Search

The literature is still scarce on studies describing S. mutans global gene expression under clinical conditions such as those found on complex biofilms from sound root surfaces (SRS) and carious root surfaces (RC). This study aimed to investigate the S. mutans gene expression and functional profile within the metatranscriptome of biofilms from SRS and from RC in an attempt to identify enriched functional signatures potentially associated with healthy to disease transitioning process. Total RNA was extracted, and prepared libraries (SRS=10 and RC=9) were paired-end sequenced using the Illumina HiSeq2500. Read count assigned to each gene of the S. mutans UA159 strain were obtained. Differentially expressed genes (DEG) between SRS and RC were identified using the DESeq2 R package and weighted gene co-expression network analysis (WGCNA) was performed to explore and identify functional modules related to SRS and RC. We found seventeen DEG between SRS and RC samples, with three overexpressed in RC and related to membrane protein, alanyl-tRNA synthetase and GTP-binding protein with the remaining ones overexpressed in SRS samples and related to hypothetical protein, transposon integrase, histidine kinase, putative transporter, bacteriocin immunity protein, response regulator, 6-phospho-beta-galactosidase, purine metabolism and to transcriptional regulator. Key-functional modules were identified for SRS and RC conditions based on WCGNA, being 139 hub genes found on SRS key-module and 17 genes on RC key-module. Functional analysis of S. mutans within the metatranscriptome of biofilms from sound root and from carious root revealed a similar pattern of gene expression, and only a few genes have been differentially expressed between biofilms from sound root surfaces and from root carious lesions. However, S. mutans presented a greater functional abundance in the lesion samples. Some functional patterns related to sugar (starch, sucrose, fructose, mannose and lactose) and heterofermentative metabolisms, to cell-wall biosynthesis and to acid tolerance stress seem to be enriched on carious root surfaces conferring ecological advantages to S. mutans. Altogether, the present data suggest that a functional signature may be associated with carious root lesions.

DNA Extraction Extract DNA from sample using the phenol/chloroform procedure or your kit of choice. We typically use the Mo Bio Power Soil DNA extraction kit for extracting DNA from soil and plant litter samples. Use the Nanodrop in the Martiny lab to estimate the concentration and purity of your DNA extraction. Dilute DNA to 10 ng/ul prior to PCR. PCR Amplification Pre-amplification checklist: All pipetting should be done with aerosol barrier, PCR certified pipet tips in a PCR work station On ice thaw primers, DNA and PCR master mix Decontaminate pipettors and interior surfaces of a PCR workstation with DNA/RNA Away or 10% bleach solution. UV irradiate PCR work station interior, pipettors and consumables for minimum 15 min All samples should be amplified in triplicate. Include negative (no template) and positive (DNA isolated from mushroom) controls. Primer information: Forward primer: 454 primer B + 'AG' linker + SSU817f GCCTTGCCAGCCCGCTCAGAGTTAGCATGGAATAATRRAATAGGA Reverse Primer: 454 primer A + 12-base bar code + 'AC' linker + ssu1196r GCCTCCCTCGCGCCATCAG-12 base bar code-ACTCTGGACCTGGTGAGTTTCC Example barcode: ACACACTATGGC Example primer sequence: GCCTCCCTCGCGCCATCAGACACACTATGGCACTCTGGACCTGGTGAGTTTCC PCR Cocktail: 22.5 ul PCR master mix (we use the Invitrogen Platinum PCR SuperMix) 1 ul BSA 0.75 ul 10 uM forward primer (all samples get the same forward primer) 0.75 ul 10 uM reverse primer (all samples get a unique barcoded reverse primer) 1 ul template DNA PCR cycle: Samples are initially denatured at 94°C for 10 min, then amplified using 30 cycles of 94°C for 45 sec, 52°C for 30 sec, and 72°C for 90 sec. A final extension of 10 min at 72°C is added at the end of the program to ensure complete amplification of the target region. Check for PCR product on a gel Amplicon Cleaning Combine the triplicate PCR reactions into a single volume Clean PCR reactions with a PCR clean up kit. The MoBio UltraClean PCR clean up kit and the Invitrogen Purelink PCR purification kit have both worked well. Amplicon Quantification Use the qubit system for quantifying DNA, with a few modifications. Instead of using the qubit assay tubes, prepare the samples in black microplates. Perform assay with 1 ul of PCR product Read the plates on the microplate reader in the Allison lab set at 485ex /530em. Estimate amplicon concentration using the standard curve. Amplicon Pooling Combine equal amounts of DNA per sample into single vessel (usually a 15 mL tube). Concentrate pooled amplicons using the Invitorgen Purelink PCR purification kit Run a gel to visualize pooled samples Depending on how your pooled amplicons look on the gel, you may need to gel purify the pooled amplicons. Pyrosequencing is biased towards shorter reads. If you have a messy band on your gel, it is important to purify your samples to improve the quality of the DNA you will receive. We used the Qiagen QIAquick Gel Extraction Kit. We ran samples out on a 1.4 % gel. The main drawback to performing a gel extraction is that you will almost certainly lose some of your sample. You may need to pool additional PCR product and perform a second gel extraction to obtain enough sample for sequencing. Remove contaminants from gel purified samples using an Invitrogen Purelink PCR purification kit. Estimate final sample concentration and purity Use the qubit system for estimating sample concentration. The sequencing facility requires 2-3 ug of DNA for sequencing. Use the Nanodrop in the Martiny lab for estimating sample purity. Samples with an A260/A280 ratio of ~1.8 typically provide optimal sequencing results. Send sample for sequencing Send samples to the Engencore sequencing facility at the University of South Carolina. Check their website for more specific details about what else to include in the shipment. Send samples overnight on dry ice