex-related differences in the secretion of IL-2 (p<0.001), IL-1β (p<0.001) and IL-10 (p=0.017). These data suggest that vaccinia-specific cytokine responses following primary smallpox vaccination are significantly influenced by race and sex of vaccinees., (Copyright © 2013 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.)