Search

Background and Aims Condensed tannins, responsible for berry and wine astringency, may have been selected during grapevine domestication. This work examines the phylogenetic distribution of condensed tannins throughout the Vitaceae phylogenetic tree. Methods Green berries and mature leaves of representative true-to-type members of the Vitaceae were collected before ‘véraison’, freeze-dried and pulverized, and condensed tannins were measured following depolymerization by nucleophilic addition of 2-mercaptoethanol to the C4 of the flavan-3-ol units in an organic acidic medium. Reaction products were separated and quantified by ultrahigh pressure liquid chromatography/diode array detection/mass spectrometry. Key Results and Conclusions The original ability to incorporate epigallocatechin (EGC) into grapevine condensed tannins was lost independently in both the American and Eurasian/Asian branches of the Vitaceae, with exceptional cases of reversion to the ancestral EGC phenotype. This is particularly true in the genus Vitis, where we now find two radically distinct groups differing with respect to EGC content. While Vitis species from Asia are void of EGC, 50 % of the New World Vitis harbour EGC. Interestingly, the presence of EGC is tightly coupled with the degree of leaf margin serration. Noticeably, the rare Asian EGC-forming species are phylogenetically close to Vitis vinifera, the only remnant representative of Vitis in Eurasia. Both the wild ancestral V. vinifera subsp. sylvestris as well as the domesticated V. vinifera subsp. sativa can accumulate EGC and activate galloylation biosynthesis that compete for photoassimilates and reductive power.

Fusarium oxysporum f. sp radicis-vanillae (Forv), the causal agent of Root and Stem Rot disease, is the main pathogen affecting vanilla production. Sources of resistance have been reported in Vanilla planifolia G. Jackson ex Andrews, the main cultivated vanilla species. Here we developed the first high-density genetic map in this species with 1,804 GBS-generated single nucleotide polymorphism (SNP) markers using 125 selfed progenies of the CR0040 traditional vanilla cultivar. Sixteen linkage groups (LG) were successfully constructed, with a mean of 113 SNPs and an average length of 207 cM per LG. The map had a high density with an average of 5.45 SNP every 10 cM and an average distance of 1.85 cM between adjacent markers. The first 3 LG were aligned against the first assembled chromosome of CR0040 and the other 13 LG were correctly associated with the other 13 assembled chromosomes. The population was challenged with the highly pathogenic Forv strain Fo072 using the root-dip inoculation method. Five traits were mapped and 20 QTLs were associated with resistance to Fo072. Among genes retrieved in the CR0040 physical regions associated with QTLs, genes potentially involved in biotic resistance mechanisms have been highlighted, coding for kinases, E3 ubiquitin ligases, pentatricopeptide repeat-containing proteins, and one leucine-rich repeat receptor underlying the qFo72_08.1 QTL. This study should provide useful resources for marker-assisted selection in V. planifolia.

Iron is an essential nutrient that regulates productivity in ~30% of the ocean. Compared with deep (>2000 meter) hydrothermal activity at mid-ocean ridges that provide iron to the ocean’s interior, shallow (2 .

Microsatellite data used to produce genetic structuring (Fig. 2) and PCoA (Fig. S3) are accessible on the online UMR PVBMT Cirad dataverse (https://doi.org/10.18167/DVN1/3OFMLH).; International audience; The leafless Vanilla species complex from the South-West Indian Ocean (SWIO) region has long been a taxonomic challenge, due to limited patterns of morphological differentiation and an absence of variation within chloroplast sequences. This complex includes seven known morphospecies: V. madagascariensis, V. bosseri, V. decaryana, and V. perrieri endemic to Madagascar, V. humblotii presumed as endemic to the Comoros Archipelago, but also present in Madagascar, V. roscheri from the East African coast, and V. phalaenopsis endemic to Seychelles. A previous population genetic study using microsatellite markers allowed us to distinguish, in addition to the five recognized Malagasy taxa, two other genetic clusters present in the East of the island. An integrative taxonomy approach was therefore conducted by combining microsatellite and morphological data used in the previous study with new data sets, and by adding ITS sequencing data, to validate the taxonomic level of these Malagasy genetic clusters and unravel phylogenetic relationships between SWIO species. As a result, based on phylogenetic, genotypic and morphological evidence, nine species were discriminated in the SWIO region, including seven in Madagascar, with two new eastern species. The leafless Vanilla group originated and diversified in Madagascar, from an ancestor of African descent, with three subsequent independent colonization events from Madagascar to the other territories of SWIO within the two main lineages (white versus yellow flower species). The new Malagasy species, V. allorgeae Andriamihaja & Pailler sp. nov., and V. atsinananensis Andriamihaja & Pailler sp. nov., are described and a new identification key is proposed.

Vanilla (Vanilla planifolia, Orchidaceae) is Madagascar's leading agricultural export resource which provides 80% of world's consumption. During a phytosanitary survey conducted from November 2019 to March 2021 in the main vanilla production regions of Madagascar, 250 plots were indexed for cymbidium mosaic virus (CymMV, Potexvirus genus) and odontoglossum ringspot virus (ORSV, Tobamovirus genus) the two most prevalent viruses of cultivated orchids worldwide (Zettler et al., 1990). For each plot, bulk samples (ten leaves taken at random) were assayed using Immunostrips (AGDIA, ISK 13301). A quarter of the plots (63/250) tested positive for CymMV. The highest prevalence of CymMV was observed in the SAVA region (57 out of 153 plots = 37,2%) where the virus has been reported since 1997 (Grisoni et al., 2010). Six plots located in the district of Mahanoro (Atsinanana) tested positive for ORSV. A few plants in these plots showed chlorotic often annular spots on their leaves. They were individually tested positive for ORSV, and negative for CymMV and potyviruses (Immunostrips AGDIA ISK 27200), the other two viruses reported so far in vanilla in Madagascar. To confirm the diagnosis of ORSV, leaf samples from five of the six infected plots were analysed by Tube Capture-RT-PCR (Grisoni et al., 2017) using two pairs of primers flanking the ORSV coat protein (CP) gene: OrCP1 (GGTCGGTAATGGTGTTAG) / OrCP2 (TGCATTATCGTATGCTCC), and CPOR-F(ATGTCTTACACTATTACAGACC) / CPOR-R(TTAGGAAGAGGTCCAAGTAAG). The five samples gave amplicons of the expected size (820 nt and 476 nt, respectively) and were sequenced with Sanger technology (Macrogen, The Netherlands). The ORSV-CP sequences of the Mahanoro isolates showed very close similarity to 198 ORSV-CP sequences from GenBank (95.8% to 99.6% nucleotide and 94.5 to 100% amino-acid identities), and less than 75.4% nucleotide (80.1% amino-acid) identities with Bell pepper mosaic virus (DQ355023), the tobamovirus closest to ORSV. The five ORSV-CP sequences from vanilla were deposited in GenBank under accessions numbers OM847399 to OM847403. These data confirmed that ORSV infects vanilla vines in Madagascar. To our knowledge, this is the first report of this virus in Madagascar and of its ability to infect symptomatically V. planifolia. The five ORSV isolates from vanilla had more than 98.7 % nucleotide identities of CP gene and clustered into a monophyletic group in maximum likelihood phylogenetic tree, suggesting a single origin of these isolates. To further investigate the origin of ORSV in Madagascar, we made use of RNA sequences isolated at different points in time to infer the timing of evolutionary events (Rieux et al., 2016). We estimated the CP gene substitution rate to 4.8E-4 subst/site/year [95%HPD 2.1E-4 - 8.7E-4] which is close to the estimate of He et al. (2019) based on a slightly different sequences set (1.25E-3 subst/site/year). We dated the initial contamination of vanilla plts by ORSV between 2004 and 2013. Both ORSV and CymMV have deleterious effects on many ornamental orchids, and the pathogenicity of CymMV is exacerbated when co-infecting with ORSV (Lee et al., 2021). Therefore, ORSV represents a new threat to the Malagasy vanilla crop, especially in regions where CymMV is already rife. Given the economic importance of vanilla cultivation in the country, the implementation of prophylactic measures aimed at preventing the spread of ORSV, in particular through the sanitary control of cuttings, should be a priority for the vanilla industry.

With over 25,000 species, orchids are among families with remarkable high rate of diversification. Since Darwin's time, major advances attributed the exceptional diversity of orchids to plant–pollinator interactions. However, unraveling the processes and factors that determine the phenotypic and genotypic variation of natural orchid populations remains a challenge. Here, we assessed genetic population structure and floral differentiation in recently diverged leafless Vanilla species in a world biodiversity hotspot, Madagascar, using seven microsatellite loci and 26 morphometric variables. Additionally, analyses were performed to test for the occurrence of any patterns of isolation by distance, isolation by environment, and isolation by adaptation and to detect possible physical barriers that might have caused genetic discontinuities between populations. Positive inbreeding coefficients detected in 22 populations were probably due to the presence of null alleles, geitonogamy and/or some admixture (sympatric species). In contrast, the only high‐altitude population showed an important rate of clonality leading to heterozygote excess. Genetic diversity was maximum in western populations, suggesting a postglacial colonization to the north and south. Clustering analyses identified seven genetic groups characterized by specific floral traits that matched five botanical descriptions in the literature. A contribution of montane refugia and river barriers on population differentiation was detected. We also detected combined effects of IBD/IBE and IBE/IBA on genetic differentiation and suggested this pattern is more likely determined by ecological isolation, although pollinator‐mediated divergent selection could not be ruled out for some of the species. Overall, this study provides further insights on speciation in orchids, a group for which Madagascar shows one of the world's highest level of endemism and confirms the importance of the peculiar biogeography of the island in shaping species differentiation., The aim of our study was to resolve evolutionary processes in a group of recently diverged Vanilla species in Madagascar, using a population genetics approach, with a combination of molecular data (microsatellites), floral morphological data, ecological data, and geographic distances. Clustering analyses identified seven genetic groups characterized by specific floral traits that matched five botanical descriptions in the literature. A contribution of montane refugia and river barriers on population differentiation was detected. We also detected combined effects of IBD/IBE and IBE/IBA on genetic differentiation and suggested this pattern is more likely determined by ecological isolation, although pollinator‐mediated divergent selection could not be ruled out for some of the species.

An ambitious vanilla (Vanilla planifolia Jacks. ex Andrews) breeding program was started in Madagascar in the early 1950s to control Fusariosis, a serious crop disease caused by the soil fungus Fusarium oxysporum. The breeding program has produced tens of thousands of new vanilla genotypes of which a small number have been selected and conserved. This article examines the history of the Malagasy breeding work during the second half of the twentieth century, and outlines a possible strategy to exploit the data and exceptional genetic resources it has produced. The National Center for Research Applied to Rural Development has preserved 19 of the very diverse and original hybrids at the vanilla station in Ambohitsara (Antalaha, Madagascar). Two of them are particularly remarkable, namely Manitra ampotony for its exceptionally high vanillin content and Tsy taitra for its strong resistance to Fusariosis and its aromatic profile, which is similar to that of Bourbon vanilla. However, the global vanilla industry remains fragile because varietal diversity now available cannot overcome current and foreseeable constraints. The hybrids formed from multiple crosses between V. planifolia and three aromatic species, (V. pompona Schiede, V. tahitensis J.W. Moore and V. phaeantha Rchb.f.), constitute a preferred resource for further vanilla breeding. Facilitating its wide use by current research and extension teams is, in our opinion, essential to meet the growing need of producers for better-adapted varieties to supply the market of one of the most highly prized natural flavors in the world.

The Vanilla genus is a complex taxonomic group characterized by a vegetative reproduction mode combined with intra- and inter-specific hybridizations, and polyploidy events. These factors strongly impact the diversification of the genus and complicate the delimitation of taxa. Among the hundred Vanilla species, Vanilla planifolia Jacks. ex Andrews and Vanilla × tahitensis J. W. Moore are the main cultivated aromatic species. We applied Genotyping-by-Sequencing to explore the genetic diversity of these two cultivated vanilla species, seven closely related species and nineteen interspecific hybrids. The inter- and intra-specific relationships of 133 vanilla accessions were examined based on 2004 filtered SNPs. Our results showed a strong genetic structuring between the nine species studied, with wild species showing much lower heterozygosity levels than cultivated ones. Moreover, using Bayesian clustering analyses, the kinship of several hybrids could be verified. We evidenced in particular that Vanilla sotoarenasii and Vanilla odorata C.Presl may be the parental species of V. x tahitensis. The analysis of 1129 SNPs for 84 V. planifolia accessions showed a clear genetic demarcation between the vegetatively propagated traditional vanilla cultivars compared to the accessions derived from sexual reproduction, and a higher genetic diversity and lower heterozygosity of the latter (Ho = 0.206) compared to the former (Ho = 0.362). Our data are consistent with a single-step domestication for V. planifolia in accordance with the recent history of its cultivation. It also opens avenues to breed new V. planifolia varieties adapted to biotic and abiotic constraints and to reduce mutational load induced by clonal propagation.

International audience

Vanilla flavor is derived from the cured fruits of two orchid species Vanilla planifolia and V. × tahitensis. About twenty other Vanilla species are also credited with scented fruits, but very little is known about their aromatic features. We investigated the aromatic compound content of the ripe fruits of 30 vanilla accessions obtained from eight species and three hybrids. Glucovanillin plus six phenolic and one anisic aglycones, extracted after enzymatic hydrolysis, were quantified by High-Performance Liquid Chromatography and Ultra-Violet detection. The analysis of the aromatic contents and the principal components showed clear-cut differences in the aromatic content of the species and varieties studied. The total content of aromatic compounds separated the three species most distantly related to V. planifolia, namely V. lindmaniana, V. crenulata and V. imperialis, from the other species notably by the absence of vanillin potential and a very low total aromatic potential (

Powerful DNA barcodes have been much more difficult to define in plants than in animals. In 2009, the international Consortium for the Barcoding Of Life (CBOL) chose the combination of the chloroplast genes (rbcL + matK) as the proposed official barcode for plants. However, this system has got important limits. First, any barcode system will only be useful if there is a clear barcode gap and if species are monophyletic. Second, chloroplast and mitochondrial (COI gene used for animals) barcodes will not be usable for discriminating hybrid species. Moreover, it was also shown that, using chloroplast regions, maximum species discrimination would be around 70% and very variable among plant groups. This is why many authors have more recently advocated for the addition of the nuclear ITS region to this barcode because it reveals more variations and allows the resolution of hybrid or closely related species. We tested different chloroplast genes (rbcL, matK, psaB, psbC) and the nuclear ITS region in the genus Vanilla, a taxonomically complex group and therefore a good model to test for the efficiency of different barcode systems. We found that the CBOL official barcode system performed relatively poorly in Vanilla (76% species discrimination), and we demonstrate that adding ITS to this barcode system allows to increase resolution (for closely related species and to the subspecies level) and to identify hybrid species. The best species discrimination attained was 96.2% because of one paraphyletic species that could not be resolved.

Powerful DNA barcodes have been much more difficult to define in plants than in animals. In 2009, the international Consortium for the Barcoding Of Life (CBOL) chose the combination of the chloroplast genes (rbcL + matK) as the proposed official barcode for plants. However, this system has got important limits. First, any barcode system will only be useful if there is a clear barcode gap and if species are monophyletic. Second, chloroplast and mitochondrial (COI gene used for animals) barcodes will not be usable for discriminating hybrid species. Moreover, it was also shown that, using chloroplast regions, maximum species discrimination would be around 70% and very variable among plant groups. This is why many authors have more recently advocated for the addition of the nuclear ITS region to this barcode because it reveals more variations and allows the resolution of hybrid or closely related species. We tested different chloroplast genes (rbcL, matK, psaB, psbC) and the nuclear ITS region in the genus Vanilla, a taxonomically complex group and therefore a good model to test for the efficiency of different barcode systems. We found that the CBOL official barcode system performed relatively poorly in Vanilla (76% species discrimination), and we demonstrate that adding ITS to this barcode system allows to increase resolution (for closely related species and to the subspecies level) and to identify hybrid species. The best species discrimination attained was 96.2% because of one paraphyletic species that could not be resolved.

In Low Nutrient Low Chlorophyll areas, such as the Mediterranean Sea, atmospheric fluxes represent a considerable external source of nutrients likely supporting primary production especially during stratification periods. These areas are expected to expand in the future due to lower nutrient supply from sub-surface waters caused by enhanced stratification, likely further increasing the role of atmospheric deposition as a source of new nutrients to surface waters. Yet, whether plankton communities will react differently to dust deposition in a warmer and acidified environment remains an open question. The impact of dust deposition both in present and future climate conditions was assessed through three perturbation experiments in the open Mediterranean Sea. Climate reactors (300 L) were filled with surface water collected in the Tyrrhenian Sea, Ionian Sea and in the Algerian basin during a cruise conducted in May/June 2017 in the frame of the PEACETIME project. The experimental protocol comprised two unmodified control tanks, two tanks enriched with a Saharan dust analog and two tanks enriched with the dust analog and maintained under warmer (+3 °C) and acidified (−0.3 pH unit) conditions. Samples for the analysis of an extensive number of biogeochemical parameters and processes were taken over the duration of the experiments (3–4 d). Here, we present the general setup of the experiments and the impacts of dust seeding and/or future climate change scenario on nutrients and biological stocks. Dust addition led to a rapid and maximum input of nitrate whereas phosphate release from the dust analog was much smaller. Our results showed that the impacts of Saharan dust deposition in three different basins of the open Northwestern Mediterranean Sea are at least as strong as those observed previously in coastal waters. However, interestingly, the effects of dust deposition on biological stocks were highly different between the three investigated stations and could not be attributed to differences in their degree of oligotrophy but rather to the initial metabolic state of the community. Finally, ocean acidification and warming did not drastically modify the composition of the autotrophic assemblage with all groups positively impacted by warming and acidification, suggesting an exacerbation of effects from atmospheric dust deposition in the future.

Black spot symptoms were reported on vanilla plants in Reunion Island in 2011. They have repeatedly reduced annual pod production by 10% to 30%. The disease is characterized by dark spots that appear in slight depressions on flowers, pods, leaves and stems. The spots then develop into broad clearly depressed necrotic plaques. Morphological and molecular analyses, as well as pathogenicity tests, identified the fungus Colletotrichum orchidophilum (Ascomycota) as the causal agent of the disease. Inoculation tests in controlled conditions confirmed that the two C. orchidophilum strains isolated from fruit lesions are pathogenic on the leaves and fruits of Vanilla planifolia (accessions CR0001 and CR0020). However, these strains induced symptoms only when the epidermis of leaves and fruits had been punctured by a needle. In the absence of injury, no symptom appeared. Colletotrichum arxii and Fusarium proliferatum (Ascomycota) are fungal species that are also frequently isolated from black spot lesions. However, they are not pathogenic to vanilla. This is the first report of C. orchidophilum in Reunion Island. It is also the first demonstration of C. orchidophilum's pathogenicity to an orchid. Simple preventive control measures were proposed to reduce the incidence of black spot disease in vanilla plots.

Vanillin is the most important flavor compound in the vanilla pod. Vanilla planifolia vanillin synthase (VpVAN) catalyzes the conversion of ferulic acid and ferulic acid glucoside into vanillin and vanillin glucoside, respectively. Desorption electrospray ionization mass spectrometry imaging (DESI-MSI) of vanilla pod sections demonstrates that vanillin glucoside is preferentially localized within the mesocarp and placental laminae whereas vanillin is preferentially localized within the mesocarp. VpVAN is present as the mature form (25 kDa) but, depending on the tissue and isolation procedure, small amounts of the immature unprocessed form (40 kDa) and putative oligomers (50, 75 and 100 kDa) may be observed by immunoblotting using an antibody specific to the C-terminal sequence of VpVAN. The VpVAN protein is localized within chloroplasts and re-differentiated chloroplasts termed phenyloplasts, as monitored during the process of pod development. Isolated chloroplasts were shown to convert [14C]phenylalanine and [14C]cinnamic acid into [14C]vanillin glucoside, indicating that the entire vanillin de novo biosynthetic machinery converting phenylalanine to vanillin glucoside is present in the chloroplast.

Vanilla sotoarenasii M.Pignal, Azofeifa-Bolaños & Grisoni sp. nov. urn:lsid:ipni.org:names:77160155-1 Figs 2, 3, 6 Diagnosis A Vanilla planifolia similis, sed folia caulesque breviores (folium: 7.6̅10.6 × 2.7̅3.3 cm versus 14.7̅14.9 × 4.8̅5 cm), laminae breviores, ellipticae-oblongaeque, Fores albiores, tubus Foris, sepala petalaque breviores, sepalum dorsale angustius, labellum angustiius cum papillis salientioribus, ovarium brevitius (3.8̅4.6 cm versus 5̅5.3 cm), fructus brevitior (11.4 cm versus 20.1̅20.3 cm) indehiscensque, sectio fructi cylindrica (versus trigona). Moleculae aromaticae fructi absimilis. Etymology This species is dedicated to Dr. Miguel Angel Soto Arenas (1963̅2009), authority in orchid Foristics and ecology, particularly in the Vanilla genus. Type material Holotype COSTA RICA: Cahuita (ex hort. parc E. Liais, from plants collected by B. Gosselin in 1993), 8 Oct. 1996, Pignal 396 b (holo-: P: P00075132). Paratypes COSTA RICA: Limón Province: Talamanca, Refugio Nacional Mixto de Vida Silvestre Gandoca- Manzanillo, 9.594° N, 82.602° W, altitude 2 m, 14 Nov. 2013 (originally collected), cultivated in BRC Vatel, Saint Pierre, La Réunion, France CRV2180, 28 Feb. 2016, M. Grisoni & J.B. Azofeifa-Bolaños V. sp. nov. V. Compounds / 100 % 100 g % Vanillin 0.26 a 10.9 2.28 b 68.0 Vanillic acid nd a 0.0 0.19 b 5.5 Vanillyl alcohol 0.73 a 31.0 0.32 b 9.6 Total vanillyl compounds 0.99 a 41.9 2.79 b 83.1 p -hydroxybenzaldehyde 0.20 a 8.5 0.18 a 5.4 p -hydroxybenzoic acid 0.37 a 15.8 0.37 a 11.2 p -hydroxybenzyl alcohol 0.27 a 11.6 0.01 b 0.3 Total p -hydroxybenzyl compounds 0.85 a 35.9 0.56 b 16.9 Anisyl alcohol 0.24 a 10.2 nd b 0.0 Anisaldehyde 0.03 b 1.4 nd b 0.0 Anisic acid 0.25 a 10.6 nd b 0.0 Total anisyl compounds 0.52 a 22.2 nd b 0.0 Total 2.36 a 100 3.35 b 100sotoarenasii planifolia g g dw g / dw JJMM01 (REU: REU13363); Canton of Talamanca, Refugio de Vida Silvestre Gandoca-Manzanillo (originally collected), cultivated in INISEFOR, Heredia, Costa Rica, 14 Nov. 2013, M. Grisoni, B. Azofeifa and J. García 2180 (CR 281507), cultivated at the same locality, B. Azofeifa and J. García 0 0 47 (CR 281508); Canton of Siquirres, Barra de Parismina (originally collected), cultivated in INISEFOR, Heredia, Costa Rica, 8 Feb. 2013, B. Azofeifa, J. García and A. Paniagua 0 0 0 2 (CR 281509). Description Hemiepiphytic vine up to 15 m high. Stems Fexuous, terete, smooth, green, 5̅6 mm thick; internodes, sometimes slightly curved apically, ca 10 cm long. Terrestrial roots pubescent, ramiFed, ca 2 mm thick; both attaching and free aerial roots terete, pubescent, ca 2 mm thick at base, ca 3.5 mm at middle. Leaves regularly alternate. Blade elliptic to obovate, slightly Feshy (ca 27 veins visible on dry specimens); base rounded to cuneate, shortly pseudopetiolate; apex shortly acuminate (acumen sharp, 12 mm long, 5 mm at base), slightly recurved; margin thinned; pseudopetiole canaliculate, 16 × 5 mm. InForescence: raceme, ca 10̅20-Fowered, 7̅13 cm, sometimes located on short axillary branches, sometimes lying on leafy stems. 3̅4 inForescence bracts, foliaceous, basal bract pseudopetiolate (40 × 20 mm), upper bract sessile and shorter (20 × 8 mm and 12 × 3 mm). Flowers at anthesis successively, ephemeral, 1̅2 simultaneously, white green, sepals forming an angle of approximately 45° with axis of column, petals more or less parallel to this axis. Ovary terete, smooth, slightly arcuate, white at base and green on upper ¾, 30 mm long and 4 mm in diameter. Parts of perianth with whitish inclusions (visible on dry specimens), longitudinally oriented, ca 0.1̅2 mm long, more numerous on petals, dorsal sepal narrow elliptic to oblanceolate, ca 11-veined, 40 × 10 mm, apex acute, rounded, base attenuate-clawed, slightly concave, canaliculate. Lateral sepals, elliptic asymmetric, slightly falciform, ca 11-veined, 38 × 10.5 mm, apex acute, slightly cupuliform, base attenuate, canaliculate, 4 mm wide. Petals elliptic asymmetric, slightly falciform, ca 12-veined, carinate dorsally (carena 1.2 mm wide), 38 × 9 mm, apex rounded, base attenuate, 3 mm wide (Fig. 6). Labellum attached to column along margins of 5/7 (ca 20 mm), funnel-shaped, spread apically (opening about 10 mm), trilobed, ca 30-veined ramiFed in distal third, margin crenulate. With 5̅6 Fmbriated scales, ca 1.5 × 1.5 mm, at about middle of labellum. Lateral lobes, obliquely triangular, ca 11-veined, 10 mm high and 7 mm wide, margins widely undulate. Midlobe quadrate, 20 mm wide and 6 mm high, about 12-veined, converging at apex. Papillae on four central veins, on apical half. Column trigonous-semicylindrical, 28 mm long, 2.5 mm wide, apically with 2 lateral auricles, crenulate, 2.5 mm high and 4 mm wide. Rostellum quadrangular, ca 3 × 3 mm. Stigma bilobed. Anther articulated, connective keel-shape, 2 × 2 mm, bicarinate on top. Operculum helmet-shaped, 2 × 3 mm. Pollinarium, 2. Fruit arcuate, banana-shaped, green, turning yellowish and then brown, 11̅16 × 1.5 cm, with cylindrical section. Phenology The Fowering period occurs from October to March in Costa Rica. IUCN status –Vulnerable The populations of V. sotoarenasii sp. nov. observed in the province of Limón showed strong vegetative development of vines and natural seed set was frequently observed. However, a small number of populations have so far been observed and only over a very limited area of Limón Province (10 populations over a coastal strip of about 50 km²), and its habitat is periodically submerged by the ocean. This makes us inclined to tentatively classify V. sotoarenasii sp. nov. as vulnerable D2 (IUCN 2012) until further data on distribution and population dynamics have been obtained. Discussion Using complementary approaches involving morphology of the reproductive and vegetative systems, molecular barcoding and the accumulation of secondary metabolites in fruits, we highlighted speciFc traits for the vanilla populations sampled on the Caribbean coast of Costa Rica which revealed a new taxon, V. sotoarenasii sp. nov. The morphology of the Fowers and leaves clearly assigned V. sotoarenasii sp. nov. within the V. planifolia group (Soto Arenas & Dressler 2010). Based on Fower morphology, V. sotoarenasii sp. nov. was more similar to V. planifolia and V. × tahitensis than to any other vanilla species of this group. However, V. sotoarenasii sp. nov. differs from the other two species by several characteristics (Table 6). Firstly, our data and previous data by Costantin & Bois (1915) and Portères (1953) showed that V. sotoarenasii sp. nov. has a signiFcantly smaller size for all organs measured (stem, leaf, Fower and fruit) compared to V. planifolia and V. × tahitensis, and had a distinct shape of the leaves: elliptic to obovate in the case of V. sotoarenasii sp. nov., elliptic to oblong for V. planifolia and narrowly oblong to lanceolate for V. × tahitensis (Table 6). In addition, the Fowers of V. sotoarenasii sp. nov. are more whitish, with a narrower label showing marked papillae, compared to those of V. planifolia, which are more greenish, with a wider label and smooth papillae. On the basis of HPLC quantiFcation of hydrolyzed volatile compounds in mature fruits, the aromatic precursors of V. sotoarenasii sp. nov. are very distinct from those of V. planifolia. In particular, fruits of V. sotoarenasii sp. nov. were characterized by less predominant vanillin content and the presence of anisyl compounds. They should develop, after over-maturation or curing, Favors extremely different from those of V. planifolia and more similar to those of V. pompona or V. × tahitensis (Pérez-Silva et al. 2006; Brunschwig et al. 2009; Maruenda et al. 2013). On the other hand, molecular analysis of nuclear DNA sequences (ITS) unambiguously separated the V. sotoarenasii sp. nov. group of plants from the V. planifolia group including 68 accessions originating from seven countries (Comoros, Costa Rica, Guatemala, Madagascar, Mayotte, Mexico, and La Réunion). This result is corroborated by ampliFed fragment length polymorphism (AFLP) analyses by Bory et al. (2008) that clearly separated V. sotoarenasii sp. nov. CR0068 from 303 V. planifolia genotypes of diverse origins with an average distance comparable to the distance between V. planifolia and V. × tahitensis. The facts that i) at the plastid DNA level (partial mat K sequence) V. sotoarenasii sp. nov. and V. planifolia share the same clade, and ii) in the ITS phylogeny V. sotoarenasii sp. nov. is in an internal position within the V. planifolia clade (like V. helleri within the V. odorata cluster), suggest the recent radiation of V. sotoarenasii sp. nov. from V. planifolia populations. So far, V. sotoarenasii sp. nov. has only been observed in the Limón Province of Costa Rica where it is sympatric with V. planifolia, which has been reported as native to Costa Rica (Soto Arenas & Dressler 2010). However, recent introductions in the country of V. planifolia cultivars and hybrids have also been documented (Soto Arenas & Dressler 2010; Belanger & Havkin-Frenkel 2011; Varela Quirós 2011). Historical, genetic and phylogenetic data are insufFcient to decide whether V. sotoarenasii sp. nov. derived from natural or introduced populations of V. planifolia, nor how and when the radiation occurred. Orchid species are often interfertile, which allows them to create interspeciFc and even intergeneric fertile hybrids. Many interspeciFc hybrids between species of Vanilla have been produced in the last decades by botanists and agronomists (Knudson 1950; Theis & Jiménez 1957; Divakaran et al. 2006). In nature, however, interspeciFc hybrids are prevented by reproductive barriers that result primarily from the inability of pollinators to transfer pollen from one species to another.Within the limits of our sampling, we have never observed intermediary types, at the genetic or morphological level, in the Limón area, which suggests that a reproductive barrier may exist between V. planifolia and V. sotoarenasii sp. nov. Indeed, in the case of sympatric populations of the two very closely related species V. barbellata Rchb. f. and V. dilloniana Correll, having synchronous Fowering and the same pollinator in western Puerto Rico, intermediary types were observed, demonstrating natural interspeciFc hybridizations (Nielsen 2000). We hypothesize that the differences in Fower morphology observed between V. planifolia and V. sotoarenasii sp. nov. impede gene Fow from one species to another, which enhanced the radiation of the population in Limón. Vanilla pollinationis bee-dependent(Ackerman1986; Gigant et al. 2011)and Fower size difference is likely to constitute a reproductive barrier between species by selecting compatible pollinators. This has been observed for instance in Peru where, due to their small size, the Mellipona bees did not remove pollen when visiting V. grandiFora Lindl. Fowers, and therefore did not contribute to its pollination (Lubinsky et al. 2006). Given the signiFcant size reduction of the Fowers of V. sotoarenasii sp. nov. compared to those of V. planifolia, it is unlikely that a bee capable of pollinating one of the two species would be able to pollinate the other. In addition to size compatibility, the probability of pollinator visits is frequently increased by the aromatic metabolites emitted by orchid Fowers, which act as bee attractants (Ackerman 1986; Pansarin & Pansarin 2014). This is particularly important for vanilla Fowers that are open a single day, which reduces the chances of pollen-pollinator encounter. Analysis of the volatile compounds emitted by Fowers from various Vanilla species (unpublished data) has shown in particular that in V. planifolia (n = 4) the major compounds are a hydrocarbon monoterpene, (E)-β-ocimene (representing 17.10 ± 14.08% of all detected compounds), and an aromatic compound, 2,6-bis (1,1-dimethylethyl)- 4-(1-oxopropyl) phenol (11.59 ± 8, 04%), while in V. sotoarenasii sp. nov. (n = 1), only (E)-β-ocimene was predominantly found (63.26%). This difference in the nature of volatile emissions between the two species could also contribute to the speciFcity of the pollinators visiting the Fowers. Furthermore, the earlier Fowering of V. sotoarenasii sp. nov. compared to V. planifolia may also contribute to favor self or geitonogamous pollination as well as provide greater reproductive success to V. sotoarenasii sp. nov., as pointed out for non-rewarding orchids (Jersáková et al. 2006; Sun et al. 2009). All these factors hindering gene Fow between populations of V. sotoarenasii sp. nov. and V. planifolia may account for the radiation that led to the emergence of V. sotoarenasii sp. nov., a species that is genetically, morphologically, and biochemically distinct from V. planifolia. Finally, given its original aromatic content combining vanilyl and anisic notes, its high level of resistance (at least for CR0068) to the Fusarium root rot of vanilla (Koyyappurath et al. 2015), and its early and abundant Fowering in culture, V. sotoarenasii sp. nov. could be a promising genitor for breeding programs aiming to produce new vanilla varieties for the agroindustry.

We describe a new vanilla species growing in sympatry with Vanilla planifolia Jacks. ex Andrews (Orchidaceae) in the province of Limón, Caribbean coast of Costa Rica. The morphology of the reproductive and vegetative organs observed on vines cultivated under shade-house, the nuclear (Internal Transcribed Spacer) and plastid (matK) nucleotide sequences, as well as the contents of aromatic compounds measured in ripe fruits, show that this species is close to but distinct from V. planifolia. The name V. sotoarenasii M.Pignal, Azofeifa-Bolaños & Grisoni sp. nov. is proposed for this new Vanilla species endemic in Costa Rica. It is especially distinguished from V. planifolia by a reduction of about 30% of the size of the fruits and flowers, by a divergence of ITS sequences for at least two species-conserved nucleotides compared to seven other species of the V. planifolia group, and by the presence of anisic compounds and low content of phenolic compounds (including vanillin) in the fruits. These results confirmed the extension of the area of distribution of V. planifolia southward to Costa Rica, where a recent speciation process occurred. Because of its particular agronomic and aromatic properties, V. sotoarenasii sp. nov. could represent a valuable biological resource for the vanilla industry. Describimos una nueva especie de vainilla que crece en simpatía con Vanilla planifolia Jacks. ex Andrews (Orchidaceae) en la provincia de Limón, costa caribeña de Costa Rica. La morfología de los órganos reproductores y vegetativos observados en vides cultivadas bajo sombra, las secuencias nucleotídicas nucleares (Internal Transcrito Spacer) y plastidios (matK), así como el contenido de compuestos aromáticos medidos en frutos maduros, muestran que esta especie es cercano pero distinto de V. planifolia. El nombre V. sotoarenasii M. Pignal, Azofeifa-Bolaños & Grisoni sp. nov. Se propone para esta nueva especie de vainilla endémica en Costa Rica. Se distingue especialmente de V. planifolia por una reducción de aproximadamente el 30% del tamaño de los frutos y flores, por una divergencia de secuencias de ITS para al menos dos especies de nucleótidos conservados en comparación con otras siete especies del grupo de V. planifolia. , y por la presencia de compuestos anísicos y bajo contenido de compuestos fenólicos (incluida la vainillina) en los frutos. Estos resultados confirmaron la extensión del área de distribución de V. planifolia hacia el sur hasta Costa Rica, donde ocurrió un reciente proceso de especiación. Por sus particulares propiedades agronómicas y aromáticas, V. sotoarenasii sp. nov. podría representar un valioso recurso biológico para la industria de la vainilla. Descrevemos uma nova espécie de baunilha que cresce em simpatia com Vanilla planifolia Jacks. ex Andrews (Orchidaceae) na província de Limón, costa caribenha da Costa Rica. A morfologia dos órgãos reprodutivos e vegetativos observados em vinhas cultivadas à sombra, as sequências de nucleotídeos nucleares (espaçador de transcrição interno) e plastídeos (matK), bem como o conteúdo de compostos aromáticos medidos em frutos maduros, mostram que esta espécie está próxima, mas diferente de V. planifolia. O nome V. sotoarenasii M. Pignal, Azofeifa-Bolaños & Grisoni sp. Nov. É proposto para esta nova espécie endêmica de baunilha na Costa Rica. É especialmente distinta de V. planifolia por uma redução de aproximadamente 30% no tamanho de frutos e flores, por uma divergência de sequências ITS para pelo menos duas espécies de nucleotídeos conservados em comparação com outras sete espécies do grupo V. planifolia. , e pela presença de compostos anísicos e baixo teor de compostos fenólicos (incluindo vanilina) nos frutos. Esses resultados confirmaram a extensão da área de distribuição de V. planifolia ao sul até a Costa Rica, onde ocorreu um recente processo de especiação. Devido às suas propriedades agronômicas e aromáticas particulares, V. sotoarenasii sp. Novembro pode representar um valioso recurso biológico para a indústria de baunilha. Universidad Nacional, Costa Rica Université de La Réunion, Francia Instituto Tecnológico de Tuxtepec, México Instituto Tecnológico de Veracruz, México Universidad Autónoma de México, México Benemérita Universidad Autónoma de Puebla, México Universidad de San Carlos de Guatemala, Guatemala. Instituto de Investigación y Servicios Forestales Escuela de Ciencias Agrarias Escuela de Ciencias Biológicas

UMR BFP - Equipe Virologie; The genomes of two novel viruses were assembled from 454 pyrosequencing data obtained from vanilla leaves from La Réunion. Based on genome organization and homologies, one agent was unambiguously classified as a member of the genus Potexvirus and named vanilla virus X (VVX). The second one, vanilla latent virus (VLV), is phylogenetically close to three unclassified members of the family Alphaflexiviridae with similarity to allexiviruses, and despite the presence of an additional 8-kDa open reading frame, we propose to include VLV as a new member of the genus Allexivirus. Both VVX and VLV were mechanically transmitted to vanilla plants, resulting in asymptomatic infections.

The study aimed at evaluating the mating system of Vanilla mexicana (Orchidaceae) in natural populations in the island of Guadeloupe. A total of 132 V. mexicana samples were collected from 12 sites in Guadeloupe (Basse-Terre). Five other samples coming from Martinique and Mexico completed our analyses. Reproductive biology experiments excluding pollinators with bagged flowers revealed 53.9% fruit set, a value identical to the natural fruit set measured in the populations. These results suggested that V. mexicana, unlike most Vanilla species, was reproducing by self‐pollination and autogamy. Due to lack of specific DNA markers for V. mexicana, microsatellite markers, previously developed in other Vanilla species, were used for the genetic analyses. Only 6 out of the 33 markers tested were transferable and polymorphic in V. mexicana. A panel of 51 V. mexicana samples genotyped with 3 polymorphic loci was finally retained for Guadeloupe population genetic analyses. A heterozygote deficiency was detected, and the selfing rate was estimated to 74%. These results confirmed the reproductive biology results as self‐pollination and autogamy were the most likely explanation for this deficit. Results were compared to those from allogamous wild Vanilla species and discussed in the light of suggested existence of a pollinator for V. mexicana in other areas (Mexico).

International audience; In Vanilla species (Orchidaceae), the influence of sexual and asexual mating systems on the spatial structuring of population genetic diversity is understudied. These elements are crucial in restoration program to limit inbreeding depression and to maintain the genetic diversity of natural populations. In the remnant fragments of tropical dry forest in Mayotte (Comoros Archipelago, Indian Ocean), the clarification of the reproductive strategies of the orphan leafless Vanilla humblotii Rchb. f. will provide a better understanding of its fine-scale spatial genetic structure. Approaches combining reproductive biology and fine-scale spatial genetic structure analyses using ten mi-crosatellite markers in 49 individuals sampled in the only remaining large population of V. humblotii were employed to unravel the reproductive strategies of this species. The results showed that V. humblotii displays un-scented flowers and is allogamous and pollinator-dependent although also self-compatible. A total absence of pollen movements and a low level of natural fruit set (~1%) are reported, although a wild bee (Allodape obscuripennis Strand, Xylocopinae) and a bird (Nectarinia coquerelli,Nectarinidae) visitedthe flowers. A high ge-notypic diversity (G/N = 0.88) and a phalanx clonal growth are detected, and seed dispersal is higher than pollen dispersal. The phalanx distribution of the repeated genotypes (ramets arisen from the same genet) is responsible for significant autocorrelations detected at small distances. Limited inbreeding was detected although geitonogamy could have been enhanced by vegetative reproduction. This study highlights the need to perform interdisciplinary studies to unravel the reproductive strategy of clonal plant species with a deceptive pollination system.

On the global scale, N2 fixation provides the major external source of reactive nitrogen to the surface ocean, surpassing atmospheric and riverine inputs, and sustains ∼ 50 % of new primary production in oligotrophic environments. The main goal of the VAriability of vertical and tropHIc transfer of diazotroph derived N in the south wEst Pacific (VAHINE) project was to study the fate of nitrogen newly fixed by diazotrophs (or diazotroph-derived nitrogen) in oceanic food webs, and how it impacts heterotrophic bacteria, phytoplankton and zooplankton dynamics, stocks and fluxes of biogenic elements and particle export. Three large-volume ( ∼ 50 m3) mesocosms were deployed in a tropical oligotrophic ecosystem (the New Caledonia lagoon, south-eastern Pacific) and intentionally fertilized with ∼ 0.8 µM of dissolved inorganic phosphorus (DIP) to stimulate diazotrophy and follow subsequent ecosystem changes. VAHINE was a multidisciplinary project involving close collaborations between biogeochemists, molecular ecologist, chemists, marine opticians and modellers. This introductory paper describes in detail the scientific objectives of the project as well as the implementation plan: the mesocosm description and deployment, the selection of the study site (New Caledonian lagoon), and the logistical and sampling strategy. The main hydrological and biogeochemical conditions of the study site before the mesocosm deployment and during the experiment itself are described, and a general overview of the papers published in this special issue is presented.

The results of long term virus surveys in intensively cultivated vanilla plots in the Society Islands (French Polynesia), between 1999 and 2007 are reported here. The data confirmed a potential for high incidence of aphid borne viruses in particular Cucumber mosaic virus (CMV) and Watermelon mosaic virus (WMV) as well as the non vectored Cymbidium mosaic virus (CymMV). CMV had a particularly high prevalence (over 30% of the plots) and could severely damage up to 50% of the vines before blossom. Severe outbreaks of CMV were correlated to the presence of the weed Commelina diffusa as a reservoir of virus and aphid vectors. The application in 2003 of simple prophylactic measures resulted in a sharp reduction of virus incidence in new plantations, compared to levels of virus diseases recorded in the previous decade. Indeed, at the beginning of fruiting, the incidence of aphid borne viruses did not exceeded 1.6% of vines for the 29 shade houses which adopted the virus prophylaxis. The three remaining shade houses were severely (20–50%) infected by WMV or CymMV because of the planting of virus-infected cuttings. These results demonstrate the benefit of implementing prophylaxis at the scale of an archipelago, and widen the possibilities of developing intensive cultivation of vanilla in other areas confronted with similar virus constraints.

International audience; Variation in intron length in caffeic acid O-methyltransferase (COMT) in Vanilla was studied and demonstrated that COMT genes in Vanilla are organized with four exons and three introns. At least two to four different versions (either allelic or paralogous) of the COMT multigenic family in the genus Vanilla (in terms of intron sizes) were detected. The three introns were differentially variable, with intron-1 being the most length-polymorphic. Patterns of variations were in accordance with known phylogenetic relationships in the genus obtained with neutral markers. In particular, the genus displayed a strong Old World versus New World differentiation with American fragrant species being characterized by a specific 99 bp intron-1 size-variant and a unique 226 bp intron-3 variant. Conversely, leafless species of the genus displayed unexpected variations in intron lengths. Due to their role in primary (lignin) and secondary (phenolics, e.g., vanillin, alkaloids) metabolisms, COMT genes might not be neutral markers, and represent candidate functional markers for resistance, aromatic or medicinal properties of Vanilla species. Investigating the orthologous/paralogous status of the different genes revealed (in terms of intron size) will allow the evolution of the COMT genes to be studied. (Résumé d'auteur)

UMR AGAP - équipe PHIV - Plateforme d'histocytologie et d'imagerie cellulaire végétale; Root and stem rot (RSR) disease caused by Fusariurn oxysporurn f. sp. radicis-vanillae (Forv) is the most damaging disease of vanilla (Vanilla planifolia and V. x tahitensis, Orchidaceae). Breeding programs aimed at developing resistant vanilla varieties are hampered by the scarcity of sources of resistance to RSR and insufficient knowledge about the histopathology of Forv. In this work we have (i) identified new genetic resources resistant to RSR including V planifolia inbreds and vanilla relatives, (ii) thoroughly described the colonization pattern of Forv into selected vanilla accessions, confirming its necrotic non-vascular behavior in roots, and (iii) evidenced the key role played by hypodermis, and particularly lignin deposition onto hypodermal cell walls, for resistance to Forv in two highly resistant vanilla accessions. Two hundred and fifty-four vanilla accessions were evaluated in the field under natural conditions of infection and in controlled conditions using in vitro plants root-dip inoculated by the highly pathogenic isolate Fo072. For the 26 accessions evaluated in both conditions, a high correlation was observed between field evaluation and in vitro assay. The root infection process and plant response of one susceptible and two resistant accessions challenged with Fo072 were studied using wide field and multiphoton microscopy. In susceptible V planifolia, hyphae penetrated directly into the rhizodermis in the hairy root region then invaded the cortex through the passage cells where it induced plasmolysis, but never reached the vascular region. In the case of the resistant accessions, the penetration was stopped at the hypodermal layer. Anatomical and histochemical observations coupled with spectral analysis of the hypodermis suggested the role of lignin deposition in the resistance to Forv. The thickness of lignin constitutively deposited onto outer cell walls of hypodermis was highly correlated with the level of resistance for 21 accessions tested. The accumulation of p-coumaric and sinapic acids, two phenolic precursors of lignin, was observed in the resistant plants inoculated with Fo072, but not in the susceptible one. Altogether, our analyses enlightened the mechanisms at work in RSR resistant genotypes and should enhance the development of novel breeding strategies aimed at improving the genetic control of RSR of vanilla.

International audience; Root and stem rot (RSR) is a very detrimental disease of vanilla worldwide. Fusarium oxysporum is frequently associated with the disease but other Fusarium species are also reported. In this international study, 52 vanilla plots were surveyed in three of the most important vanilla producing countries (Madagascar, Reunion Island and French Polynesia) in order to determine the aetiology of RSR disease. Subsets from the 377 single-spored Fusarium isolates recovered from rotten roots and stems in the surveys were characterized by molecular genotyping (EF1α and IGS gene sequences) and pathogenicity assays on Vanilla planifolia and V. ×tahitensis, the two commercially grown vanilla species. Fusarium oxysporum was shown to be the principal species responsible for the disease, representing 79% of the isolates recovered from the RSR tissues, 40% of which induced severe symptoms on inoculated plantlets. Fusarium oxysporum isolates were highly polyphyletic regardless of geographic origin or pathogenicity. Fusarium solani, found in 15% of the samples and inducing only mild symptoms on plantlets, was considered a secondary pathogen of vanilla. Three additional Fusarium species were occasionally isolated in the study (F. proliferatum, F. concentricum and F. mangiferae) but were nonpathogenic. Histopathological preparations observed in wide field and multiphoton microscopy showed that F. oxysporum penetrated the root hair region of roots, then invaded the cortical cells where it induced necrosis in both V. planifolia and V. ×tahitensis. The hyphae never invaded the root vascular system up to 9 days post-inoculation. As a whole, the data demonstrated that RSR of vanilla is present worldwide and that its causal agent should be named F. oxysporum f. sp. radicis-vanillae. (Résumé d'auteur)

Background The objective of the work was to characterize fungal endophytes from aerial parts of Vanilla planifolia. Also, to establish their biotransformation abilities of flavor-related metabolites. This was done in order to find a potential role of endophytes on vanilla flavors. Results Twenty three MOTUs were obtained, representing 6 fungal classes. Fungi from green pods were cultured on mature green pod based media for 30 days followed by 1H NMR and HPLC-DAD analysis. All fungi from pods consumed metabolized vanilla flavor phenolics. Though Fusarium proliferatum was recovered more often (37.6 % of the isolates), it is Pestalotiopsis microspora (3.0 %) that increased the absolute amounts (quantified by 1H NMR in μmol/g DW green pods) of vanillin (37.0 × 10−3), vanillyl alcohol (100.0 × 10−3), vanillic acid (9.2 × 10−3) and p-hydroxybenzoic acid (87.9 × 10−3) by significant amounts. Conclusions All plants studied contained endophytic fungi and the isolation of the endophytes was conducted from plant organs at nine sites in Réunion Island including under shade house and undergrowth conditions. Endophytic variation occured between cultivation practices and the type of organ. Given the physical proximity of fungi inside pods, endophytic biotransformation may contribute to the complexity of vanilla flavors. Electronic supplementary material The online version of this article (doi:10.1186/s12870-015-0522-5) contains supplementary material, which is available to authorized users.

International audience; Most of phytoplankton influence is barely understood at the sub meso scale and daily scale because of the lack of means to simultaneously assess phytoplankton functionality, dynamics and community structure. For a few years now, it has been possible to address this objective with an automated in situ high frequency sampling strategy. In order to study the influence of environmental short-term events (nutrients, wind speed, precipitation, solar radiation, temperature, and salinity) on the onset of the phytoplankton bloom in the oligotrophic Bay of Villefranche-sur-Mer (NW Mediterranean Sea), a fully remotely controlled automated flow cytometer (CytoSense) was deployed on a solar-powered platform (EOL buoy, CNRS-Mobilis). The CytoSense carried out single-cell analyses on particles (1–800 μm in width, up to several mm in length), recording optical pulse shapes when analyzing several cm3. Samples were taken every 2 h in the surface waters during 2 months. Up to 6 phytoplankton clusters were resolved based on their optical properties (PicoFLO, Picoeukaryotes, Nanophytoplankton, Microphytoplankton, HighSWS, HighFLO). Three main abundance pulses involving the 6 phytoplankton groups monitored indicated that the spring bloom not only depends on light and water column stability, but also on short-term events such as wind events and precipitation followed by nutrient pulses. Wind and precipitation were also determinant in the collapse of the clusters' abundances. These events occurred within a couple of days, and phytoplankton abundance reacted within days. The third abundance pulse could be considered as the spring bloom commonly observed in the area. The high frequency data-set made it possible to study the phytoplankton cell cycle based on daily cycles of forward scatter and abundance. The combination of daily cell cycle, abundance trends and environmental pulses will open the way to the study of phytoplankton short-term reactivity to environmental conditions.

International audience; A multiple cell imaging approach combining immunofluorescence by confocal microscopy, fluorescence spectral analysis by multiphotonic microscopy, and transmission electron microscopy identified the site of accumulation of 4-O-(3-methoxybenzaldehyde) β-d-glucoside, a phenol glucoside massively stockpiled by vanilla fruit. The glucoside is sufficiently abundant to be detected by spectral analysis of its autofluorescence. The convergent results obtained by these different techniques demonstrated that the phenol glucoside accumulates in the inner volume of redifferentiating chloroplasts as solid amorphous deposits, thus ensuring phenylglucoside cell homeostasis. Redifferentiation starts with the generation of loculi between thylakoid membranes which are progressively filled with the glucoside until a fully matured organelle is obtained. This peculiar mode of storage of a phenolic secondary metabolite is suspected to occur in other plants and its generalization in the Plantae could be considered. This new chloroplast-derived organelle is referred to as a 'phenyloplast'.

Vanillin is a popular and valuable flavour compound. It is the key constituent of the natural vanilla flavour obtained from cured vanilla pods. Here we show that a single hydratase/lyase type enzyme designated vanillin synthase (VpVAN) catalyses direct conversion of ferulic acid and its glucoside into vanillin and its glucoside, respectively. The enzyme shows high sequence similarity to cysteine proteinases and is specific to the substitution pattern at the aromatic ring and does not metabolize caffeic acid and p-coumaric acid as demonstrated by coupled transcription/translation assays. VpVAN localizes to the inner part of the vanilla pod and high transcript levels are found in single cells located a few cell layers from the inner epidermis. Transient expression of VpVAN in tobacco and stable expression in barley in combination with the action of endogenous alcohol dehydrogenases and UDP-glucosyltransferases result in vanillyl alcohol glucoside formation from endogenous ferulic acid. A gene encoding an enzyme showing 71% sequence identity to VpVAN was identified in another vanillin-producing plant species Glechoma hederacea and was also shown to be a vanillin synthase as demonstrated by transient expression in tobacco., Vanilla is derived from vanillin isolated from a vanillin-producing orchid, but the process is laborious, costly and results in a small yield. Here, the authors identified an enzyme from the orchid, Vanilla planifolia, that is able to catalyse the formation of vanillin and vanillin glucoside from ferulic acid and its glucoside in vitro, respectively.

International audience; In South Africa, the wild leafless Vanilla roscheri Rchb. f. (Orchidaceae) is distributed only on the banks of the Lake Sibaya in KwaZulu-Natal Coastal Forest in the iSimangaliso Wetland Park. It is the southernmost vanilloid orchid on the African continent and a species of high conservation priority with little understanding of its reproductive biology and levels of genetic diversity. Mating systems and pollination ecology of the species were assessed by in situ experiments, in addition to genotyping plants at 16 microsatellite markers. Allogamous but self-compatible, V. roscheri depends on pollinators to achieve sexual reproduction. Its natural fruit set (26.3 %) is the highest reported for a non-spontaneously self-pollinating Vanilla species. It was associated with numerous flower visitors including two female allodapine bees (Allodapula variegata and Allodape rufogastra, Xylocopinae), captured with pollinia stored on the hind legs, and one female anthophorine bee. On the other hand, we report an absence of genetic diversity and homozygosity of the South-African populations of V. roscheri for all the genetic markers. Given the preferential outbreeding, the high natural fruit set and the pollinator/visitor richness of V. roscheri in Sibaya, a high level of genetic diversity was expected, but this was not the case. We detected a counterintuitive situation between the results of reproductive biology and genetics, making sense once the population situation on the margins of the species distribution is included. The null diversity expressed through the homozygous monomorphic markers is a consequence of the range-edge localization of the populations, which may have been subjected to severe bottlenecks (due to long distance colonization or fragmentation) along with inbreeding, in the past. The analysis highlights the complementarity of the approaches for which the implications in terms of conservation of the species in South Africa are discussed.

International audience; Jumellea fragrans and Jumellea rossii, both named “Faham”, are two epiphytic orchids endemic to the Mascarene Islands (Reunion, Mauritius) widely used for their aromatic and medicinal properties. Cultivation of these orchids is currently non-existent, so gathering and poaching in natural populations provide the supply. Continued use of this resource and the reduction of its natural habitat now result in a drastic decline of its natural populations. In order to prevent the decline of these taxa, to preserve its natural evolution in the wild, and to answer to the local consumers demand, we initiate a multidisciplinary project. The main aim of the so-called “ORCHIFAH” project is to provide the scientific background requisite for the production of Faham at an industrial level. An ecological approach is set to characterise the environmental conditions (light, temperature, watering) for an optimal biomass production. In vitro conditions of asymbiotic germination are currently determined. The biochemical components variation of populations of the two species are analysed by RMN spectrometry. The development of an appropriated extractive mode of volatile compounds is planned. All this information will help us to accurately characterise the biology of Faham and the conditions of its production, essential prerequisites for the development of an agricultural production chain. The results will also allow us to determine the conservation status of the species and recommendations for the management of wild populations. The poster will explicit the different steps of the implementation of an agricultural production chain. The first results in each field will be presented.

It has recently been postulated that lithogenic particles such as Saharan dust strongly influence particulate organic carbon export to the deep ocean by acting as mineral ballast. However, our understanding of the processes involved remains scant. In the present study, optical measurements were performed to monitor variations in the concentration, composition and size distribution of particles in suspension within the water column after simulating a Saharan dust event in very clear Mediterranean waters off Corsica in June 2010. A new methodology set up in large mesocosms proved very successful in this regard. Values obtained simultaneously from three instruments (WetLabs ECO-BB3, WetLabs ac-9, Sequoia Scientific LISST-100) provided evidence that (1) part of the Saharan dust pool has a rapid settling velocity (similar to 24-86 m day(-1)), (2) particulate export following a dust event is a nonlinear multi-step process and (3) export is controlled in part by the formation of organic-mineral aggregates. This experimental study provides the first insight of the complex export processes occurring after a dust event involving both physical and biogeochemical forcings in clear oligotrophic waters.

The genus Vanilla which belongs to the Orchidaceae family comprises more than 110 species of which two are commercially cultivated (Vanilla planifolia and Vanilla xtahitensis). The cured pods of these species are the source of natural vanilla flavor. In intensive cultivation systems the vines are threatened by viruses such as Cymbidium mosaic virus (CymMV). In order to investigate the effect of CymMV on the growth and metabolome of vanilla plants, four accessions grown in intensive cultivation systems under shadehouse, CR01 (V. planifolia), CR17 (V. xtahitensis), CR03 (V. planifolia × V. xtahitensis) and CR18 (Vanilla pompona), were challenged with an isolate of CymMV. CymMV infected plants of CR01, CR03 and CR17 had a reduced growth compared to healthy plants, while there was no significant difference in the growth of CR18 vines. Interestingly, CR18 had qualitatively more phenolic compounds in leaves and a virus titre that diminished over time. No differences in the metabolomic profiles of the shadehouse samples obtained by nuclear magnetic resonance (NMR) were observed between the virus infected vs. healthy plants. However, using in- vitro V. planifolia plants, the metabolomic profiles were affected by virus infection. Under these controlled conditions the levels of amino acids and sugars present in the leaves were increased in CymMV infected plants, compared to uninfected ones, whereas the levels of phenolic compounds and malic acid were decreased. The metabolism, growth and viral status of V. pompona accession CR18 contrasted from that of the other species suggesting the existence of partial resistance to CymMV in the vanilla germplasm.

International audience; There is a serious lack of information on the genetic diversity and population dynamics of the 110 tropical Vanilla species, although these are keys elements to adjust conservation strategies. Nineteen polymorphic microsatellite markers were developed from two African leafless Vanilla species V. roscheri and V. humblotii to use in population genetic studies. A transferability analysis of these markers on seven Vanilla species from various geographical origins was conducted. Nine microsatellites were polymorphic in a population of 22 individuals of V. humblotii from Mayotte (Comoros Archipelago). These markers had two to eight alleles per locus and observed heterozygosity ranged from 0.23 to 0.64. Amplification parameters were calibrated to facilitate multiplexing and rapid multi-loci genotyping. (Résumé d'auteur)

International audience; Since the publication of the first vanilla book by Bouriquet (1954c) and the more recent review on vanilla biodiversity (Bory et al., 2008b), there has been a world regain of interest for this genus, as witnessed by the recently published vanilla books (Cameron, 2011a; Havkin-Frenkel & Belanger, 2011; Odoux & Grisoni, 2010). A large amount of new data regarding the genus biodiversity and its evolution has also been obtained. These will be reviewed in the present paper and new data will also be presented. (Résumé d'auteur)

The phylogeny and the biogeographical history of the genus Vanilla was investigated using four chloroplastic genes (psbB, psbC; psaB and rbcL), on 47 accessions of Vanilla chosen from the ex situ CIRAD collection maintained in Reunion Island and additional sequences from GenBank. Bayesian methods provided a fairly well supported reconstruction of the phylogeny of the Vanilloideae sub-family and more particularly of the genus Vanilla. Three major phylogenetic groups in the genus Vanilla were differentiated, which is in disagreement with the actual classification in two sections (Foliosae and Aphyllae) based on morphological traits. Recent Bayesian relaxed molecular clock methods allowed to test the two main hypotheses of the phylogeography of the genus Vanilla. Early radiation of the Vanilla genus and diversification by vicariance consecutive to the break-up of Gondwana, 95 million years ago (Mya), was incompatible with the admitted age of origin of Angiosperm. Based on the Vanilloideae age recently estimated to 71 million years ago (Mya), we conclude that the genus Vanilla would have appeared approximately 34 Mya in South America, when continents were already separated. Nevertheless, whatever the two extreme scenarios tested, at least three long distance migration events are needed to explain the present distribution of Vanilla species in tropical areas. These transoceanic dispersions could have occurred via transoceanic passageway such as the Rio Grande Ridge and the involvement of floating vegetation mats and migratory birds.