Search

The diagnosis of Waldenström’s macroglobulinemia (WM), an IgM-associated lymphoplasmacytic lymphoma, can be challenging due to the different forms of disease presentation. Furthermore, in recent years, WM has witnessed remarkable progress on the diagnostic front, as well as a deeper understanding of the disease biology, which has affected clinical practice. This, together with the increasing variety of tools and techniques available, makes it necessary to have a practical guidance for clinicians to perform the initial evaluation of patients with WM. In this paper, we present the consensus recommendations and laboratory requirements for the diagnosis of WM developed by the European Consortium of Waldenström’s Macroglobulinemia (ECWM), for both clinical practice as well as the research/academical setting. We provide the procedures for multiparametric flow cytometry, fluorescence in situ hybridization and molecular tests and with this offer guidance for a standardized diagnostic work-up and methodological workflow of patients with IgM monoclonal gammopathy of uncertain significance, asymptomatic and symptomatic WM.

PURPOSE High levels of circulating tumor plasma cells (CTC-high) in patients with multiple myeloma are a marker of aggressive disease. We aimed to confirm the prognostic impact and identify a possible cutoff value of CTC-high for the prediction of progression-free survival (PFS) and overall survival (OS), in the context of concomitant risk features and minimal residual disease (MRD) achievement. METHODS CTC were analyzed at diagnosis with two-tube single-platform flow cytometry (sensitivity 4 × 10–5) in patients enrolled in the multicenter randomized FORTE clinical trial (ClinicalTrials.gov identifier: NCT02203643 ). MRD was assessed by second-generation multiparameter flow cytometry (sensitivity 10–5). We tested different cutoff values in series of multivariate (MV) Cox proportional hazards regression analyses on PFS outcome and selected the value that maximized the Harrell's C-statistic. We analyzed the impact of CTC on PFS and OS in a MV analysis including baseline features and MRD negativity. RESULTS CTC analysis was performed in 401 patients; the median follow-up was 50 months (interquartile range, 45-54 months). There was a modest correlation between the percentage of CTC and bone marrow plasma cells ( r = 0.38). We identified an optimal CTC cutoff of 0.07% (approximately 5 cells/µL, C-index 0.64). In MV analysis, CTC-high versus CTC-low patients had significantly shorter PFS (hazard ratio, 2.61; 95% CI, 1.49 to 2.97, P < .001; 4-year PFS 38% v 69%) and OS (hazard ratio, 2.61; 95% CI, 1.49 to 4.56; P < .001; 4-year OS 68% v 92%). The CTC levels, but not the bone marrow plasma cell levels, affected the outcome. The only factor that reduced the negative impact of CTC-high was the achievement of MRD negativity (interaction P = .039). CONCLUSION In multiple myeloma, increasing levels of CTC above an optimal cutoff represent an easy-to-assess, robust, and independent high-risk factor. The achievement of MRD negativity is the most important factor that modulates their negative prognostic impact.

Background: Minimal residual disease (MRD) is one of the most relevant prognostic factors in patients with multiple myeloma (MM); however, the impact of maintenance therapy on MRD levels remains unclear. Among patients with newly diagnosed MM (NDMM) who received lenalidomide maintenance until they developed disease progression, the role of MRD status as a predictor of progression-free survival (PFS) was evaluated by multiparameter flow cytometry (MFC) and allelic-specific oligonucleotide real-time quantitative polymerase chain reaction (ASO-RQ-PCR) analysis. Methods: Seventy-three patients with NDMM enrolled in the RV-MM-EMN-441 (clinical trials.gov identifier, NCT01091831) and RV-MM-COOP-0556 (clinicaltrials.gov identifier, NCT01208766; European Myeloma Network EMN02/HO95 MM Trial) phase 3 trials who achieved at least a very good partial response after intensification/consolidation were included. The median patient age was 57 years (interquartile range, 53-61 years), and all patients received lenalidomide maintenance until they developed progression. MRD was evaluated on bone marrow after intensification/consolidation, after 6 courses of maintenance, and every 6 months thereafter until clinical relapse using both ASO-RQ-PCR (sensitivity, 10 −5 ) and MFC (sensitivity, from 10 −4 to 10 −5 ). Results: After intensification/consolidation, 33 of 72 patients (46%) achieved a molecular complete response (m-CR), and 44 of 70 (63%) achieved a flow complete response (flow-CR). Almost 27% of patients who were MRD-positive after consolidation became MRD-negative during maintenance. After a median follow-up of 38 months, PFS was prolonged in patients who achieved negative MRD status during maintenance according to results from both ASO-RQ-PCR analysis (hazard ratio, 0.29; 95% confidence interval, 0.14-0.62; P =.0013) and MFC (hazard ratio, 0.19; 95% confidence interval, 0.09-0.41; P

Minimal residual disease (MRD) by multiparameter flow cytometry (MFC) is the most effective tool to define a deep response in multiple myeloma (MM). We conducted an MRD correlative study of the EMN02/HO95 MM phase III trial in newly diagnosed MM patients achieving a suspected complete response before maintenance and every 6 months during maintenance. Patients received high-dose melphalan (HDM) versus bortezomib-melphalan-prednisone (VMP) intensification, followed by bortezomib-lenalidomide-dexamethasone (VRd) versus no consolidation, and lenalidomide maintenance. Bone marrow (BM) samples were processed in three European laboratories, applying EuroFlow-based MFC protocols (eight colors, two tubes) with 10−4−10−5 sensitivity. At enrollment in the MRD correlative study, 76% (244/321) of patients were MRD-negative. In the intention-to-treat analysis, after a median follow-up of 75 months, 5-year progression-free survival was 66% in MRD-negative versus 31% in MRD-positive patients (HR 0.39; p p

Despite remarkable advances in the treatment of multiple myeloma in the last decades, the prognosis of patients harboring high-risk cytogenetic abnormalities remains dismal as compared to that of standard-risk patients. Proteasome inhibitors demonstrated to partially ameliorate the prognosis of high-risk patients. We pooled together data from two phase I/II trials on transplant-ineligible patients with multiple myeloma receiving upfront carfilzomib cyclophosphamide and dexamethasone followed by carfilzomib maintenance. The aim of this analysis was to compare treatment outcomes in patients with standard- versus high-risk cytogenetic abnormalities detected by fluorescence in situ hybridization (FISH) analysis. High risk was defined by the presence of at least one chromosomal abnormality, including t(4;14), del17p and t(14;16). Overall, 94 patients were included in the analysis: 57 (61%) in the standard-risk and 37 (39%) in the high-risk group. Median follow-up was 38 months. In standard- vs. high-risk patients, we observed similar progression-free survival (3-year PFS: 52% vs. 43%, respectively; p=0.50), overall survival (3-year OS: 78% vs. 73%; p=0.38), and overall response rate (88% vs 95%; p=0.47), with no statistical differences between the two groups. No difference in terms of progression-free survival was observed between patients with or without del17p. Carfilzomib, used both as induction and maintenance agent for transplant-ineligible newly diagnosed multiple myeloma patients, mitigated the poor prognosis carried by high-risk cytogenetics and resulted into similar progression-free survival and overall survival, as compared to standard-risk patients. ClinicalTrials.gov IDs: NCT01857115 (IST-CAR-561) and NCT01346787 (IST-CAR-506).

We analyzed variations in terms of chromosomal abnormalities (CA) by fluorescence in situ hybridization (FISH) analysis on purified bone marrow plasma cells throughout the progression from monoclonal gammopathy of undetermined significance/smoldering multiple myeloma (MGUS/SMM) to newly diagnosed MM/plasma cell leukemia (NDMM/PCL) at diagnosis and from diagnostic samples to progressive disease. High risk was defined by the presence of at least del(17p), t(4;14), and/or t(14;16). 1p/1q detection (in the standard FISH panel from 2012 onward) was not available for all patients. We analyzed 139 MM/PCL diagnostic samples from 144 patients, with a median follow-up of 71 months: high-risk CA at diagnosis (MGUS/SMM or NDMM) was present in 28% of samples, whereas 37–39% showed high-risk CA at relapse. In 115 patients with NDMM who evolved to relapsed/refractory MM, we identified 3 different populations: (1) 31/115 patients (27%) with gain of new CA (del13, del17p, t(4;14), t(14;16) or 1q CA when available); (2) 10/115 (9%) patients with loss of a previously identified CA; and (3) 74 patients with no changes. The CA gain group showed a median overall survival of 66 months vs. 84 months in the third group (HR 0.56, 95% CI 0.34–0.92, p = 0.023). Clonal evolution occurs as disease progresses after different chemotherapy lines. Patients who acquired high-risk CA had the poorest prognosis. Our findings highlight the importance of performing FISH analysis both at diagnosis and at relapse.

CD200, a transmembrane type Ia glycoprotein belonging to the immunoglobulin superfamily, has been shown to have a differential expression in B-cell neoplasms. Here, we retrospectively assessed the diagnostic relevance of CD200 on 427 patients with B-cell chronic neoplasms in leukemic phase (median age, 69 y; range, 35-97 y). The final diagnosis based on the investigator's assessment was chronic lymphocytic leukaemia (CLL) in 75% of cases and non-CLL in 25% of cases. Sensitivity and specificity for the diagnosis of CLL (vs non-CLL) were calculated for the following markers: CD200, CD5, CD22, CD23, CD79b, FMC7, and SmIg. CD23 was the only marker without a statistically significant difference between the investigator assessment and the flowcytometric analysis. The other markers were unable-when individually evaluated-to discriminate between CLL and non-CLL, requiring the integration into a scoring system. The modified score no. 1 (addition of CD200) showed superimposable sensitivity and specificity compared with the Matutes score. The substitution of CD79b (modified score no. 2), surface membrane immunoglobulins (SmIg) (modified score no. 3), and CD79b and FMC7 (modified score no. 4) with CD200 showed that only the modified score no. 4 had both higher sensitivity and higher specificity compared with standard Matutes score. In conclusion, this work defines a simplified score, compared with the classical Matutes score, for the differential diagnosis of chronic B-cell leukaemia-which only requires 4 markers instead of 5 (CD5, CD23, CD200, and SmIg).

Introduction Flow cytometry is a useful tool for diagnosis and minimal residual disease (MRD) study of hematological diseases. Standard sample preparation protocols are characterized by stain-lyse-wash (SLW). To prevent nonspecific bindings and achieve high sensitivity in MRD studies, lyse-wash-stain-wash (LWSW) is required. To our knowledge, no comparison between the two methods has been performed. Methods We compared mean fluorescence intensity (MFI), stain index, signal-to-noise ratio, and percentage of positive cells of 104 antibodies and of 13 selected antibodies tested in 10 samples simultaneously prepared with the two methods. Results MFI and percentages of positive cells obtained by the two methods did not show significant differences and showed a very high correlation. Stain index and signal-to-noise ratio presented higher values for kappa and lambda surface chains in LWSW samples and a trend of higher values for the other antibodies in SLW samples. Conclusions We suggest to use LWSW method also at diagnosis to obtain more comparable antibody intensity expressions when samples from the same patient are processed for MRD evaluation after bulk lysis. Moreover, LWSW can prevent nonspecific bindings, shows no differences in the identification and quantitation of the populations of interest, and reduces acquisition of cell debris.

Background. The World Health Organization defines Waldenström Macroglobulinemia (WM) as a lymphoplasmacytic lymphoma associated with a serum immunoglobulin M (IgM) monoclonal protein. Since bone marrow (BM) infiltration is always present, while extramedullary involvement is infrequent, trephine BM biopsy is mandatory based on currently used diagnostic criteria, while multiparameter flow cytometry (MFC) studies are recommended to support the diagnosis (Owen et al, 2003). Next generation flow cytometry using panels with 8 to 17 monoclonal antibodies (MoAb), high number of cell acquisitions and appropriate software have shown an increased sensitivity, being able to detect one tumor cell among 10.000 normal cells (10-4) or even more. Aims of the study. Here we report an extensive phenotypic characterization by eight color MFC of a large prospective cohort of newly diagnosed WM patients, enrolled in the multicenter, observational trial BIO-WM (NCT03521596). In this study we evaluated the potential role of MFC on BM and peripheral blood (PB) samples as an alternative to BM biopsy in the diagnostic work-up of WM, with the final goal to assess the feasibility of a non-invasive or at least less invasive diagnostics. Methods. The diagnosis of WM was made using the criteria of the Second International Workshop on WM. Patients without bone marrow biopsy were excluded from the analysis. Whole BM and PB samples were processed following the bulk lysis protocol and stained using 8-color combination of the following fluorochrome-conjugated monoclonal antibodies: cIgM, CD56, CD5, CD19, CyK, CyL, CD38, CD45 (screening panel). CD5- lymphoproliferative disorders with two populations in different maturation stage showing identical cytoplasmatic light chain restriction underwent further characterization with six 8 color-panels (characterization panel). A minimum of 1x106/L cells per tube was acquired. The full list of monoclonal antibodies is reported in Table 1. Results. We analyzed 173 prospective patients with a histologic diagnosis of WM, either asymptomatic (n=46, 27%) or symptomatic (n=127, 73%). Their baseline characteristics are reported in Table 2. MFC results on BM samples collected at diagnosis were available in 165 patients. The median white blood cell (WBC) count was 13.5 x 109/L (IQR: 4.9-94) and the median number of cell acquisitions was 1.16 x 106 (IQR: 0.91-1.58). Clonal CD19+ B-cells were detected by MFC in 155/165 cases (94%) and showed k light chain restriction in 76% of cases. The median percentage of clonal CD19+ B-cells out of total BM WBC was 5.9% (IQR: 2.9-12.4). Twelve cases out of 165 (7%) were CD5+. The complete phenotype of clonal B CD19+ lymphocytes is shown in Figure 1. Clonal CD38+ plasma cells were detected in BM samples in 86% of cases and were CD20+ in 51% of cases. The median percentage of clonal CD38+ plasma cells out of total BM WBC was 0.18% (IQR: 0.05-0.47). The complete antigenic expression of clonal plasma cells is shown in Figure 2. The MYD88 (L265P) mutation was found with droplet digital polymerase chain reaction (dd-PCR) in 95% of patients with detectable clonal CD19+ B-cells in BM samples, without significant difference between CD5- and CD5+ cases (95% versus 93%, P=0.698). Paired BM and PB samples were available in 157 patients. Clonal CD19+ B-cells were detected in BM samples in 149/157 cases (95%) and in PB samples in 98/157 cases (58%). Overall, there was a slight agreement between BM and PB MFC results according to Landis and Koch scale (63%, k = 0.138). Conclusions. The comparison of MFC results on BM samples with BM histology in this large prospective cohort of WM patients suggests that eight-color MFC is highly sensitive and is able to identify the majority of patients with WM. Conversely, the comparison of MFC results on paired BM and PB samples indicates that MFC on PB samples has a low sensitivity, missing approximately 40% of cases. The integration of MFC results on BM samples with MYD88 mutation status assessed with a highly sensitive method such as dd-PCR may be considered as an alternative, less invasive method for the diagnosis of WM. Further analyses within this trial will assess the role of MFC combined with molecular profile of patients for the differential diagnosis between WM and other mature B-cell lymphoproliferative disorders as well as for the discrimination between WM and IgM monoclonal gammopathy of undetermined significance. Figure 1 Disclosures Varettoni: Roche: Consultancy, Membership on an entity's Board of Directors or advisory committees; AbbVie: Other: Travel/accommodations/expenses; Janssen: Consultancy, Membership on an entity's Board of Directors or advisory committees, Other: Travel/accommodations/expenses. Ferrero:Servier: Speakers Bureau; Gilead: Research Funding, Speakers Bureau; EUSA Pharma: Honoraria, Membership on an entity's Board of Directors or advisory committees, Speakers Bureau; Janssen: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Speakers Bureau. Puig:JANSSEN: Consultancy, Honoraria, Other: TRAVEL, ACCOMMODATIONS, EXPENSES, Research Funding; TAKEDA: Consultancy, Honoraria, Other: TRAVEL, ACCOMMODATIONS, EXPENSES, Research Funding; AMGEN: Consultancy, Honoraria, Other: TRAVEL, ACCOMMODATIONS, EXPENSES, Research Funding; THE BINDING SITE: Consultancy, Honoraria; BRISTOL-MYERS SQUIBB: Consultancy, Honoraria, Other: TRAVEL, ACCOMMODATIONS, EXPENSES, Research Funding, Speakers Bureau; CELGENE: Consultancy, Honoraria, Other: TRAVEL, ACCOMMODATIONS, EXPENSES, Research Funding, Speakers Bureau. Ferrari:Abbvie: Honoraria. Laurenti:Janssen: Honoraria; Gilead: Honoraria; AbbVie: Honoraria; Roche: Honoraria. Marchetti:Takeda: Other: Sponsored meetings; Pfeizer: Other: Sponsored meetings; AbbVie: Other: Sponsored meetings; Gilead: Consultancy; Novartis: Speakers Bureau; Amgen: Speakers Bureau. Re:BerGenBio ASA: Research Funding. Boccadoro:GlaxoSmithKline: Membership on an entity's Board of Directors or advisory committees; Sanofi: Honoraria, Research Funding; Mundipharma: Research Funding; AbbVie: Honoraria; Celgene: Honoraria, Research Funding; Amgen: Honoraria, Research Funding; Janssen: Honoraria, Membership on an entity's Board of Directors or advisory committees, Research Funding; Novartis: Honoraria, Research Funding; Bristol-Myers Squibb: Honoraria, Research Funding. Garcia-Sanz:Novartis: Honoraria; Janssen: Honoraria, Research Funding; Incyte: Research Funding; Gilead: Honoraria, Research Funding; BMS: Honoraria; Amgen: Membership on an entity's Board of Directors or advisory committees; Pharmacyclics: Honoraria; Takeda: Consultancy, Research Funding.

Background Despite an improvement in treatment response, high-risk multiple myeloma (MM) patients (pts) experience early relapse and short disease-free survival. Together with more validated high-risk features, high levels of circulating plasma cells (high CPC) have been considered a marker of aggressive disease and poor outcome (F. Gay et al, ASH 2019; W.I. Gonsalves et al, Am J Hematol 2020). To date, there are no uniform data on the optimal cut-off predictive of clinical outcome. No prospective data on CPC are available in the setting of novel-drug clinical trials with comprehensive baseline evaluation and minimal residual disease (MRD) assessment. Aims 1) To identify the best cut-off for CPC to predict progression-free survival (PFS); 2) to assess the impact of high CPC levels on the clinical outcome of newly diagnosed (ND)MM pts in the context of concomitant risk features and MRD evaluation. Methods In the multicenter randomized FORTE clinical trial, 474 NDMM pts ≤65 years were randomized (R1) to receive either: carfilzomib-lenalidomide-dexamethasone (KRd) induction-autologous stem-cell transplant-KRd consolidation (KRd_ASCT); KRd for 12 cycles (KRd12); or carfilzomib-cyclophosphamide-dexamethasone (KCd) induction-ASCT-KCd consolidation (KCd_ASCT). Thereafter, pts were randomized (R2) to maintenance treatment with lenalidomide alone (R) or plus carfilzomib (KR). MRD was assessed by 2nd-generation multiparameter flow cytometry (MFC, sensitivity 10-5) in pts who achieved ≥very good partial response before maintenance and then every 6 months. At diagnosis, single-platform FC was used to sort and count CPC. Receiver Operating Characteristic (ROC) analysis was used to define a cut-off based on PFS at 36 months as outcome. Correlations between high CPC and the most important baseline prognostic features (age, International Staging System (ISS), lactate dehydrogenase (LDH), chromosomal abnormalities (CA) by FISH [(del17p, t(4;14), t(14;16), t(11;14), amp1q, del1p, del13], Revised-ISS (R-ISS)) were explored. Hence, we performed a multivariate (MV) analysis to assess the impact of high CPC on the achievement of MRD negativity, on PFS and OS. Finally, we evaluated the impact of baseline CPC and MRD achievement. Results CPC analysis was performed in 401/474 pts at diagnosis; median follow-up was 44.2 months (39.6-47.9) and baseline features were similar to those reported in the overall FORTE population. Median CPC were 0.02% (IQR 0-0.14). The optimal CPC cut-off to predict PFS (ROC analysis) was 0.07% (5 cells/ul, 0.005 x109/l) and was consistent with a cut-off previously identified as a predictor of sustained MRD negativity (MRDsus12; L. Bertamini et al, EHA 2020). High-CPC pts (>0.07%) were 130/401 (32%), while 271/401 (68%) had low CPC (≤0.07%). The proportion of high-CPC pts was comparable among treatment arms. Baseline features significantly associated with high CPC in a MV analysis were: ISS II/III, high LDH, amp1q, t(4;14), t(14;16) and bone marrow plasma cells (>60%). Regarding PFS, in a MV analysis adjusted for R-ISS and R1 treatment, including all the baseline features, high CPC were associated with a lower PFS (HR 2.49, 95% CI 1.76-3.51, P The impact of baseline CPC levels on PFS was consistent in all high-risk subgroups (Fig. 1C), except in those patients who achieved pre-maintenance MRD negativity [(neg); interaction P=0.03]. Low-CPC and MRD-neg pts showed the best outcome with a 3-year PFS of 84%. Low-CPC MRD-positive (pos) and high-CPC MRD-neg pts had similar 3-year PFS (70% vs 68%). High-CPC MRD-pos pts had a dismal outcome (3-year PFS 32%; Fig. 1D). Conclusion High CPC with a cut-off of 0.07% (5 cells/ul, 0.005 x109/l) is a strong and independent high-risk factor, predicting a shorter PFS and OS even in the context of other high-risk features. The achievement of MRD neg independently improved the poor prognosis of high-CPC patients. Figure 1 Disclosures D'Agostino: GSK: Membership on an entity's Board of Directors or advisory committees. Galieni:Janssen: Honoraria; AbbVie: Honoraria; Takeda: Honoraria; Celgene: Honoraria. Molica:Gilead: Membership on an entity's Board of Directors or advisory committees; Janssen: Membership on an entity's Board of Directors or advisory committees, Speakers Bureau; Roche: Membership on an entity's Board of Directors or advisory committees; Abbvie: Membership on an entity's Board of Directors or advisory committees, Speakers Bureau. Tacchetti:Oncopeptides: Honoraria; AbbVie: Honoraria; Takeda: Honoraria; Amgen: Honoraria; Bristol-Myers Squibb: Honoraria; Celgene: Honoraria; Janssen: Honoraria. Musto:Amgen: Honoraria; Celgene: Honoraria. Gay:GSK: Membership on an entity's Board of Directors or advisory committees; Roche: Membership on an entity's Board of Directors or advisory committees; AbbVie: Membership on an entity's Board of Directors or advisory committees; Adaptive: Membership on an entity's Board of Directors or advisory committees; Seattle Genetics: Membership on an entity's Board of Directors or advisory committees; Oncopeptides: Membership on an entity's Board of Directors or advisory committees; Amgen: Honoraria, Membership on an entity's Board of Directors or advisory committees; Bristol-Myers Squibb: Honoraria, Membership on an entity's Board of Directors or advisory committees; Takeda: Honoraria, Membership on an entity's Board of Directors or advisory committees; Janssen: Honoraria, Membership on an entity's Board of Directors or advisory committees; Celgene: Honoraria, Membership on an entity's Board of Directors or advisory committees. Boccadoro:GlaxoSmithKline: Membership on an entity's Board of Directors or advisory committees; Sanofi: Honoraria, Research Funding; Celgene: Honoraria, Research Funding; Amgen: Honoraria, Research Funding; Janssen: Honoraria, Membership on an entity's Board of Directors or advisory committees, Research Funding; Novartis: Honoraria, Research Funding; Bristol-Myers Squibb: Honoraria, Research Funding; AbbVie: Honoraria; Mundipharma: Research Funding. Oliva:Adaptive Biotechnologies: Membership on an entity's Board of Directors or advisory committees; Janssen: Honoraria, Membership on an entity's Board of Directors or advisory committees; Amgen: Honoraria, Membership on an entity's Board of Directors or advisory committees; Celgene: Honoraria; Takeda: Membership on an entity's Board of Directors or advisory committees. OffLabel Disclosure: The presentation includes discussion of off-label use of a drug or drugs for the treatment of multiple myeloma (including carfilzomib, cyclophosphamide, lenalidomide and dexamethasone).

Background. In multiple myeloma (MM), the role of minimal residual disease (MRD) by multiparameter flow cytometry (MFC) and next-generation sequencing (NGS) is well established (H. Avet-Loiseau et al. IMW 2019, S. Oliva et al. EHA 2020). Aims. The aims of this analysis were the evaluation of (1) the rate of conversion from MRD-positivity (MRD-pos) to MRD-negativity (MRD-neg) with MFC and NGS during maintenance and (2) the impact on progression-free survival (PFS) and overall survival (OS) of MRD-neg with both techniques in different subgroups including different treatment arms. Methods. Newly diagnosed (ND)MM patients (pts) aged ≤65 years were randomized (R1) to receive carfilzomib (K)-lenalidomide (R)-dexamethasone (d) induction followed by autologous stem-cell transplantation (ASCT) and KRd consolidation (KRd_ASCT), 12 KRd cycles (KRd12), or K-cyclophosphamide(C)-d induction followed by ASCT and KCd consolidation (KCd_ASCT). After consolidation, pts were further randomized (R2) to KR vs R maintenance. MRD was assessed every 6 months (m) by 8-color second-generation flow cytometry (sensitivity 10-5) in pts with ≥very good partial response (VGPR). In pts achieving at least a complete response (≥CR), MRD was also assessed by NGS at the same time points (Adaptive Biotechnologies, Seattle, US-WA; sensitivity 10-5-10-6). Logistic regression analysis adjusted for International Staging System (ISS) stage (I vs II/III) and R1 was performed to evaluate the conversion rate from MRD-pos to MRD-neg during maintenance (KR vs R). PFS and OS of MRD-neg vs MRD-pos in the intention-to-treat (ITT) population were evaluated. For these analyses, MFC-pos pts included those who were positive by MRD plus those Results. Rates of MRD-neg by MFC and NGS before maintenance in the 3 induction/consolidation arms have been previously presented (S. Oliva et al. EHA 2020). At R2, 65% of randomized pts were MRD-neg by MFC (equally distributed in the 2 arms); 39% (48/123) of MRD-pos pts turned MRD-neg after a median of 7.6 m (IQR 6.5-12): 46% (29/63) in KR vs 32% (19/60) in R (OR 2.27; P=0.04) arms. At R2, 72% of pts evaluable for CR were MRD-neg by NGS (equally distributed in the 2 arms); 33% of MRD-pos pts (15/45) became MRD-neg at 10-5: 39% (9/23) in KR vs 27% (6/22) in R arms (=NS). In the ITT analysis, after a median follow-up of 45 m from R1, pts who were MRD-neg before maintenance by both techniques showed a superimposable prolonged PFS and OS vs pts who were MRD-pos: 3-year PFS was 80% vs 52% (HR 0.36, 95% CI 0.26-0.49 P The impact of pre-maintenance MRD negativity by MFC on PFS was explored in different treatment arms: 3-year PFS was longer in KRd_ASCT vs KRd12 and in KRd_ASCT vs KCd_ASCT arms; MRD-pos pts showed a similar PFS in the 3 arms. The same trend was shown by NGS MRD negativity: 3-year PFS was longer in KRd_ASCT vs KRd12 and in KRd_ASCT vs KCd_ASCT arms. A longer PFS was observed in pre-maintenance MRD-neg pts who were randomized to KR vs R both by MFC (HR 0.51, P=0.02) and NGS (HR 0.38, P=0.03); similar features were observed in MRD-pos pts (Fig. 1B). Conclusions. KR maintenance induced a high rate of conversion from MRD-pos to MRD-neg both by MFC and NGS. The outcomes of pts who were MRD-neg by MFC and NGS at 10-5 were similar, as well as those of pts with 1-year sustained MRD-neg both by MFC and NGS. These clinical findings confirmed a high degree of concordance between these two techniques. MRD-neg pts receiving KRD_ASCT showed a longer PFS (88% at 3 years) than pts receiving KRd12 and KCd_ASCT. KR vs R significantly prolonged PFS even in pts who were MRD-neg before maintenance. Figure 1 Disclosures Oliva: Adaptive Biotechnologies: Membership on an entity's Board of Directors or advisory committees; Janssen: Honoraria, Membership on an entity's Board of Directors or advisory committees; Amgen: Honoraria, Membership on an entity's Board of Directors or advisory committees; Celgene: Honoraria; Takeda: Membership on an entity's Board of Directors or advisory committees. Petrucci:Janssen: Honoraria, Membership on an entity's Board of Directors or advisory committees; Celgene: Honoraria, Membership on an entity's Board of Directors or advisory committees; BMS: Honoraria, Membership on an entity's Board of Directors or advisory committees; GSK: Honoraria, Membership on an entity's Board of Directors or advisory committees; Sanofi: Honoraria, Membership on an entity's Board of Directors or advisory committees; Takeda: Honoraria, Membership on an entity's Board of Directors or advisory committees; Amgen: Honoraria, Membership on an entity's Board of Directors or advisory committees. D'Agostino:GSK: Membership on an entity's Board of Directors or advisory committees. Jacob:Adaptive Biotechnologies: Current Employment, Current equity holder in publicly-traded company. Gozzetti:Amgen: Honoraria; Takeda: Honoraria; Janssen: Honoraria, Research Funding. Kirsch:Adaptive Biotechnologies: Current Employment. Corradini:KiowaKirin: Consultancy, Honoraria; Novartis: Consultancy, Honoraria, Other: Travel and accommodations paid by for; F. Hoffman-La Roche Ltd: Consultancy, Honoraria; Sanofi: Consultancy, Honoraria; Servier: Consultancy, Honoraria; Takeda: Consultancy, Honoraria, Other; BMS: Other; Amgen: Consultancy, Honoraria, Other: Travel and accommodations paid by for; Celgene: Consultancy, Honoraria, Other: Travel and accommodations paid by for; Daiichi Sankyo: Consultancy, Honoraria; Gilead: Consultancy, Honoraria, Other: Travel and accommodations paid by for; Incyte: Consultancy; Janssen: Consultancy, Honoraria; Kite: Consultancy, Honoraria; AbbVie: Consultancy, Honoraria, Other: Travel and accommodations paid by for. Musto:Amgen: Honoraria; Celgene: Honoraria. Boccadoro:Sanofi: Honoraria, Research Funding; GlaxoSmithKline: Membership on an entity's Board of Directors or advisory committees; Mundipharma: Research Funding; AbbVie: Honoraria; Bristol-Myers Squibb: Honoraria, Research Funding; Novartis: Honoraria, Research Funding; Janssen: Honoraria, Membership on an entity's Board of Directors or advisory committees, Research Funding; Amgen: Honoraria, Research Funding; Celgene: Honoraria, Research Funding. Zamagni:Amgen: Honoraria, Membership on an entity's Board of Directors or advisory committees, Speakers Bureau; BMS: Honoraria, Membership on an entity's Board of Directors or advisory committees, Other: Travel, Accommodations, Expenses, Speakers Bureau; Takeda: Honoraria, Other: Travel, Accommodations, Expenses, Speakers Bureau; Sanofi: Honoraria, Membership on an entity's Board of Directors or advisory committees, Other: Travel, Accommodations, Expenses, Speakers Bureau; Janssen: Honoraria, Membership on an entity's Board of Directors or advisory committees, Other: Travel, Accommodations, Expenses, Speakers Bureau; Celgene Corporation: Honoraria, Membership on an entity's Board of Directors or advisory committees, Speakers Bureau. Gay:Celgene: Honoraria, Membership on an entity's Board of Directors or advisory committees; Amgen: Honoraria, Membership on an entity's Board of Directors or advisory committees; Janssen: Honoraria, Membership on an entity's Board of Directors or advisory committees; Takeda: Honoraria, Membership on an entity's Board of Directors or advisory committees; Seattle Genetics: Membership on an entity's Board of Directors or advisory committees; Adaptive: Membership on an entity's Board of Directors or advisory committees; AbbVie: Membership on an entity's Board of Directors or advisory committees; Roche: Membership on an entity's Board of Directors or advisory committees; Bristol-Myers Squibb: Honoraria, Membership on an entity's Board of Directors or advisory committees; Oncopeptides: Membership on an entity's Board of Directors or advisory committees; GSK: Membership on an entity's Board of Directors or advisory committees. OffLabel Disclosure: The presentation includes discussion of off-label use of a drug or drugs for the treatment of multiple myeloma (including carfilzomib, cyclophosphamide, lenalidomide and dexamethasone).

8533 Background: The role of MRD by MFC and NGS is well known in MM, with few data on the concordance of the two techniques. We analyzed and compared MRD data from the FORTE trial both by MFC and NGS. Methods: Newly diagnosed MM patients (pts) ≤65 years were randomized to: carfilzomib, lenalidomide, dexamethasone (KRd) induction-autologous stem cell transplant (ASCT) - KRd consolidation (KRd_ASCT); 12 KRd cycles (KRd12); carfilzomib, cyclophosphamide, dexamethasone (KCd) induction-ASCT-KCd consolidation (KCd_ASCT). Pts were then randomized to maintenance: lenalidomide alone or plus carfilzomib. MRD was assessed by 8-color second generation flow cytometry (sensitivity 10−5) in pts with ≥very good partial response (VGPR) before maintenance. In a subgroup of these pts, next generation flow (NGF; sensitivity 10−5-10−6) was performed. In ≥CR pts, MRD pre-maintenance was also assessed by NGS (Adaptive Biotechnologies; sensitivity 10−5-10−6). Thus, both MFC and NGS evaluations were available only in ≥CR pts. 1-year sustained MRD negativity by MFC and NGS was also analyzed in pts with at least one sample available at least 1 year apart. Results: MFC and NGS data were available in 184/233 (79%) CR pts (66 KRd_ASCT, 67 KRd12 and 51 KCd_ASCT). Median age of this ≥CR population was 57 years (IQR 52-62), 13% had International Staging System (ISS) III and 27% high risk cytogenetics by FISH [either del(17p) or t(4;14) or t(14;16)]. Table reports MRD negativity rate by MFC and NGS at a cut-off of 10−5 and 10−6 among ≥CR negative pts in the 3 arms. NGS negativity at a cut-off 10−6 was found in 36/133 (27%) ≥CR pts (for 51/184 CR pts 10−6 sensitivity was not reached). In evaluable pts, 1-year sustained 10−5 MRD negativity by MFC and NGS was superimposable (83%). We evaluated concordance of MRD results by the two techniques and observed agreement was 86% for MFC and NGS at 10−5 evaluable samples (n: 335; r: 0.61) and 78% for MFC and NGS at 10−6 evaluable samples (n: 56; r: 0.77). Conclusions: In pts who achieved ≥CR, similar rate of pre-maintenance 10−5 negativity by MFC and NGS has been reached in each arm, with 83% pts maintaining 1-year MFC or NGS 10−5 sustained MRD negativity. Concordance between MFC and NGS was good, particularly when the same sensitivity was reached. Longer follow up is needed to draw definitive conclusions. Clinical trial information: NCT02203643 . [Table: see text]

Background Risk-adapted therapy is a common strategy in curable hematologic malignancies: standard-risk patients receive less intensive treatment, whereas high-risk patients require a more intensive approach. This model cannot be applied in multiple myeloma (MM), which is still incurable. Continuous treatment (CT) is a key strategy for MM treatment, since it improves duration of remission. However, the role of CT according to standard- or high-risk baseline prognosis remains an open question. Patients and methods We performed a pooled analysis of 2 phase III trials (GIMEMA-MM-03-05 and RV-MM-PI-209) that randomized patients to CT vs fixed-duration therapy (FDT). Results In the overall patient population (n = 550), CT improved progression-free survival1 (PFS1) (HR 0.54), PFS2 (HR 0.61) and overall survival (OS) (HR 0.71) vs FDT. CT improved PFS1 both in R-ISS I (HR 0.49) and R-ISS II/III patients (HR 0.55). Four-year PFS1 was 38% in R-ISS II/III patients receiving CT and 25% in R-ISS I patients receiving FDT, with similar trends for PFS2 and OS. High-risk patients benefited more from proteasome-inhibitor plus immunomodulatory-based CT than immunomodulatory alone. Conclusion Good prognosis patients receiving FDT lose their prognostic advantage over high-risk patients receiving CT and high-risk patients may benefit from more intensive maintenance including proteasome inhibitors and immunomodulators.

Background Multiple Myeloma (MM) is a neoplastic disorder characterized by clonal proliferation of malignant plasma cells (PCs). Flow cytometry is an essential tool to confirm diagnosis and evaluate minimal residual disease (MRD). This study aims at identifying new surface PC markers suitable for targeted therapy in MM and able to improve MRD detection. Methods The expression of 82 molecules provided by the “Ninth International Workshop on Leukocyte Antigens” was analyzed by flow cytometry in 5 MM cell lines and in 20 newly diagnosed MM (NDMM) patients. Based on the antigens expression and monoclonal antibody availability, CD150, CD48, CD229, CD352, CD319, CD272, CD86, CD200 and CD184 were subsequently tested in 24 NDMM, 8 relapsed MM (RMM), 6 plasma cell leukemia (PCL) and 13 healthy subjects. Results CD352 was less frequently expressed on NDMM than on healthy PCs; CD200 was more frequently expressed on NDMM than on RMM and healthy PCs. CD150, CD319, CD229, CD352 Mean Fluorescence Intensity (MFI) was lower in pathological than in healthy samples. The proportion of CD150-positive samples was lower in NDMM and RMM than in healthy subjects; CD86+ samples were less frequent in NDMM than in healthy subjects; CD200+ samples were more frequent in NDMM than in RMM and healthy subjects. Conclusions CD150, CD86 and CD200 can help to identify malignant PCs; CD272, CD319, CD229, CD48 are highly expressed on all PCs and could be considered for targeted therapy. All these antigens could be added to a routine panel for PCs identification and MRD evaluation. © 2015 International Clinical Cytometry Society

// Stefania Oliva 1, * , Manuela Gambella 1, * , Milena Gilestro 1 , Vittorio Emanuele Muccio 1 , Francesca Gay 1 , Daniela Drandi 2 , Simone Ferrero 2 , Roberto Passera 3 , Chiara Pautasso 1 , Annalisa Bernardini 1 , Mariella Genuardi 1 , Francesca Patriarca 4 , Elona Saraci 1 , Maria Teresa Petrucci 5 , Norbert Pescosta 6 , Anna Marina Liberati 7 , Tommaso Caravita 8 , Concetta Conticello 9 , Alberto Rocci 10 , Pellegrino Musto 11 , Mario Boccadoro 1 , Antonio Palumbo 1 , Paola Omede 1 1 Myeloma Unit, Division of Hematology, University of Torino, Azienda Ospeadliero-Universitaria Citta della Salute e della Scienza di Torino, Torino, Italy 2 Division of Hematology, Department of Molecular Biotechnologies and Health Sciences, University of Torino, Torino, Italy 3 Division of Nuclear Medicine, University of Torino, Azienda Ospedaliero-Universitaria Citta della Salute e della Scienza di Torino, Torino, Italy 4 Azienda Ospedaliera-Universitaria di Udine, DISM Universita di Udine, Udine, Italy 5 Division of Hematology, Department of Cellular Biotechnologies and Hematology, Sapienza University of Rome, Rome, Italy 6 Ematologia e Centro TMO, Ospedale Centrale Bolzano, Bozen, Italy 7 AO S.Maria di Terni, SC Oncoematologia, Terni, Italy 8 UOC Ematologia S.Eugenio ASL RM2 Roma, Rome, Italy 9 Divisione di Ematologia, Azienda Policlinico-OVE, Universita di Catania, Catania, Italy 10 Department of Haematology, Manchester Royal Infirmary, Central Manchester University Hospitals NHS Foundation Trust, Manchester, UK 11 Scientific Direction, IRCCS-CROB, Referral Cancer Center of Basilicata, Rionero in Vulture (Pz), Italy * Both authors share first authorship of the manuscript Correspondence to: Paola Omede, email: paolaomede@yahoo.com Keywords: myeloma, MRD, ASO-RQ-PCR, novel agents, flow cytometry Received: June 11, 2016 Accepted: September 21, 2016 Published: October 13, 2016 ABSTRACT We analyzed 50 patients who achieved at least a very good partial response in the RV-MM-EMN-441 study. Patients received consolidation with autologous stem-cell transplantation (ASCT) or cyclophosphamide-lenalidomide-dexamethasone (CRD), followed by Lenalidomide-based maintenance. We assessed minimal residual disease (MRD) by multi-parameter flow cytometry (MFC) and allelic-specific oligonucleotide real-time quantitative polymerase chain reaction (ASO-RQ-PCR) after consolidation, after 3 and 6 courses of maintenance, and thereafter every 6 months until progression. By MFC analysis, 19/50 patients achieved complete response (CR) after consolidation, and 7 additional patients during maintenance. A molecular marker was identified in 25/50 patients, 4/25 achieved molecular-CR after consolidation, and 3 additional patients during maintenance. A lower MRD value by MFC was found in ASCT patients compared with CRD patients (p=0.0134). Tumor burden reduction was different in patients with high-risk vs standard-risk cytogenetics (3.4 vs 5.2, ln-MFC; 3 vs 6 ln-PCR, respectively) and in patients who relapsed vs those who did not (4 vs 5, ln-MFC; 4.4 vs 7.8 ln-PCR). MRD progression anticipated clinical relapse by a median of 9 months while biochemical relapse by a median of 4 months. MRD allows the identification of a low-risk group, independently of response, and a better characterization of the activity of treatments.

L’emoglobinuria parossistica notturna (EPN) e un disordine ematologico raro caratterizzato da anemia emolitica, trombosi e difetti dell’ematopoiesi. Tale patologia e dovuta a una mutazione somatica del gene PIG-A che comporta la mancata produzione del glicosil-fosfatidil-inositolo (GPI), a cui si ancorano proteine di membrana quali CD55 e CD59 che inibiscono l’attivazione del complemento su diversi tipi cellulari. Dal 2010 il nostro Laboratorio partecipa alla compilazione dell’archivio CLONEPnh. Integrando i dati in esso inseriti con quelli contenuti nell’archivio del nostro Laboratorio e stato valutato il cambiamento negli anni del numero di richieste di ricerca del clone EPN e, in relazione a esso, come e variato il numero dei nuovi cloni individuati. E stata effettuata un’analisi citofluorimetrica a sei colori su sangue periferico, di pazienti afferenti alla Divisione Universitaria di Ematologia dell’Azienda Ospedaliera Citta della Salute e della Scienza di Torino, utilizzando il FLAER (tossina batterica inattivata) e i seguenti anticorpi: CD45, CD14, CD33, CD66, CD55, CD59, CD235a. I campioni sono stati acquisiti con citofluorimetro FACSCantoII e analizzati con il software FACS Diva. I dati sono stati inseriti nell’archivio CLONEPnh ( www.CLONEPnh.com ). Dai dati inseriti nell’archivio CLONEPnh si evince che le richieste di ricerca di EPN sono state 13 nel 2010, 16 nel 2011, 28 nel 2012 e 12 nei primi sei mesi del 2013 e i cloni individuati sono stati, rispettivamente, 1, 0, 1 e 1. Un andamento simile, anche se con un numero decisamente minore di analisi richieste, e stato riscontrato anche negli anni precedenti (dal 2000) analizzando l’archivio del nostro Laboratorio. I nostri dati mostrano un aumento negli anni di analisi effettuate, a cui, pero, non e corrisposto un aumento dei cloni individuati. L’aumento delle richieste si puo giustificare considerando che la diagnosi di EPN e diventata prevalentemente citofluorimetrica e che le recenti linee guida consigliano, in pazienti con displasie midollari, di ricercare e monitorare cloni di modesta entita mediante la metodica ad alta sensibilita. Tuttavia, per ridurre il costo in termini di tempo e risorse, sarebbero auspicabili l’elaborazione e la validazione di protocolli citofluorimetrici piu rapidi con l’utilizzo di un pannello ridotto di reagenti.

Background. High rates of response and minimal residual disease (MRD) negativity have been reported with the use of novel treatment options in multiple myeloma (MM) patients (pts) eligible for autologous stem-cell transplantation (ASCT). Despite very promising results, there is still a proportion of pts who do not respond to therapy or relapse early. This represents an unmet medical need. Aim. To identify the main factors predictive of early relapse in the context of novel treatment approaches. Methods. Data from newly diagnosed MM (NDMM) pts ≤65 years enrolled in the FORTE trial were analyzed. The evaluated baseline standard clinical and biological features included: age, Hb, creatinine, tumor circulating plasma cells (PCpb) evaluated by flow cytometry, bone marrow plasma cells (PCbm) evaluated as continuous variables, free light chain (L vs K), M-component subtype (IgA vs others), Revised International Staging System (R-ISS II/III vs I), LDH (>ULN vs ≤ULN), ISS (III vs II vs I), presence vs absence of chromosomal abnormalities detected by FISH [(del17p, t(4;14), t(14;16), t(11;14), amp1q, del1p, del13], and presence vs absence of plasmacytomas. Pts were randomized to receive carfilzomib, lenalidomide, dexamethasone (KRd) induction - ASCT intensification - KRd consolidation (arm A); KRd12 (arm B); and carfilzomib, cyclophosphamide, dexamethasone (KCd) induction - ASCT intensification - KCd consolidation (arm C). Thereafter, patients were randomized to maintenance with lenalidomide alone or lenalidomide plus carfilzomib. Pre-maintenance MRD evaluation was performed by 8-color second generation flow cytometry (sensitivity 10-5) in patients who achieved at least a very good partial response (VGPR). Early relapse was defined as relapse ≤18 months from randomization. Univariate feature selection was performed between both categorical and continuous baseline variables and the achievement of pre-maintenance MRD negativity, according to Chi-square and Kruskal tests. The same baseline features, plus the achievement of MRD negativity, were included in a univariate analysis to select candidate predictors of early relapse. Selected features were then included in a multivariate logistic model. A multivariate analysis was performed to evaluate predictors of MRD negativity and early relapse. The model was adjusted for age and administered therapy. Results. 474 patients were enrolled in the trial. Baseline features were well balanced in the 3 arms. Predictors of MRD negativity (10-5): In univariate analysis, the baseline factors selected basing on the probability of achieving pre-maintenance MRD negativity were creatinine levels, ISS stage, R-ISS stage, del17p, PCbm (P=0.004) and PCpb. In multivariate analysis, including single variables not aggregated in R-ISS, increased creatinine levels (OR 0.48, 95% CI 0.25-0.94, P=0.03), increased PCbm (OR 0.95, 95% CI 0.91-0.99, P=0.01) and presence of del17p (OR 0.44, 95% CI 0.23-0.83, P=0.01) reduced the probability of achieving MRD negativity (Table). Predictors of early relapse: In univariate analysis, the main baseline factors selected basing on the risk of early relapse were LDH, ISS, R-ISS, PCbm, PCpb, del17p and achievement of MRD negativity. In multivariate analysis, R-ISS II/III vs I (OR 3.7, 95% CI 1.24-11, P Discussion. In the context of novel highly effective treatment approaches, creatinine levels, PCbm and, in particular, presence of del17p reduced the probability of achieving MRD negativity. Multivariate analysis combining baseline features and MRD negativity highlights how comprehensive baseline evaluation including baseline R-ISS (or in particular high LDH levels, which may have an independent role) and circulating PC can help to identify patients at high risk of early relapse. However, the achievement of MRD negativity is the factor that may reduce the risk of early relapse. Disclosures Gay: Takeda: Honoraria, Membership on an entity's Board of Directors or advisory committees; Janssen: Honoraria, Membership on an entity's Board of Directors or advisory committees; Janssen: Honoraria, Membership on an entity's Board of Directors or advisory committees; Celgene: Honoraria, Membership on an entity's Board of Directors or advisory committees; Celgene: Honoraria, Membership on an entity's Board of Directors or advisory committees; Amgen: Honoraria, Membership on an entity's Board of Directors or advisory committees; Takeda: Honoraria, Membership on an entity's Board of Directors or advisory committees; Roche: Membership on an entity's Board of Directors or advisory committees; Bristol-Myers Squibb: Honoraria, Membership on an entity's Board of Directors or advisory committees; Amgen: Honoraria, Membership on an entity's Board of Directors or advisory committees; AbbVie: Membership on an entity's Board of Directors or advisory committees; Roche: Membership on an entity's Board of Directors or advisory committees; AbbVie: Membership on an entity's Board of Directors or advisory committees; Bristol-Myers Squibb: Honoraria, Membership on an entity's Board of Directors or advisory committees. Offidani:Bristol-Myers Squibb: Honoraria, Membership on an entity's Board of Directors or advisory committees; Amgen: Honoraria, Membership on an entity's Board of Directors or advisory committees; Takeda: Honoraria, Membership on an entity's Board of Directors or advisory committees; Janssen: Honoraria, Membership on an entity's Board of Directors or advisory committees; Celgene: Honoraria, Membership on an entity's Board of Directors or advisory committees. Vozella:Celgene: Honoraria; Amgen: Honoraria. Belotti:Janssen: Membership on an entity's Board of Directors or advisory committees; Celgene: Membership on an entity's Board of Directors or advisory committees; Amgen: Membership on an entity's Board of Directors or advisory committees. Galli:Takeda: Honoraria; Leadiant (Sigma-Tau): Honoraria; Janssen: Honoraria; Celgene: Honoraria; Bristol-Myers Squibb: Honoraria. Gozzetti:Celgene: Honoraria; Amgen: Honoraria; Jansenn: Honoraria; BMS: Honoraria. Giuliani:Janssen: Research Funding. Musto:Amgen: Honoraria; Celgene: Honoraria. Cavo:sanofi: Honoraria, Membership on an entity's Board of Directors or advisory committees, Speakers Bureau; amgen: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Speakers Bureau; novartis: Honoraria; takeda: Honoraria, Membership on an entity's Board of Directors or advisory committees, Speakers Bureau; AbbVie: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees; celgene: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Other: travel accommodations, Speakers Bureau; janssen: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Other: travel accommodations, Speakers Bureau; bms: Honoraria, Membership on an entity's Board of Directors or advisory committees, Speakers Bureau. Boccadoro:Sanofi: Honoraria, Research Funding; Celgene: Honoraria, Research Funding; Amgen: Honoraria, Research Funding; Janssen: Honoraria, Research Funding; Novartis: Honoraria, Research Funding; Bristol-Myers Squibb: Honoraria, Research Funding; AbbVie: Honoraria; Mundipharma: Research Funding. OffLabel Disclosure: The presentation includes discussion of off-label use of a drug or drugs for the treatment of multiple myeloma.

INTRODUCTION Post-transplant cyclophosphamide (PTCY) has expanded the application of haploidentical stem cell transplantation (haplo-HSCT). Thymic function may play a pivotal role in long-term clinical outcomes. OBJECTIVES To evaluate the kinetics of long-term immune thymus-dependent reconstitution after PTCY haplo-HSCT. METHODS Twenty-nine patients (median age 53) underwent T-cell replete haplo-HSCT with PTCY. Blood samples were collected before conditioning and at 1, 3, 6, 12, 18, 24 months after transplantation. Analyses of CD4 and CD8 T-cell subsets by flow-cytometry were correlated by generalized linear models with Real-Time PCR quantification of signal joint T-cell receptor excision DNA circles (sjTRECs), specific marker of naive T-cells thymopoiesis. A) Naive; b) central; c) memory; and d) revertant CD4 and CD8 T-cells were defined as follows: a) CD45RA+CD62L+; b) CD45RO+CD62L+; c) CD45RO+CD27-; and d) CD45RA+/45RO+, respectively. SjTRECs real-time PCR was performed on genomic DNA (100 ng) extracted from sorted CD4 and CD8 T-cells. RESULTS Following PTCY induced T-cell depletion, a constant gradual increase in absolute numbers of all CD4 and CD8 T cell subsets and of sjTRECs copies from the first month up to two years post-transplant was observed (Figure 1). Overall, at two years, CD4 and CD8 T-cell levels and sjTRECs levels were however lower than those observed in healthy donors. sjTRECs kinetics was associated with the increase in naive T-cells (overall, p CONCLUSIONS Active thymic function despite age-dependent involution, substantially contributes to T-cell reconstitution after haplo-HSCT. Chronic GVHD and older age are however significantly correlated with lower thymic activity. Overall, lower production of sjTRECs after haplo-HSCT as compared after HLA identical sibling HSCT may partly be due to a higher degree of “mismatching” of MHC molecules during thymic re-education.

Background: Survival rates of multiple myeloma (MM) patients (pts) has improved over the past few years, but patients inevitably relapse and become more resistant to subsequent treatments. Carfilzomib and Pomalidomide were both approved for the treatment of relapsed/refractory MM (RRMM). Combinations including a proteasome inhibitor (PI) plus an immunomodulator (IMiD), such as Bortezomib-Lenalidomide-Dexamethasone (VRD) or Carfilzomib-Lenalidomide-Dexamethasone (CRD), showed a very high response rate with an acceptable toxicity. Moreover, in the CHAMPION1 study (Berenson et al Blood 2016), the weekly infusion of Carfilzomib showed to be as effective as the twice schedule. In this phase I/II study we assessed for the first time weekly Carfilzomib plus Pomalidomide and low dose Dexamethasone (wKPd) for the treatment of RRMM. Here we report preliminary results. Methods: the primary objective of the phase I part of the trial was to determine the maximum tolerated dose (MTD) of wKPd combination. The primary objective of the phase II was to determine the rate of partial response (PR). Patients with RRMM, who received 1-3 prior lines of treatments and were refractory to Lenalidomide were eligible. Treatment consisted of 28-day cycles of oral Pomalidomide at fixed dose of 4 mg on days 1-21 (1 week off), oral or intravenous (iv) Dexamethasone 40 mg on days 1,8,15,22 and iv Carfilzomib at escalating doses on days 1,8,15. Escalation started at the dose of 36 mg/m2 (0 level) and used a standard 3+3 schema based on dose-limiting toxicities (DLTs) occurring in cycle 1. Treatment was continued until relapse or intolerance. Results: A total of 57 patients were enrolled in 6 Italian centers. Fifty-two patients could be evaluated for this analysis (5 patients did not complete the first cycle yet). The median age was 62 years with a median time from diagnosis of 4 years. 17/39 (44%) of patients were considered high risk according to cytogenetic abnormalities [at least one among t (4;14) t (14;16) and deletion chromosome 17 (del17) detected by FISH]. In the phase I of the trial 15 patients were enrolled. The first 3 patients at the dose level 0 of Carfilzomib did not experience any DLT. In the next cohort with Carfilzomib 20/45 mg/m2 a G3 hypertension and a sudden death occurred. According to the protocol, 3 more patients were enrolled at dose level 0: 1 patient experienced G3 atrial fibrillation, 2 patients ≥ G3 hypertension. Considering the serious adverse events (SAEs) occurred, the trial was temporary stopped to evaluate the benefit of continuing the study. All the DLTs were cardiologic and occurred in patients with a prior history of cardiac disease. As per protocol, they were evaluated with ECG and echocardiogram before the enrolment and were considered eligible for the study. The safety committee established new procedures for the evaluation of cardiac function of potentially eligible patients, including 24 h continuing pressure monitoring before the enrolment and serial measurement of blood pressure during and after Carfilzomib infusions. Six more patients were enrolled at dose level -1 (Carfilzomib 20/27 mg/m2) and none experienced a DLT. The MTD was established at dose level -1 with Carfilzomib 20/27 mg/m2, Pomalidomide 4 mg and Dexamethasone 40 mg. In the phase II portion of the trial, 42 patients were enrolled. Considering both phase I and II portions of the study, the most frequent drug related, grade ≥ 3 AEs were hematologic (65% of neutropenia and 13% of thrombocytopenia) and cardiologic (17%, mainly hypertension). We recorded only 4% of infection and ≥ G3 peripheral neuropathy. The overall response rate (ORR) of phase I/II portions was 58% (30/52) including 25% (13/52) of ≥ very good partial remission (VGPR). The ORR of high risk patients was 44% (7/16) including 19% (3/16) of ≥ VGPR. With a median follow-up of 10 months, median progression free survival (PFS) was 9.5 months and the median overall survival was not reached. Conclusions: This is the first phase I/II trial that combined weekly Carfilzomib with Pomalidomide and Dexamethasone. This combination was highly effective in RRMM. After a median follow-up of 10 months, wKRd showed a double median PFS in comparison with Pomalidomide-low dose dexamethasone (Sanmiguel et al Lancet Oncology 2013): 9.5 vs 4 months respectively, confirming the efficacy of combining a PI with an IMiD. An updated analysis will be presented at the meeting. Disclosures Bringhen: BMS: Honoraria; Celgene: Honoraria; Janssen-Cilag: Honoraria; Amgen: Other: ADVISORY BOARD; Mundipharma: Other: ADVISORY BOARD; Karyopharm: Other: ADVISORY BOARD. Larocca:Celgene: Honoraria; Janssen-Cilag: Honoraria; Bristol-Myers Squibb: Honoraria; Amgen: Honoraria. Gaidano:Karyopharm: Consultancy, Honoraria; Novartis: Consultancy, Honoraria, Speakers Bureau; Gilead: Consultancy, Honoraria, Speakers Bureau; Morphosys: Consultancy, Honoraria; Janssen: Consultancy, Honoraria, Speakers Bureau; Roche: Consultancy, Honoraria, Speakers Bureau. Oliva:Amgen: Honoraria; Celgene: Honoraria; Takeda: Honoraria. Sonneveld:Amgen: Consultancy, Honoraria, Research Funding; Takeda: Consultancy, Honoraria; Janssen: Consultancy, Honoraria, Research Funding; Celgene: Honoraria, Research Funding; Karyopharm: Consultancy, Honoraria, Research Funding. Palumbo:Janssen Cilag: Honoraria; Takeda: Employment, Honoraria. Boccadoro:Janssen: Honoraria, Research Funding; BMS: Honoraria, Research Funding; Novartis: Honoraria, Research Funding; Amgen: Honoraria, Research Funding; Abbivie: Honoraria; Mundipharma: Research Funding; SANOFI: Honoraria, Research Funding; CELGENE: Honoraria, Research Funding.

Multiple Myeloma (MM) is a neoplastic disorder characterized by clonal proliferation of malignant plasma cells (PCs). Flow cytometry is an essential tool to confirm diagnosis and evaluate minimal residual disease (MRD). This study aims at identifying new surface PC markers suitable for targeted therapy in MM and able to improve MRD detection.The expression of 82 molecules provided by the "Ninth International Workshop on Leukocyte Antigens" was analyzed by flow cytometry in 5 MM cell lines and in 20 newly diagnosed MM (NDMM) patients. Based on the antigens expression and monoclonal antibody availability, CD150, CD48, CD229, CD352, CD319, CD272, CD86, CD200 and CD184 were subsequently tested in 24 NDMM, 8 relapsed MM (RMM), 6 plasma cell leukemia (PCL) and 13 healthy subjects.CD352 was less frequently expressed on NDMM than on healthy PCs; CD200 was more frequently expressed on NDMM than on RMM and healthy PCs. CD150, CD319, CD229, CD352 Mean Fluorescence Intensity (MFI) was lower in pathological than in healthy samples. The proportion of CD150-positive samples was lower in NDMM and RMM than in healthy subjects; CD86+ samples were less frequent in NDMM than in healthy subjects; CD200+ samples were more frequent in NDMM than in RMM and healthy subjects.CD150, CD86 and CD200 can help to identify malignant PCs; CD272, CD319, CD229, CD48 are highly expressed on all PCs and could be considered for targeted therapy. All these antigens could be added to a routine panel for PCs identification and MRD evaluation.

Immunophenotypic remission (IR) is a strong prognostic factor in myeloma patients. The combination of IR and conventional CR was retrospectively evaluated in 66 patients after allografting. IR was defined as the absence of monoclonal plasma cells in BM aspirates by multiparameter flow cytometry. Conditioning was non-myeloablative in 55 patients; reduced-intensity in 10 and myeloablative in 1 patient. The allograft was given upfront in 35/66 (53%) patients. After a median follow-up of 7.1 years, 24 patients achieved both CR and IR (CR/IR group), 21 achieved IR but not CR with persistence of a urine/serum M-component (no CR/IR group) and 21 did not achieve either CR or IR (no CR/no IR group). Median OS and EFS were 'not reached' and 59 months in the CR/IR group; 64 and 16 months in the no CR/IR; and 36 and 6 months in the no CR/no IR, respectively (P

8011 Background: MRD detection is a sensitive tool to measure response in MM. We assessed MRD by MFC in newly diagnosed MM patients (pts) enrolled in the EMN02/HO95 phase 3 trial. Methods: Pts were ≤65 years old and received Bortezomib-Cyclophosphamide-Dexamethasone (VCD) induction, intensification with Bortezomib-Melphalan-Prednisone (VMP) vs High-Dose-Melphalan (HDM) followed by stem cell transplant, consolidation with Bortezomib-Lenalidomide-Dexamethasone (VRD) vs no consolidation, and Lenalidomide maintenance. MRD analysis was performed in pts achieving at least a very good partial response (VGPR) before starting maintenance (after HDM, VMP or VRD) and during maintenance every 6-12 months; samples were centralized to 3 European labs. MFC was performed on bone marrow according to Euroflow-based methods (8 colors, 2 tubes) with a sensitivity of 10-5. Quality checks were performed to compare sensitivity and to show correlation between protocols (Hofste op Bruinink D ASH 2016 abstract 2072). Results: 316 pts were evaluable before maintenance: median age was 57 years, 18% (57/316) pts had ISS III and 22% (70/316) had high risk cytogenetic (HR-C) defined as having at least one among del17, t(4;14) or t(14;16); 63% (199/316) had received HDM and 37% (117/316) VMP; thereafter 51% (160/316) had received VRD. 76% (239/316) were MRD negative (MRD-) of whom 64% (153/239) received HDM vs 36% (86/239) VMP, with a median follow-up time of 30 months from MRD enrolment. 3-year PFS was 50% in MRD positive (MRD+) vs 77% in MRD- pts (HR: 2.87, p < 0.001). Subgroup analyses were performed to evaluate the risk factors for MRD+ according to baseline characteristics and therapies: HR-C was the most important risk factor (HR 9.87, interaction-p = 0.001). Finally, 48% of MRD+ pts at pre-maintenance who had a second MRD evaluation after at least 1 year of lenalidomide became MRD-. Conclusions: MRD by MFC is a strong prognostic factor in MM pts receiving intensification with novel agents or transplant; lenalidomide maintenance further improved depth of response; HR-C is the most important prognostic factor in MRD+ pts. Clinical trial information: NCT01208766.

Abstract 1254 Background: The thymus is fundamental for the generation of T-cell diversity following allografting even though its function declines with age. Non-myeloablative conditionings have extended the eligible age for allografting to 65–70 yrs for patients with hematological cancers. The thymic generation of the TCR diversity occurs through the recombination of gene segments coding for the TCR alpha and beta chains generating by-products defined as signal joint TCR excision circles (sjTRECs). sjTRECs are extrachromosomal DNA fragments, most frequently found in naive T cell, that do not replicate with subsequent cell divisions. Methods: sjTRECs evaluation by quantitative PCR and the kinetics of naive and memory T cells by flow-cytometry were used to asses the thymic function. Moreover, TCR repertoire analysis of V-beta families was evaluated, in a subset of patients, by spectratyping up to 1 year post-transplant. Finally, TRECs values were compared with 67 paediatric patients (median age 9, r 1–19 years). Subpopulations studied included peripheral mononuclear cells (PMC), sorted CD4- and CD8 – T cells. Results: Overall, 55 patients, median age 51 (r 34–64) years, conditioned with low dose TBI (200 cGy), with/without fludarabine, followed by G-CSF mobilised donor peripheral blood stem cell infusion from HLA identical siblings or unrelated donors, were evaluated at different time points: baseline, at 28, 56, 84, 100, 180 days, and at 1, 2, 3, 4, 5 years post-transplant. Naive CD4+CD62L+CD45RA+bright T cells and memory CD4+CD62L+CD45R0+bright T cells showed a gradual increase up to 3 years post-transplant with median values of 882/ul and of 532/ul respectively. Median values of sjTREC copies/100ng DNA in PMC increased 5 fold at 1 yr, 20 fold at 3 yrs and 75 fold at 5 yrs from 0.7 (pre-transplant), whereas median sjTREC copies/100ng DNA from sorted CD4+ cells (purity>95%) increased 7 fold at 1 yr and 15 fold at 5 yrs from 5 at 3 months post-transplant. A significant correlation was demonstrated between TREC values and CD4+CD62L+CD45RA+bright T cells (p Conclusions: Detectable thymic function persisted post-transplant in all patients except one who had previously been thymectomised. T cell reconstitution was somewhat slow especially during the first year post-transplant. The thymus may be an important target of chronic GVHD. Age played an important role in thymic output. Disclosures: Boccadoro: Celgene: Consultancy, Membership on an entity's Board of Directors or advisory committees, Research Funding; Janssen-Cilag: Consultancy, Membership on an entity's Board of Directors or advisory committees, Research Funding.

Abstract 1821 Poster Board I-847 Background Over-expression of the tyrosine kinase receptor Met has been reported in several solid tumors and increases cell proliferation, cell migration (scattering) and neoplastic angiogenesis. The Hepatocyte Growth Factor (HGF) is the only known Met ligand and the HGF/Met pathway seems to play a pivotal role in Multiple Myeloma (MM) pathogenesis. HGF is secreted by bone marrow stromal cells and Met is expressed at the surface of malignant plasma cells and endothelial cells. The phosphorylation of Met induced by HGF is a strong signal for cell growth and migration. The activity of the HGF/Met pathway and the heterogeneity of HGF/Met expression on MM cells suggest that the over-expression of Met could be a prognostic marker in MM patients. Aims To investigate the role of HGF/Met pathway as prognostic marker predictive of response rate, progression-free survival (PFS) and overall survival (OS) in MM patients treated with novel agents. Methods 102 newly diagnosed MM patients received the PAD-Mel100-LP-L regimen (Palumbo A, Abs 159, ASH 2008): as induction, four 21-day PAD cycles (Bortezomib, Pegylated-lyposomal-doxorubicin, Dexamethasone); as transplantation, tandem Mel100 (Melphalan 100 mg/m2) followed by stem cell support; as consolidation four 28-day LP cycles (Lenalidomide plus Prednisone) followed by Lenalidomide alone as maintenance. Samples from 47 newly diagnosed patients enrolled in this study have been analyzed. On CD138+ and CD138- cells separated from bone marrow (BM) aspirate, HGF and Met mRNA levels have been evaluated using a quantitative Real-Time PCR (qRT-PCR) on Abi Prism 7900 (Applied Biosystems). The JUM2 cell line was used as a calibrator for relative quantification of mRNA using the σσCt approach and Gus has been used as housekeeping gene. The cut-off value of Met mRNA expression/percentage calibrator was selected according to Receiver Operating Characteristic (ROC) analysis. Results mRNA expression of Met was higher in CD138+ cells than in CD138- cells (median 103, range 2 – 586 vs median 31, range 0-243 respectively; p=0.002). Met mRNA expression was significantly higher in CD138+ cells of patients with suboptimal response (partial response PR, stable disease SD, progression disease PD), compared with patients achieving complete response (CR) or very good partial remission (VGPR) (median 140 range 27-586 vs median 36.5 range 1-163 respectively; p=0.0001) (FIG 1A). With a median follow-up of 18 months, the 2-year PFS was 54% in patients with high Met mRNA expression and 87% in patients with low Met mRNA expression (p=0.007, FIG 1B); 2-year OS was 72% in patients with high Met mRNA expression and 95% in patients with low Met mRNA expression (p=0.047, FIG 1C). Patients with high levels of Met mRNA displayed albumin and beta-2-microglobuline levels similar to that observed in patients with low levels of Met mRNA. The BM plasma cells infiltration was also comparable (median 61% vs 65%) within the two groups. A similar percentage of patients in both groups showed the following cytogenetic abnormalities: t(4;14), t(14;16), del17 and del13. Interestingly, the percentage of patients carrying t(11;14) was higher in the group of patients with low Met mRNA levels in comparison with patients with high Met mRNA levels (28% vs 6%). mRNA expression of HGF was similar in responders and non responders patients and did not predict PFS and OS. Conclusion 1) mRNA level of Met on CD 138+ cells is a biological marker predictive of response; 2) high level of Met mRNA at diagnosis delineates significantly inferior progression-free and overall survival in MM patients treated with both bortezomib and lenalidomide based regimens. Disclosures Patriarca: Celgene: Honoraria. Caravita:Celgene: Consultancy. Ladetto:Celgene: Research Funding; Janssen-Cilag: Research Funding. Boccadoro:Celgene: Consultancy, advisory Committees, Research Funding; Janssen-Cilag: Consultancy, advisory Committees, Research Funding; Pharmion: Consultancy, advisory Committees, Research Funding. Palumbo:Celgene: Honoraria; Janssen-Cilag: Honoraria.

Introduction: Multiple myeloma (MM) is still an incurable disease and patients may relapse despite achievement of complete remission (CR). Minimal residual disease (MRD) assessment by multiparameter flow cytometry (MFC) on bone marrow (BM) is a sensitive diagnostic tool to measure response and is highly predictive of outcome in MM as previously reported. The aim of this study is to evaluate the role of MRD monitoring by MFC in MM patients receiving novel agents with or without autologous stem cell transplantation (ASCT) and to investigate the efficacy of treatments by using MRD-negativity as a deeper response criteria. Methods: The RV-MM-COOP-0556 (EMN02/HO95 MM) study is a phase III, randomized, trial including newly diagnosed MM patients ≤ 65 years. All subjects received 4 cycles of Bortezomib-Cyclophosphamide-Dexamethasone (VCD) induction, followed by Cyclophosphamide chemotherapy and subsequent stem cell mobilization and collection. Afterward, patients were randomized to receive 4 cycles of Bortezomib-Melphalan-Prednisone (VMP) vs one or two cycles of High-Dose-Melphalan (HDM) followed by ASCT. After intensification patients were secondly randomized to receive two cycles of consolidation with Bortezomib-Lenalidomide-Dexamethasone (VRD) vs no consolidation, followed by Lenalidomide maintenance in both arms. Patients who achieved CR/sCR according to IMWG criteria (Rajkumar et al. Blood 2011) after intensification/consolidation treatment, were eligible for the MRD sub-study. MRD analysis by MFC was performed on BM samples after intensification/consolidation, after 6 courses of maintenance, and thereafter every 6 months until progression, to detect monoclonal plasma cells (PCs). Here, we used a double antibody combination (CD138Fitc/CD20PerCp-Cy5.5/CD117APC/CD45APC-H7/CD38PE-Cy7; cyKappaFitc/cyLambdaPE/CD19PerCp-Cy5.5/CD56APC/CD45APC-H7/CD38 PE-Cy7): one tube was employed to obtain PCs quantification, the other one to validate PCs clonality. MRD-negativity was defined when Results: One hundred-eleven Italian patients (58 male/53 female) with a median age of 56 years (IQR 52-62) entered MRD sub-study. Sixteen (14%) were ISS stage III, 24 (22%) had high-risk cytogenetic profile and 10 (9%) had LDH levels higher than the upper normal limit. Forty-five patients (40%) received VMP as intensification and 66 (60%) underwent ASCT, thereafter 65 (58%) received VRD consolidation, 24 after VMP and 41 after ASCT. The median follow-up were 28.7 and 17 months from starting treatment and from MRD enrollment, respectively. After intensification/consolidation, 4 patients were not evaluable for MRD due to unsuitable samples, MRD negativity rate was 79% (85 out of 107 evaluable patients) and was independent from the intensification therapy: actually 50/63 patients who received ASCT and 35/44 patients who received VMP achieved MRD negativity. Within MRD-negative patients, 48/85 (56%) received VRD consolidation without major differences between VMP and ASCT. With the limitation related to the shorter follow-up, depth of response further improved during maintenance: 11/22 (50%) of MRD-positive patients became MRD-negative, independently from previous intensification therapy. Conclusions: MRD detection by MFC is a feasible technique in MM and allows to detect residual tumor cells among CR and sCR patients. Preliminary MRD results show that, in patients achieving CR, intensification with VMP or ASCT induced comparable rates of MRD-negativity and maintenance with Lenalidomide further improved depth of response in both arms. Longer follow-up is needed to correlate MRD status to prognosis and clinical outcome and to evaluate the role of maintenance therapy in increasing the quality of response. Disclosures Off Label Use: Use off-label of drugs for the dose and/or schedule and/or association . Gay:Sanofi: Membership on an entity's Board of Directors or advisory committees; Celgene: Honoraria, Membership on an entity's Board of Directors or advisory committees; Janssen-Cilag: Honoraria. Larocca:Janssen-Cilag, Celgene: Honoraria. Caravita:Celgene: Honoraria. Gamberi:Janssen Pharmaceuticals: Membership on an entity's Board of Directors or advisory committees; Mundipharma: Membership on an entity's Board of Directors or advisory committees; Celgene Corporation: Membership on an entity's Board of Directors or advisory committees. Rossi:Celgene: Research Funding. Offidani:Janssen-Cilag, Celgene, Sanofi, Amgen, Mundipharma: Honoraria. Boccadoro:Sanofi: Consultancy, Membership on an entity's Board of Directors or advisory committees; Celgene: Consultancy, Membership on an entity's Board of Directors or advisory committees; Onyx Pharmaceuticals: Consultancy, Membership on an entity's Board of Directors or advisory committees; Janssen-Cilag: Consultancy, Membership on an entity's Board of Directors or advisory committees. Sonneveld:Janssen-Cilag, Celgene, Onyx, Karyopharm: Honoraria, Research Funding; novartis: Honoraria. Palumbo:Novartis, Sanofi Aventis: Honoraria; Celgene, Millennium Pharmaceuticals, Amgen, Bristol-Myers Squibb, Genmab, Janssen-Cilag, Onyx Pharmaceuticals: Consultancy, Honoraria.

Background. Minimal residual disease (MRD) detection by multi-parameter flow cytometry (MFC) and real time quantitative PCR (RQ-PCR) is highly predictive of outcome in multiple myeloma (MM) patients (pts). Less is known on the ability of maintenance therapy to modulate MRD levels. The primary end-point of this study was to monitor MRD during maintenance therapy and to evaluate the impact on outcome. Patients and Methods. In the RV-MM-EMN-441 study (NCT01091831), after induction and consolidation pts received maintenance therapy with either Lenalidomide alone (R) or Lenalidomide-Dexamethasone (RD) until progression. Pts achieving at least very good partial response (VGPR) after induction/consolidation treatment were eligible for the MRD sub-study. MRD analysis was performed on bone marrow (BM) samples at diagnosis, after consolidation, after 3 and 6 courses of maintenance, and thereafter every 6 months until progression. MFC complete remission (CR) was defined by Results. MRD sub-study included 50 pts with a median age of 57 years (range 40-65). After consolidation 34/50 (68%) pts achieved VGPR, 16/48 (32%) achieved CR according to IMWG criteria (Rajkumar et al. Blood 2011). After a median follow-up of 44 months, 22/50 (44%) progressed and 7/50 (14%) deaths were recorded, with a 4-year PFS of 49% and 4-year OS of 87%. In the MFC analysis 19/50 pts (38%) achieved MFC-CR after consolidation, while other additional 7/50 pts (14%) achieved MFC-CR during maintenance. Among pts who achieved MFC–CR (< 1E-04), 7/26 (27%) pts progressed after a median of 30 months; among those who did not reach MFC–CR, 15/24 (62%) pts progressed after a median of 26 months (p=0.009). In 18/19 pts MFC-progression anticipated clinical relapse of a median of 9 months. In 1/19 pts, clinical extra-medullary progression anticipated MFC-progression. A molecular marker was identified in 25/50 pts (50%); 4/25 pts (16%) achieved molecular-CR after consolidation, while other additional 3/25 pts (20%) achieved molecular-CR during maintenance. Among pts who achieved molecular–CR ( Conclusions. Lower MRD values, both with MFC and RQ-PCR procedures, predict better outcome. 30% of patients achieved MFC-CR (7/26) or molecular-CR (3/7) during maintenance therapy suggesting that MRD levels can be modified by maintenance. MRD progression anticipates clinical relapse of approximately 8 months. Disclosures Off Label Use: lenalidomide used as off-label. Ferrero:MUNDIPHARMA: Honoraria. Gay:Sanofi: Membership on an entity's Board of Directors or advisory committees; Janssen: Honoraria; Celgene: Honoraria, Membership on an entity's Board of Directors or advisory committees. Patriarca:Merck Sharp & Dohme: Honoraria; Janssen and Cilag: Honoraria; Celgene: Honoraria. Petrucci:CELGENE: Honoraria; JANSSEN-CILAG: Honoraria; SANOFI: Honoraria; BRISTOL MYERS SQUIBB: Honoraria. Caravita:Celgene: Honoraria. Di Raimondo:CELGENE: Honoraria; JANSSEN-CILAG: Honoraria. Musto:CELGENE: Honoraria; JANSSEN-CILAG: Honoraria. Boccadoro:Sanofi: Consultancy, Membership on an entity's Board of Directors or advisory committees; Onyx: Consultancy, Membership on an entity's Board of Directors or advisory committees; Janssen-Cilag: Consultancy, Membership on an entity's Board of Directors or advisory committees; Celgene: Consultancy, Membership on an entity's Board of Directors or advisory committees. Palumbo:Array BioPharma: Honoraria; Onyx Pharmaceuticals: Consultancy, Honoraria; Millennium Pharmaceuticals, Inc.: Consultancy, Honoraria; Janssen-Cilag: Consultancy, Honoraria; Celgene: Consultancy, Honoraria; Genmab A/S: Consultancy, Honoraria; Bristol-Myers Squibb: Consultancy, Honoraria; Amgen: Consultancy, Honoraria; Sanofi: Honoraria.

Background Minimal residual disease (MRD) by multiparameter flow-cytometry recently showed a promising role in predicting outcomes in patients with multiple myeloma. However, data on immunophenotypic response (IR) after allografting are lacking. Aim To evaluate the impact of IR and compare it to conventional complete remission (CR) following allografting in myeloma patients. Methods Sixty-six consecutive patients, median age 54 years (35-66), who underwent an allograft between January 2000 and December 2011 with a follow-up of at least 3 months were included. Disease response was evaluated by serum and urine electrophoresis, and bone marrow aspirate at baseline, 3, 6, 12, 18, 24 months after transplant and yearly thereafter. Skeletal survey or MRI were performed yearly or as clinically indicated (overt relapse or complaints of bone pain). Bone marrow aspirates had to contain at least 13000 cells/µL for flow-cytometry studies and IR was defined as absence of monoclonal plasma-cells detected by 4 or 6-colour staining with the following antibodies: CD38, CD138, CD56, CD19, CD45, cyKappa, cyLambda. CR was defined according to standard criteria (Durie et al, Leukemia 2006; 20:1467-73). Results Conditioning regimen was non-myeloablative 2Gy TBI-based in 55 patients, reduced intensity (fludarabine-melphalan-based) in 10 and myeloablative in 1 patient. Post-grafting immunosuppression consisted of cyclosporine with mycophenolate mofetil or methotrexate. Donors were HLA identical siblings in 58 patients and unrelated in 8. Only 1 patient received bone marrow as source of stem cells. Thirty-five/66 (53%) received the allograft as part of the first line treatment, whereas the remaining 31/66, (47%) were transplanted at relapse. At the time of transplant, 5/66 were both in IR and CR, 16 were only in IR and 4 patients were only in clinical CR. All 21 patients in IR at the time of transplant maintained it, while 26/45 (58%) entered IR after the allograft. Among patients surviving at least 3 months, overall treatment related mortality was 10.6% at 3 years. After a median follow-up of 69 months (range 19-147), the incidence of acute and chronic graft-versus-host disease was 45.6% and 49.3% without significant difference between responsive and non-responsive patients. At follow-up, overall, 24 patients achieved CR and IR (CR/IR group), 21 achieved IR but not CR because of persistence of urine/serum M-component (noCR/IR group), and 21 did not achieve either CR or IR (noCR/noIR group). Interestingly, none achieved CR without IR. Median overall survival (OS) and event-free survival (EFS) in patients who achieved IR were 96 and 55 months versus 36 and 7 months in those who did not (p Conclusion The achievement of IR confers a favorable impact on OS and EFS after allografting. A higher incidence of extra-medullary in the noCR/IR group (some 30% of our patient cohort) may suggest that myeloma cells escape immune control outside the bone marrow. In this group, imaging studies such as positron emission tomography may clinically be indicated during follow-up to detect early relapse. Disclosures: No relevant conflicts of interest to declare.

Abstract 730 Background: Carfilzomib is a novel, irreversible proteasome-inhibitor with a significant activity and favourable toxicity profile. Here we evaluated efficacy and safety of the combination carfilzomib-cyclophosphamide-dexamethasone in elderly (≥ 65 years) newly diagnosed MM patients. Methods: The Bryant and Day two-stage design was used to evaluate both efficacy and safety. Patients received oral cyclophosphamide (300 mg/m2 on days 1,8,15), oral dexamethasone (40 mg on days 1, 8, 15, 22) and iv carfilzomib (20 mg/m2 on days 1, 2, and 36 mg/m2 on days 8, 9, 15, 16, cycle 1; 36 mg/m2 on days 1, 2, 8, 9, 15, 16, cycles 2–9) every 28 days for 9 cycles, followed by maintenance with iv carfilzomib (36 mg/m2 on days 1, 2, 15, 16) every 28 days until progression or intolerance. Results: Thirty-four patients were enrolled: median age was 70 years, 21% of patients were older than 75 years, 24% had reduced creatinine clearance ( Grade (G) 4 hematologic toxicities included neutropenia (1 patient, 5%). At least one G3-4 non-hematologic event was reported in 4 patients (21%): pneumonia and bronchitis (2 patients, 10%), atrial fibrillation (1 patient, 5%) and renal failure (1 patient, 5%). Only 1 patient (5%) developed G1 peripheral neuropathy. No patient discontinued treatment and 4 patients (21%) required carfilzomib dose reductions due to adverse events (G4 neutropenia, G3 pneumonia, G3 atrial fibrillation and G3 renal failure). Conclusions: Carfilzomib-cyclophosphamide-dexamethasone showed encouraging activity in patients with newly diagnosed MM. The combination was well tolerated with a frequency of at least one G3-4 non-hematologic adverse event of 21%. Results will be updated at the meeting. Disclosures: Palumbo: Onyx: Honoraria. Bringhen:Onyx: Honoraria.

Abstract 620 Background. The combination of bortezomib-melphalan-prednisone (VMP) is a new standard of care for elderly newly diagnosed multiple myeloma. This phase 3 study compared the 4 drug combination bortezomib-melphalan-prednisone-thalidomide followed by maintenance bortezomib-thalidomide (VMPT-VT) with VMP alone. Methods. Patients (N=511) older than 65 years were randomized to receive nine 6-week cycles of VMPT-VT (N=254; induction: bortezomib 1.3 mg/m2, d 1, 4, 8, 11, 22, 25, 29, 32, cycles 1–4, d 1, 8, 22, 29, cycles 5–9; melphalan 9 mg/m2 d 1–4, prednisone 60 mg/m2, d 1–4, thalidomide 50 mg d 1–42; maintenance: bortezomib 1.3 mg/m2 every 14 days and thalidomide 50 mg/day) or VMP (N=257) alone. In March 2007, the protocol was amended: both VMPT-VT and VMP induction schedules were changed to nine 5-week cycles and bortezomib schedule was modified to weekly administration (1.3 mg/m2 d 1,8,15,22, all cycles). The primary end point was progression-free survival (PFS). Results. All patients have been evaluated in intention-to-treat. Patient characteristics were similar in both groups, median age was 71 years. The response rates were superior in the VMPT-VT group with a complete remission (CR) rate of 38% vs 24% (p=0.0008). After a median follow-up of 26.1 months, the 3-year PFS were 55% in patients receiving VMPT-VT and 38% in those receiving VMP (HR 0.65, 95% CI 0.49–0.85, P=0.002, Table). The 3-year time-to-next-therapy were 69% with VMPT-VT and 55% with VMP (HR 0.60, 95% CI 0.42–0.85, P=0.004). The 3-year overall survival was 86% with VMPT-VT and 84% with VMP (HR 0.88, 95% CI 0.53–1.45, P=0.62). The achievement of CR was a strong predictive factor of longer PFS in both groups (P=0.0001): in VMPT-VT arm, 3-year PFS was 66% in patients who obtained CR and 47% in those achieving PR; in VMP arm, it was 70% and 30%, respectively. The PFS benefit of VMPT-VT was seen consistently across different subgroups defined by creatinine clearance, LDH and bortezomib schedule; by contrast, in patients older than 75 years (HR 0.87; 95% CI 0.54–1.43, P=0.59) and in those at increased risk of disease progression, defined as presence of cytogenetic abnormalities [t(4;14) or t(14;16) or del17p] and ISS 3 (HR 1.35; 95% CI 0.45–4.06, P=0.60), VMPT-VT seemed not to add any significant PFS advantage to VMP. Grade 3–4 neutropenia (38% vs. 28%, p=0.02), cardiological events (10% vs. 5%, p=0.04) and thromboembolic events (5% vs. 2%, p=0.08) were more frequent among patients assigned to the VMPT-VT group; treatment-related deaths were 4% with VMPT-VT and 3% with VMP. In both groups, the once-weekly infusion of bortezomib significantly reduced the incidence of severe sensory peripheral neuropathy from 16% to 3% (p Conclusion. In summary the current results indicate that: 1. VMPT-VT prolonged PFS with an unprecedented 3-year PFS of 55% in elderly patients; 2. once-weekly infusion of bortezomib improved safety without affecting outcome; 3. higher dose-intensity regimens seemed to be less effective in frail patients (≥ 75 years) and 4. maintenance therapy with VT further improved PFS with a good safety profile. Disclosures: Palumbo: Celgene: Honoraria, Membership on an entity's Board of Directors or advisory committees; Janssen Cilag: Honoraria, Membership on an entity's Board of Directors or advisory committees. Bringhen:Celgene: Honoraria; Janssen-Cilag: Honoraria. Patriarca:Celgene: Honoraria; Janssen Cilag: Honoraria; Roche: Honoraria; Merck: Membership on an entity's Board of Directors or advisory committees. Guglielmelli:Celgene: Honoraria; Janssen Cilag: Honoraria. Petrucci:Celgene: Honoraria; Janssen Cilag: Honoraria. Musto:Celgene: Honoraria; Janssen Cilag: Honoraria. Boccadoro:Celgene: Consultancy, Membership on an entity's Board of Directors or advisory committees, Research Funding; Janssen Cilag: Consultancy, Membership on an entity's Board of Directors or advisory committees, Research Funding.

The introduction of nonmyeloablative/reduced intensity conditionings has increased the eligible age for allografting up to 65–70 years. The thymic function is fundamental for the generation of T-cell diversity following allografting even though it is generally considered to decline with age. Until recently, thymic function could not be monitored as a consequence of the absence of adequate technology to differentiate true recent thymic emigrants from naive T cells. The generation of TCR diversity occurs in the thymus through the recombination of gene segments encoding the variable parts of the TCR alpha and beta chains. During this process, by-products of the rearrangements are generated in the form of signal joint T-cell receptor excision circles (sjTRECs). As sjTRECs are stable extrachromosomal DNA fragments, they are not replicated during mitosis and thus diluted with each round of cell division. They are therefore more frequent in T cells that have recently left the thymus. Thymic output was assessed in 52 patients, median age 50 (range 26–67) years, conditioned with low dose TBI (200 cGy), with/without fludarabine (90 mg/m2 total), or cyclophosphamide-thiotepa followed by G-CSF mobilised peripheral blood stem cell infusion from HLA identical siblings or volunteer donors. Diagnoses included: multiple myeloma (no=36), acute myeloid leukemia (no=2), myelodisplastic syndrome (no=4), chronic myeloid leukemia (no=1), Hodgkin disease (no=3), and chronic lymphocytic leukemia (no=6). Genomic DNA was purified from highly enriched CD3–CD4 pos and CD3–CD8 pos T cells by cell sorting (median purity: 97%) at 3, 6, 12, 18 and 24 months post-transplant. Real Time PCR analysis was performed with sjTREC specific primers: forward 5′-TGGTTTTTGTAAAGGTGCCCAC-3′ (50nM), reverse 5′-GTGCCAGCTGCAGGGTTT-3′ (50nM) and the oligo 5′(FAM) CATAGGCACCTGCACCCCGTGC(TAMBRA)p-3′ (250nM) as a detection probe. The GAPDH gene was amplified to standardize DNA content. Amplification reactions (25μl) contained 100ng of genomic DNA, TaqMan universal PCR master mix (Perkin Elmer Applied Biosystems, Foster City, CA, USA), and the appropriate primers and probes. All reactions were performed in the Model 7900 Sequence Detector using standard parameters and analysed using the GeneAmp software (Perkin Elmer Apllied Biosystems). All samples were measured in duplicate PCR reactions. Median sjTRECs values/100 ng DNA from CD3–CD4 pos T cells were as follows: 5.47; 7.09; 11.05; 15.42; 30.45 at 3, 6, 12, 18 and 24 months respectively, while sjTRECs values/100 ng DNA from CD3–CD8 pos T cells were as follows: 2.95; 2.33; 6.64; 10.49; 12.65 at 3, 6, 12, 18 and 24 months respectively. Healthy donors had significantly higher sjTRECs values at the time of donation compared to recipients. Importantly, sjTRECs were not detected in a 60-year-old leukemic patient thymectomized 10 years before allografting for a thymoma. CDR3 spectratyping analysis, evaluated on cDNA samples from the same T cell populations showed an oligoclonal pattern of the TCR repertoire during the first 6 months post-transplant that gradually expanded. The recovery of naive CD4+CD62L+CD45RA+bright T cells and of memory CD4+CD62L+CD45R0+bright T cells, evaluated by flow cytometry, was also gradual over the two-year period. A significant correlation between the levels of sjTRECs and the number of very naive CD62L + T cells was observed (p Correlation between the thymic activity and clinical variables such as graft-vs-host disease, graft-vs-tumor effects and infections are being evaluated and will be presented at the meeting. Overall, our findings provide evidence that adult thymus activity contributes to a slow T cell immune reconstitution during the first two years post-transplant. To enhance the thymus activity, future therapeutic interventions with agents such as recombinant human keratinocyte growth factor-1 or IL-7 may be investigated in clinical phase I trials.

Background: New agents have been introduced as induction prior to autologous stem cell transplant (ASCT) and as consolidation/maintenance thereafter to improve complete response (CR) rates. In this trial we evaluate Bortezomib plus Pegylated-lyposomal-doxorubicin and Dexamethasone (PAD) as induction therapy prior to reduced intensity ASCT, followed by consolidation with Lenalidomide and Prednisone (LP) and maintenance with Lenalidomide alone (L). Methods: Newly diagnosed multiple myeloma (MM) patients aged 65–75 years were eligible. Induction regimen consisted of 4 21-day PAD cycles (Bortezomib 1.3 mg/m2 days 1, 4, 8, 11, Pegylated-lyposomal-doxorubicin 30 mg/m2 day 4 and Dexamethasone 40 mg days 1–4, 8–11, 15–18). Two cycles of Cyclophosphamide 3 g/m2 plus Granulocyte-Colony Stimulating Factor were used to harvest stem cells. Patients were conditioned with tandem Melphalan 100 mg/m2 (MEL100) followed by stem cell support. After ASCT patients received consolidation with 4 28-day LP cycles (Lenalidomide 25 mg days 1–21 plus, Prednisone 50 mg every other day) followed by Lenalidomide alone maintenance (10 mg days 1–21 every 28 day). Primary objectives were safety (grade 3 non-hematologic toxicity < 30%) and efficacy (near CR rate > 35%). Results: One-hundred and two patients have been enrolled. After PAD cycles at least partial response (PR) rate was 94%, at least very good partial response (VGPR) was 59% including 13% CR. After tandem MEL100, 88% of patients achieved at least VGPR and 41% CR. After LP consolidation all patients obtained PR, 88% at least VGPR and 53% immunofixation negative CR. After a median follow-up of 14 months, 1-year progression free survival (PFS) was 92%, 1 year time to progression was 97% and 1 year overall survival was 92%. PFS was not significantly affected β2-microglobulin levels (p=0.10), presence of chromosome 13 deletion (p=0.5) or t(4;14) (p=0.61). During PAD, grade 3–4 adverse events included thrombocitopenia (13%), neutropenia (11%), infections (18%), gastrointestinal toxicities (12%), peripheral neuropathy (11%) and deep vein thrombosis (6%). During LP consolidation, grade 3–4 toxicities included neutropenia (18%), thrombocytopenia (6%), infections (6%) and deep vein thrombosis (6%). The other grade 3–4 toxicities occurred in less than 5% of patients. Conclusions: Bortezomib as induction regimen prior to reduced intensity ASCT, followed by Lenalidomide as consolidation maintenance is a highly effective regimen in elderly patients. Updated results will be presented at the meeting.

In vitro growth of acute myelogenous leukemia blasts as an established cell line is an uncommon event and molecular mechanisms allowing permanent in vitro proliferation have not been defined. In particular, few acute monoblastic leukemia (AMoL) cell lines have been described. Here we report a new AMoL cell line expressing a combination of growth factors and growth factor receptor that might be involved in an autocrine stimulation loop. AMoL (M5a according to F.A.B) was diagnosed in November 2004 in a 74 old woman. Caryotypic analysis revealed a combination of 46,XX, 47,XX,+8, 47,XX,+8,6q− caryotypes. A complete remission was achieved by an age- adapted FLAG-Ida regimen but caryotype analysis still revealed about 50% mitosis with 47,XX,+8 and in February 2005 the patient presented an isolated cutaneous relapse. In spite of treatment with low dose cytarabine, etoposide and retinoids, hematologic progression occurred in May 2005. Further treatments with vinblastine, hydroxyurea and gentuzumab-ozogamycine were only temporary effective and in June 2005 the patient died, with hyperleukocytosis, extensive cutaneous and possibly CNS involvement. A 10 ml peripheral blood sample was taken, after informed consent, at the time of the last progression and mononuclear cells were collected. Part the cells were cryopreserved and part cultured in RPMI medium + 15% fetal bovine serum (FBS). Cultured cells survived without significant expansion for 4 weeks, then progressive growth started. After a few passage the cell line (named PI-BR) has been established, with a doubling time of approximately 48 hours. During early passages cell growth was density dependent, impaired at concentrations lower than 3 ×10e4/ml. Morphology and cytochemical stains were in agreement to M5a F.A.B. subtype. Immunophenotypic analysis revealed an antigenic expression comparable to that of patient’s blasts: CD13++, CD33++, HLA-DR ++, CD64++, CD117 +, CD15+/−, CD34−, CD19−, CD9−. Caryotypic analysis was performed on patient’s cells cryopreserved when culture was initiated: only 4 mitosis were found: 2 with normal 46,XX, 2 with 47,XX,+8 caryotype. Caryotypic analysis, repeated on PI-BR cell line at passage 9, revealed a mixture of mitosis with 47,XX,+8, 47,XX,+ ring, 48,XX,+8,+ ring, normal 46,XX and hypodiploid (42–44 chromosome) caryotype. Therefore, although some chromosome abnormalities were acquired during in vitro culture, they do not seem responsible for the capability of continuous in vitro growth, since about 55% of cells at passage 9 maintained the same caryotypes of patient’s cells in vivo. Real time PCR revealed expression of genes codifying for some monocytic cytokines (IL6, IL8, IL10, IL18, TGF-beta1), Vascular Endotelium Growth Factor (VEGF)-A, VEGF-D and its receptor Flt-4. Immunoistochemistry confirmed the synthesis of Flt-4, VEGF-A and VEGF-D. VEGF-D was also detected by ELISA assay in cell line supernatant (14.7 pg/ml) at early passages. VEGF A and C and VEGF receptors have been reported to be expressed in some AML cell lines and in some fresh AML cell samples, displaying anti-apoptotic and proliferative activity. In the case of PI-BR cell line, synthesis of VEGF-D and of its receptor Flt-4 may have established an autocrine loop involved in continuous cell growth.

Background The introduction of novel treatment strategies against multiple myeloma (MM) has resulted in a major improvement in the overall outcome, which has led to an increased need for highly sensitive methods to detect minimal residual disease (MRD) in each patient. MRD assessment by multicolor flowcytometry (MFC) has been shown to be of prognostic value in many treatment protocols over the last decade, making it an attractive method to assess response in clinical trials. However, it is currently not known (1) what the best timing is to perform MFC MRD analysis in the context of a treatment protocol including induction, intensification, consolidation and maintenance treatment, (2) which patients should be selected for this analysis, and (3) what its feasibility is in a large international trial. The ongoing EMN-02 MRD Study aims to answer these questions within the framework of the EMN-02/HOVON-95 MM trial. Here, we describe our methods and the results of our first quality assessment round to compare the sensitivity of the used protocols. Methods The EMN-02/HOVON-95 MM trial is a randomized, multicenter, phase 3 trial in which newly diagnosed MM patients 18-65 years received 4 cycles of bortezomib, cyclophosphamide and dexamethasone (VCD) as induction treatment, followed by a first randomization between either 4 cycles of bortezomib, melphalan and prednisone (VMP), or high dose melphalan (HDM) and 1 or 2 ASCT as intensification treatment. Subsequently, patients were randomized between 2 cycles of bortezomib, lenalidomide and dexamethasone (VRD) or no consolidation treatment, followed by lenalidomide maintenance treatment for all until progression or toxicity occurred. Patients undergoing a bone marrow (BM) aspiration for complete response (CR) confirmation according to the International Myeloma Working Group (IMWG) criteria (Rajkumar et al. - Blood 2011) anytime during the trial were eligible for the EMN-02 MRD Study. BM samples from patients from 13 European countries were sent to 4 central MFC MRD laboratories in the Netherlands (A), Czech Republic (B), Denmark (C) and Italy (D), either using the strict Euroflow protocol (A) (Van Dongen et al. - Leukemia 2012) or Euroflow-based methods (B, C & D). In order to check compatibility between protocols, 5 bone marrow samples from MM patients with a clinical response ranging from progressive disease (PD) to CR were each divided in equal volumes and sent to the respective laboratories on 3 different days. MFC MRD analysis was performed on a FACS Canto II (BD) (A-C) or Coulter Navios flowcytometer (D). Protocols A, B & C used the Euroflow Plasma Cell Disorder (PCD) tube 1 and 2 combination of antibodies, containing the backbone markers CD138-PO, CD38-FITC, CD45-PB and CD19-PE-Cy7, with CD56-PE, B2micro-PerCP-Cy5.5, cyIgK-APC and cyIgL-APC-C750 in tube 1, and CD28-PE, CD27-PerCP-Cy5.5, CD117-APC, CD81-APC-H7 in tube 2. Protocol D had the same backbone markers (CD138-PerCP-Cy5.5, CD38-PB, CD45-KO and CD19-PE-Cy7), together with CD27-PE, CD81-FITC and CD20-APC in tube 1 and cyIgK-FITC, cyIgL-PE, CD56-APC and CD117-APC-AF 750 in tube 2. Bulk lysis was performed in protocols A, B and D. Every laboratory acquired at least 2x10e6 leukocytes (or at least 1x10e4 plasma cells) and performed data-analysis in Infinicyt version 1.6 or higher (A, B & C) or Navios Kaluza (D), using a threshold ranging from 10-25 aberrant plasma cell events as cutoff for MFC MRD positivity. Results Acquisition of events occurred the day after BM aspiration for all samples. The total number of acquired events per sample was dependent on the level of MRD, ranging from 3x10e5 to 2x10e7 leukocytes. MFC MRD results were very comparable between labs with a 1:1 correlation between results at every level of residual disease, being 1x10e-2, 1x10e-4, 1x10-4, 1x10e-5 and 1 MRD negative sample at the level of Conclusions This is the first time that a European framework has been set up between laboratories to test MFC MRD analysis in the context of an international trial. The sensitivity of the protocols has been compared in a quality assessment round, which showed a high correlation of results. Disclosures Oliva: Amgen: Honoraria; Takeda: Honoraria; Celgene: Honoraria. Boccadoro:CELGENE: Honoraria, Research Funding; Mundipharma: Research Funding; Janssen: Honoraria, Research Funding; Amgen: Honoraria, Research Funding; Abbivie: Honoraria; SANOFI: Honoraria, Research Funding; Novartis: Honoraria, Research Funding; BMS: Honoraria, Research Funding. Hajek:Takeda: Honoraria, Membership on an entity's Board of Directors or advisory committees. Sonneveld:Celgene: Honoraria, Research Funding; Amgen: Consultancy, Honoraria, Research Funding; Janssen: Consultancy, Honoraria, Research Funding; Takeda: Consultancy, Honoraria; Karyopharm: Consultancy, Honoraria, Research Funding. Palumbo:Takeda: Employment, Honoraria; Janssen Cilag: Honoraria.

Background Rd and MPR are effective treatments in newly diagnosed multiple myeloma (NDMM) patients (pts). In this study we compared a non-alkylating containing regimen (Rd) vs alkylating-based regimens (MPR/CPR) in elderly transplant ineligible NDMM pts. Methods Patients were randomized (2:1) to receive nine 28-day cycles of MPR/CPR or Rd. MPR: lenalidomide 10 mg/day for 21 days; melphalan orally 0.18 mg/Kg for 4 days in pts 65-75 years old and 0.13 mg/Kg in >75 years pts; prednisone 1.5 mg/Kg for 4 days; CPR: cyclophosphamide orally 50 mg/day for 21 days in pts 65-75 years old and 50 mg every other day (eod) in >75 years pts; lenalidomide 25 mg/day for 21 days; prednisone 25 mg every other day. Rd: lenalidomide 25 mg/day for 21 days; dexamethasone 40 mg on days 1,8,15 and 22 in pts 65-75 years old and 20 mg in those >75 years. After induction, patients were randomized to receive maintenance with lenalidomide alone (10 mg/day for 21 days) or with prednisone (25 mg eod on days 1-28), until disease progression. The primary endpoint was progression-free survival (PFS). Results Between October 2009 and October 2012, 659 pts were enrolled ( MPR/CPR:439 and Rd:220), and 641 pts were evaluable (MPR/CPR:430 and Rd:211). Patient characteristics were well balanced in the 2 groups: median age was 73 years in both groups, 38% of pts were older than 75 years, 27% had ISS stage III in both groups, 21% of patients both in the MPR/CPR and in the Rd groups had unfavorable FISH profile [t(4;14) or t (14;16) or del17p]. After induction, the response rates were similar in the 2 groups: at least PR rate was 75% versus 79% (p=0.52) and CR rate was 9% versus 7% (p=0.35), in the MPR/CPR and Rd group, respectively. No significant difference in response rate were reported between two alkylating containing regimens. After a median follow-up of 21 months, the 2-year PFS was 55% in MPR/CPR and 49% in Rd (HR=0.86, 95% CI: 0.66-1.12, p=0.26), and 2-year OS was 84% in MPR/CPR and 80% in Rd (HR= 0.93, 95% CI: 0.60-1.41, p=0.71) At least one grade ≥3 hematological adverse event was reported in 51% with MPR/CPR and 29% with Rd (p Conclusion In a community-based population, triplet alkylating combinations did not lead to different PFS or OS clinical benefits over doublet therapy. Updated results will be presented at the meeting. Disclosures: Palumbo: Amgen: Consultancy, Honoraria; Bristol-Myers Squibb: Consultancy, Honoraria; Celgene: Consultancy, Honoraria; Janssen Pharmaceuticals: Consultancy, Honoraria; Millenium: Consultancy, Honoraria; Onyx: Consultancy, Honoraria. Bringhen:Celgene: Honoraria. Giuliani:Celgene: Research Funding. Cavallo:Celgene: Honoraria; Celgene: Membership on an entity’s Board of Directors or advisory committees. Hajek:Celgene: Honoraria; Celgene: Consultancy. Boccadoro:Celgene: Consultancy, Membership on an entity’s Board of Directors or advisory committees, Research Funding; Janssen-Cilag: Consultancy, Honoraria, Membership on an entity’s Board of Directors or advisory committees.