Search

Tamarix and Haloxylon species are considered important trees in the desert regions. During a survey conducted on Tamarix and Haloxylon trunk diseases in Iran, numerous Botryosphaeriaceae isolates were recovered from infected wood tissues of trees showing dieback and canker symptoms. Our study aimed to identify and evaluate the pathogenicity of these isolates. Based on cultural characteristics, microscopic morphological features and phylogenetic analyses of the internal transcribed spacer (ITS) and partial large subunit (LSU) nrDNA, translation elongation factor 1α (EF-1α), and β-tubulin (BT) gene sequences combination, eight Botryosphariaceae species, including Botryosphaeria dothidea, Diplodia citricarpa, Dothiorella plurivora, Dothiorella sarmentorum, Lasiodiplodia mahajangana, Lasiodiplodia theobromae, Neofusicoccum parvum and Neoscytalidium dimidiatum, were isolated and identified from Tamarix and Haloxylon species. Botryosphaeria dothidea, Neofusicoccum parvum, Lasiodiplodia theobromae and Neoscytalidium dimidiatum were recorded on both Tamarix and Haloxylon species, while the remaining species were detected only from Tamarix or Haloxylon species. Pathogenicity tests were conducted on detached shoots of Tamarix aphylla and Haloxylon ammodendron as well as branches of both tree species under field conditions. Lasiodiplodia mahajangana was the most virulent species and caused the longest wood lesion lengths on both tree species. Most of these species are reported for the first time from their respective hosts. Our findings in this study may be able to improve the basic information on the importance of Botryosphaeriaceae family on desert trees in Iran as well as other countries. [ABSTRACT FROM AUTHOR]

Background: Theileriosis infection is a tick-borne disease that leads to global animal morbidity, mortality and economic losses. Aim: This study aimed to examine Theileriosis infection by traditional and molecular methods Methods: A total of 100 blood samples of local breed cows were examined by Giemsa smearing under a microscope, amplified-PCR in region 18SrRNA PCR at 600bp, and DNA sequencing analysis the genetic relationships. Results: The clinical signs showed that an elevated fever [40.3-41.5°C], an asymmetrical extension of superficially prescapular lymph nodes, lacrimation, icteric mucus membranes eyes, ecchymotic haemorrhages on sclera, dullness, lethargy, salivation, and ticks presence. Giemsa-stained blood smear and conventional PCR were revealed 24% and 73% for infection respectively. Phylogenetic tree was constructed with DNA sequencing analysis of accession number: OQ779946.1, OQ779947.1, OQ779949.1, OQ779952.1, OQ779953.1 and OQ779953.1, belonging to T. annulata; acc. nos.: OQ779950.1, OQ779951.1 belong to T. parva; acc. nos.: OQ779948.1, OQ779960.1 belongs to Theileria species; acc. no.: OQ779955.1, OQ779957.1, OQ779958.1 belong to T. sergenti; and OQ779956.1, OQ779959.1 belong to T. orientalis. Nucleotide substitutions of transversion and transitions occurred in 11 types containing gaps and missing are A>T; A>C; A>G; C>A; C>G; C>T; G>A; G>C; G>T; T>A; T>C for 254 positions in final dataset. Conclusion: This study showed theileriosis infection is highly endemic and represent a first investigation into use of molecular phylogeny to classify Theileria in Al-Fallujah City, West Region of Iraq. [Open Vet J 2024; 14(9.000): 2261-2268]

This research aimed to study the life cycle and duration of each biological stage of the blow fly Calliphora vicina. Adult specimens were collected from various locations in the Erbil provinces and reared on decaying chicken meat. Each female fly produced between 440 to 620 eggs during her lifetime, laying them in clusters of up to 180 eggs at a time. The larvae feed for three to four days under warm, optimal conditions, with the puparium forming two to three days later. The entire life cycle of this insect is completed in approximately 15 days. Morphologically, the adult fly is robust, dark black-blue in color, about 5-12 mm in length, while the immature stages (1st, 2nd, and 3rd larval instars) are vermiform, creamy-white, and feature a distinct cephaloskeleton and varying body lengths, while the Larva 1: Vermiform, pale yellow, length 1.7-3.4 mm.the slits of posterior spiracles were conducted to gather slightly appeared as one part,. Larva 11 Vermiform, Milky white –pale yellow, length 4.7-7.8 mm.and sometimes absent dorsally, the slits of the posterior spiracles were clearly found and separated in to two lines; . Larva III: The mature larva milky white, reaches a length 14-19 mm. Female: resembles the male but differs by the eyes are an holoptic separated from one another by board frons. The slits of the posterior spiracles were distinctly observed and divided into three lines. Another part of the study focused on identifying the insect using molecular methods, specifically PCR. Species-specific primers were prepared and the COI sequence of samples (550 bp) was aligned using the BLAST program from GenBank (http://blast.ncbi.nlm.nih.gov/) with the submitted accession number PP733158 to compare our amplified sequences with other stored sequences. The BLAST results indicated that the highest identity query sequence was recorded in the NCBI gene bank for insect identification.

Copyright of Journal of Kirkuk University for Agricultural Sciences is the property of Republic of Iraq Ministry of Higher Education & Scientific Research (MOHESR) and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Background: Theileriosis infection is a tick-borne disease that leads to global animal morbidity, mortality, and economic losses. Aim: This study aimed to examine Theileriosis infection by traditional and molecular methods. Methods: A total of 100 blood samples of local breed cows were examined by Giemsa smearing under a microscope, amplified-PCR in region 18SrRNA PCR at 600bp, and DNA sequencing analysis of the genetic relationships. Results: The clinical signs showed that an elevated fever (40.3°C-41.5°C), an asymmetrical extension of superficially prescapular lymph nodes, lacrimation, icteric mucus membranes eyes, ecchymotic hemorrhages on the sclera, dullness, lethargy, salivation, and ticks presence. Giemsa-stained blood smear and conventional PCR were revealed 24% and 73% for infection respectively. The phylogenetic tree was constructed with DNA sequencing analysis of accession number: OQ779946.1, OQ779947.1, OQ779949.1, OQ779952.1, OQ779953.1 and OQ779953.1, belonging to Theileria annulata; acc. nos.: OQ779950.1, OQ779951.1 belong to Theileria parva; acc. nos.: OQ779948.1, OQ779960.1 belongs to Theileria species; acc. no.: OQ779955.1, OQ779957.1, OQ779958.1 belong to T. sergenti; and OQ779956.1, OQ779959.1 belong to Theileria orientalis. Nucleotide substitutions of transversion and transitions occurred in 11 types containing gaps and missing are A>T; A>C; A>G; C>A; C>G; C>T; G>A; G>C; G>T; T>A; T>C for 254 positions in the final dataset. Conclusion: This study showed theileriosis infection is highly endemic and represents the first investigation into the use of molecular phylogeny to classify Theileria in Fallujah city, West Region of Iraq. [ABSTRACT FROM AUTHOR]

Background: The larvae of Altenia spp. and gall aphids are known to feed on plants related to Anacardiaceae. This study documents the aphidophagous habit of Altenia wagneriella, which was verified by molecular techniques, subsequently by the gut dissection test, and direct observation. Materials and methods: To identify the moth larvae and adult aphids, two mitochondrial genes, cytochrome c oxidase I (COI) and cytochrome b (Cytb), were amplified by polymerase chain reaction (PCR). Nested PCR with the aphid-specific primer pairs AphidF and AphidR was used to detect aphids in the body of moth larvae. The specificity of the primers was verified by PCR analysis of DNA from moth larvae and adult aphids. Results: The method detected aphids in moth larvae, and a band of approximately 200 bp was amplified from moth larvae feeding on aphids. No cross reactions with moth larvae were observed. In the laboratory, all moth larvae feeding on aphids (Forda marginata) were also PCR positive for aphids. Conclusions: Gall-inducing insects are microhabitat engineers that manipulate their host to obtain a better nutrient supply, as well as protection from natural enemies and abiotic factors. This is the first recorded instance worldwide of the carnivorous larva of the moth A. wagneriella acting as an aphid predator, as well as the first record of a host insect for this species. Additionally, it is the first effort to molecularly analyze the predator-prey relationship between the moth larvae and the aphids inside the wild pistachio gall. [ABSTRACT FROM AUTHOR]

The current study conducted the first characterization of morphological and molecular of seven Ostracoda species new to Iraqi fauna which are; Heterocypris salina, H. spadix, Dolerocypris sinensis, Cyprinotus unoi, Eucypris virens, Sclerocypris exserta and Notodromas monacha that belongs to two families (Cyprididae and Notodromatidadae) collected from 17 different sites which are stream, lakes and rivers in the boundary of Province, from September 2021 to October 2022. For biological purposes, samples of aquatic shore plants (Cynodon dactylon, Polygonum sp., Nerium oleander and Nasturtium officinale), algal municipal (Anabaena and Chlorella vulgaris), were also collected zooplanktonic net was used in the sampling mesh-size (55 μm pore size).Samples placed in an oxygen instrument for about one week after being transformed into the laboratory to allow the ostracod species to grow. After the maturation period, adult species were fixed (were preserved) in 70% and 100% ethanol for morphological and molecular analysis respectively. PCR product of COI was sequenced using forward primer COI F 5'(ACCCGCTGAATTTAAGCAT)3' and reverse primer COIR 5'(CTCTTCAGATACTTTTCAAC) 3' then registered in the GenBank database with their accession numbers. The phylogenetic tree was constructed; the studied species were recognized (as new records to the Iraqi fauna of ostracods) and described from Iraq for the first time. The goal of present study is the molecular study the species besides the phenotypic identification for more accurate taxonomic results. [ABSTRACT FROM AUTHOR]

Copyright of Journal of Madenat Al-Elem University College / Magallaẗ Kulliyyaẗ Madīnaẗ Al-ʿAlam Al-Ğāmi'aẗ is the property of Republic of Iraq Ministry of Higher Education & Scientific Research (MOHESR) and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Spices are food flavouring agents that are highly used in Iraq. However, they may be contaminated by toxicogenic fungi and subsequent production of mycotoxins. The aim of this study was to investigate the contamination of commonly used spices with fungi using polymerase chain reaction (PCR) assay and to detect fungal mycotoxin using high‐performance liquid chromatography. Thirty‐five spices (seven samples from each black pepper, red pepper, turmeric, cumin and ginger) were cultured on an appropriate medium to identify various fungi species. Later on, the toxigenicity of Aspergillus flavus and Aspergillus niger was determined using a PCR assay. The fungal mycotoxins, including aflatoxins and ochratoxins, were then determined through a high‐performance liquid chromatography using the validated Quick, Easy, Cheap, Effective, Rugged, and Safe (QuECHERS) method. Aspergillus species were the predominantly isolated fungi, followed by Penicillium and Fusarium. The PCR results indicate the high toxigenicity of A. flavus as 85.7% of the strains had aflQ/aflR genes and 79% had PKS15KS/PKS15C‐MeT genes. Regarding mycotoxin contamination in spices, the highest rates of aflatoxins and ochratoxins were found in black pepper (5.913 μg/kg) and red chilli (6.9055 μg/kg), respectively. Spices are susceptible substrates for the growth of mycotoxigenic fungi. Thus, regular effective surveillance and quality control procedures are highly recommended. [ABSTRACT FROM AUTHOR]

The current study conducted the first characterization of morphological and molecular of seven Ostracoda species new to Iraqi fauna which are; Heterocypris salina, H. spadix, Dolerocypris sinensis, Cyprinotus unoi, Eucypris virens, Sclerocypris exserta and Notodromas monacha that belongs to two families (Cyprididae and Notodromatidadae) collected from 17 different sites which are stream, lakes and rivers in the boundary of Province, from September 2021 to October 2022. For biological purposes, samples of aquatic shore plants (Cynodon dactylon, Polygonum sp., Nerium oleander and Nasturtium officinale), algal municipal (Anabaena and Chlorella vulgaris), were also collected zooplanktonic net was used in the sampling mesh-size (55 μm pore size).Samples placed in an oxygen instrument for about one week after being transformed into the laboratory to allow the ostracod species to grow. After the maturation period, adult species were fixed (were preserved) in 70% and 100% ethanol for morphological and molecular analysis respectively. PCR product of COI was sequenced using forward primer COI F 5'(ACCCGCTGAATTTAAGCAT)3' and reverse primer COIR 5'( CTCTTCAGATACTTTTCAAC) 3' then registered in the GenBank database with their accession numbers. The phylogenetic tree was constructed; the studied species were recognized (as new records to the Iraqi fauna of ostracods) and described from Iraq for the first time. The goal of present study is the molecular study the species besides the phenotypic identification for more accurate taxonomic results.

Background: The Mediterranean area is a diversity center for the genus Dianthus. However, species belonging to this genus, including Dianthus orientalis Adams (DOA), have not been investigated for their medicinal activities. Objectives: To investigate antidiabetic, antihyperlipidemic, antioxidant effects and molecular mechanism of D. orientalis Adams leaf extract (DOAE) in an animal model. Materials and methods: The plant leaves were collected from July to August 2021 from Penjween district, Sulaimaniyah, Iraq and then identified, authenticated, shadow-dried, and extracted using pure methanol. Thirty rats were divided randomly into 5 groups of 6 animals each. Group 1 was control negative (CN) and received distilled water (DW). Group 2 was diabetic control (DC) that received DW, while group 3 was control positive (CP) treated with Glibenclamide (GLB, 0.6 mg/kg body weight). Groups 4 and 5 were diabetic rats who received a low-dose (30 mg/kg) and a high-dose (90 mg/kg) of DOAE orally for 4 weeks. Then, lipid profile, total antioxidant capacity, histopathological examinations, and molecular studies were conducted. Results: DOAE was more effective than GLB in reducing blood glucose, lipid parameters, liver enzymes, and renal function. Micromorphological assay of livers, kidneys, and pancreas revealed significant restoration in diabetic groups treated with DOAE (90 mg/kg) and GLB compared to the DC group. Microribonuclic acid-21 (miR-21) was significantly expressed in DC but markedly lowered in both DOAE groups, while miR-24 and miR-126 were significantly suppressed in DC and expressed in the DOAE-treated groups. Conclusions: DOAE exerted significant antihyperglycemic, anti-dyslipidemic, antioxidant, and hepatorenal protective effects in diabetic rats. [ABSTRACT FROM AUTHOR]

Abstract Highly effective AgNPs@C was efficiently synthesized by electrical arc powered by single spark unit which was sufficient to ionize the dielectric media (deionized water) through applying strong electric field between the electrodes (silver and carbon). The AgNPs@C shell was characterized in terms of stability, morphology and phase structure. All characterizations showed that the prepared silver nanoparticles were spherical with average size reached 17 nm coated with carbon shell. The antibacterial effect of the synthesized nanoparticles was tested against Pseudomonas aeruginosa in comparison to Ceftazidime (commonly used antibiotic against P. aeruginosa infections). It was revealed that AgNPs@C shell has superior activity with inhibition zone diameter reached 15 mm and minimum inhibitory concentration reached 2 µg/mL. The observed activity was further confirmed by confocal microscope which showed an increased red region, representing the dead cells, correlated with the presence of AgNPs@C. Moreover, transmission electron microscope studies implied the possible AgNPs@C antibacterial mechanism of action was the nanoparticles adherence to the bacterial membrane causing cell lysis. The molecular studies against fimH (virulence adhesion gene), rmpA (mucoid factor encoding gene), and mrkA (biofilm forming gene) proved the inhibition of their genetic expression. The cytotoxic effect of the synthesized AgNPs@C showed CC50 reached 235.5 μg/mL against normal lung cells (L929 cell line).

Entamoeba histolytica infects the large intestine of humans, causing a spectrum of clinical appearances ranging from asymptomatic colonization to severe intestinal and extra-intestinal disease. The parasite is identical microscopically to commensal nonpathogenic amoeba. To detect the pathogenic Entamoeba and estimate the precise prevalence of the parasite among the symptomatic pediatric population using molecular techniques. 323 fecal samples were collected from symptomatic children admitted to Sulaimani Pediatric Teaching Hospital, Sulaimaniyah Province, Iraq, from June to October 2021. A structured, validated questionnaire was prepared and used to report participants’ gender, residency, and drinking water source. Then, stool samples were microscopically examined, and the positive samples were submitted to molecular analysis by amplifying the 18s rRNA gene using nested PCR to differentiate E. histolytica from other nonpathogenic Entamoeba. Finally, gene sequences were done to confirm the species. Microscopically, 58 positive samples represented Entamoeba species infection rate of 18% among symptomatic patients. However, only 18 samples were positive for E. histolytica based on molecular methods, which accounts for 31% of the positive by microscopy and 5.6% among the 323 symptomatic populations. NCBI, available in their database, gives the gene sequence and accession number. Patients’ sociodemographic data and water sources were directly related to the infection rate. Classical microscopic examination provides a misleading profile about the prevalence of E. histolytica in an endemic region that might lead to unnecessary treatments and a lack of appropriate management for patients.

Abstract Aim Achondroplasia is the most common of the skeletal dysplasias that cause fatal and disabling growth and developmental disorders in children, and is caused by a mutation in the fibroblast growth factor receptor, type 3 gene(FGFR3). This study aims to analyse the clinical characteristics and gene mutations of ACH to accurately determine whether a patient has ACH and to raise public awareness of the disease. Methods The database of Pubmed, Cochrane Library, Wanfang and CNKI were searched with terms of “Achondroplasias” or “Skeleton-Skin-Brain Syndrome” or “Skeleton Skin Brain Syndrome” or “ACH” and “Receptor, Fibroblast Growth Factor, Type 3” or “FGFR3”. Results Finally, four hundred and sixty-seven patients with different FGFR3 mutations were enrolled. Of the 138 patients with available gender information, 55(55/138, 40%) were female and 83(83/138, 60%) were male. Among the patients with available family history, 47(47/385, 12%) had a family history and 338(338/385, 88%) patients were sporadic. The age of the patients ranged from newborn babies to 36 years old. The mean age of their fathers was 37 ± 7 years (range 31–53 years). Patients came from 12 countries and 2 continents, with the majority being Asian (383/432, 89%), followed by European (49/432, 11%). Short stature with shortened arms and legs was found in 112(112/112) patients, the abnormalities of macrocephaly in 94(94/112) patients, frontal bossing in 89(89/112) patients, genu valgum in 64(64/112) patients and trident hand were found in 51(51/112) patients. The most common mutation was p.Gly380Arg of the FGFR3 gene, which contained two different base changes, c.1138G > A and c.1138G > C. Ten rare pathogenic mutations were found, including c.831A > C, c.1031C > G, c.1043C > G, c.375G > T, c.1133A > G, c.1130T > G, c.833A > G, c.649A > T, c.1180A > T and c.970_971insTCTCCT. Conclusion ACH was caused by FGFR3 gene mutation, and c.1138G > A was the most common mutation type. This study demonstrates the feasibility of molecular genetic testing for the early detection of ACH in adolescents with short stature, trident hand, frontal bossing, macrocephaly and genu valgum.

Highly effective AgNPs@C was efficiently synthesized by electrical arc powered by single spark unit which was sufficient to ionize the dielectric media (deionized water) through applying strong electric field between the electrodes (silver and carbon). The AgNPs@C shell was characterized in terms of stability, morphology and phase structure. All characterizations showed that the prepared silver nanoparticles were spherical with average size reached 17 nm coated with carbon shell. The antibacterial effect of the synthesized nanoparticles was tested against Pseudomonas aeruginosa in comparison to Ceftazidime (commonly used antibiotic against P. aeruginosa infections). It was revealed that AgNPs@C shell has superior activity with inhibition zone diameter reached 15 mm and minimum inhibitory concentration reached 2 µg/mL. The observed activity was further confirmed by confocal microscope which showed an increased red region, representing the dead cells, correlated with the presence of AgNPs@C. Moreover, transmission electron microscope studies implied the possible AgNPs@C antibacterial mechanism of action was the nanoparticles adherence to the bacterial membrane causing cell lysis. The molecular studies against fimH (virulence adhesion gene), rmpA (mucoid factor encoding gene), and mrkA (biofilm forming gene) proved the inhibition of their genetic expression. The cytotoxic effect of the synthesized AgNPs@C showed CC50 reached 235.5 μg/mL against normal lung cells (L929 cell line). [ABSTRACT FROM AUTHOR]

Objectives Adult T-cell leukemia/lymphoma (ATLL) is a rare aggressive T-cell leukemia/lymphoma associated with human T lymphotropic virus type 1 infection. The patients might present with skin rash before, at, or after the diagnosis. The dermatopathologic finding might be diagnostically very challenging. Methods We retrospectively identified 110 patients with ATLL at a single institution in a 19-year period, with 19 patients having skin biopsies. Clinical, dermatopathologic, immunophenotypic, and molecular findings were studied. Results The cohort included 13 skin-first (5 acute, 5 lymphomatous, 2 chronic, 1 smoldering), 6 skin-second (4 acute, 1 lymphomatous, 1 smoldering), and 91 patients without skin biopsy. Some nonphotoprotected areas of body such as the forearm and lower lip were also seen. Skin manifestations included papular (5), erythroderma (1), nodulotumoral (3), plaques (1), patches (1), and a combination of skin rashes (2). Histopathologic findings included large pleomorphic cells, angiocentrism, epidermal infiltration with large Pautrier-like microabscesses, and folliculotropism. Fifteen (78.9%) cases showed CD4+/CD7–/CD25+. Next-generation sequencing study was conducted on 5 patients using either blood or bone marrow samples, revealing multiple genetic mutations across multiple signaling pathways. Conclusions Pleomorphic large, atypical cells with CD4+/CD25+/CD7– immunophenotype from a non–"bathing trunk" location, especially in a patient from endemic regions, raise suspicion for ATLL. T-cell receptor gene rearrangement is almost always positive, and the neoplasm usually demonstrates multiple mutations by next-generation sequencing study. [ABSTRACT FROM AUTHOR]

Aim: Diagnosis of mesothelioma in situ (MIS) is historically controversial and, until recently, specific features defining the entity have not been well characterized. Most reported cases of MIS occurred in the pleura; peritoneal MIS is very rare. This study investigates the morphologic features and results of ancillary testing in peritoneal MIS. Methods: We present three patients with peritoneal MIS, as defined by a single layer of mesothelial cells with loss of nuclear BRCA‐1‐associated protein‐1 (BAP1) immunostaining and without evidence of invasive tumour by microscopic evaluation, imaging, or direct examination of the peritoneum. Histology and immunostains were reviewed by three expert thoracic pathologists with multidisciplinary input. Next‐generation sequencing (NGS) was performed in all three cases. A literature review was conducted to characterize this rare precursor lesion. Results: BAP1 was lost in all three lesions, while methylthioadenosine phosphorylase (MTAP) was retained in two (not performed in the third). NGS revealed BAP1 pathogenic alterations in all three cases as well as mutations of SMO, ERCC3, TET2, and U2AF1. Progression to invasive mesothelioma occurred in one patient at 13 months postdiagnosis (case 1). One patient was diagnosed at age 24 and was later found to harbour a BAP1 germline mutation (case 3). Conclusion: This work describes the histologic features and clinicopathologic characteristics of peritoneal MIS in three cases, highlights BAP1 somatic and germline mutations in peritoneal MIS, and strengthens the importance of ancillary studies (including immunohistochemical and molecular studies) in the diagnosis of MIS. [ABSTRACT FROM AUTHOR]

Aim: Achondroplasia is the most common of the skeletal dysplasias that cause fatal and disabling growth and developmental disorders in children, and is caused by a mutation in the fibroblast growth factor receptor, type 3 gene(FGFR3). This study aims to analyse the clinical characteristics and gene mutations of ACH to accurately determine whether a patient has ACH and to raise public awareness of the disease. Methods: The database of Pubmed, Cochrane Library, Wanfang and CNKI were searched with terms of "Achondroplasias" or "Skeleton-Skin-Brain Syndrome" or "Skeleton Skin Brain Syndrome" or "ACH" and "Receptor, Fibroblast Growth Factor, Type 3" or "FGFR3". Results: Finally, four hundred and sixty-seven patients with different FGFR3 mutations were enrolled. Of the 138 patients with available gender information, 55(55/138, 40%) were female and 83(83/138, 60%) were male. Among the patients with available family history, 47(47/385, 12%) had a family history and 338(338/385, 88%) patients were sporadic. The age of the patients ranged from newborn babies to 36 years old. The mean age of their fathers was 37 ± 7 years (range 31–53 years). Patients came from 12 countries and 2 continents, with the majority being Asian (383/432, 89%), followed by European (49/432, 11%). Short stature with shortened arms and legs was found in 112(112/112) patients, the abnormalities of macrocephaly in 94(94/112) patients, frontal bossing in 89(89/112) patients, genu valgum in 64(64/112) patients and trident hand were found in 51(51/112) patients. The most common mutation was p.Gly380Arg of the FGFR3 gene, which contained two different base changes, c.1138G > A and c.1138G > C. Ten rare pathogenic mutations were found, including c.831A > C, c.1031C > G, c.1043C > G, c.375G > T, c.1133A > G, c.1130T > G, c.833A > G, c.649A > T, c.1180A > T and c.970_971insTCTCCT. Conclusion: ACH was caused by FGFR3 gene mutation, and c.1138G > A was the most common mutation type. This study demonstrates the feasibility of molecular genetic testing for the early detection of ACH in adolescents with short stature, trident hand, frontal bossing, macrocephaly and genu valgum. [ABSTRACT FROM AUTHOR]

Cercospora leaf spot disease on lettuce (Lactuca sativa L.) caused losses in Tabanan Regency, Bali, Indonesia. Cercospora leaf spot in lettuce results from the pathogenic fungi Cercospora canescens. The preventive research aimed to identify the fungi on the morphological and molecular basis by using universal primers for PCR of ITS 1 and ITS 4. The study used Koch's Postulates method to isolate the pathogenic fungal isolates from lettuce plants and test for pathogenicity. Identification of fungi continued macroscopically, microscopically, and molecularly. The macroscopic and microscopic observations showed that the cause of cercospora leaf spot on lettuce is the fungal disease caused by pathogenic fungi Cercospora spp. The isolate creates a dull white and robust mycelium structure, sideways growth, branched and septate hyphae, branched conidiophores, and dark lanceolate conidia. Through molecular identification, it helped recognize that fungi Cercospora canescens isolate Cer11-18 (Accession Number: MN400290.1) is the foremost cause of a withered lettuce crop. It is also the first research on the cercospora leaf spot disease on lettuce caused by Cercospora spp. in Tabanan Regency, Bali, Indonesia. [ABSTRACT FROM AUTHOR]

Astragalus L. is one of the main genera of blossoming plants, and its diversity of species and forms is well known. The Astragalus L. taxa make a significant contribution to the mountainous and steppe ecosystems of the Kurdistan region of Iraq. Although the species within this genus have been the subject of several molecular studies, the evolutionary relationships among these species remain unidentified. Despite extensive research, little is known about the phylogenetic relationships among the various subgenera of Astragalus. This research is intended to investigate the molecular variation of 33 species of the genus Astragalus L. found in the Kurdistan area of Iraq. For molecular validations, three separate techniques (nuclear ribosomal DNA (rDNA), inter simple sequence repeats (ISSR), and conserved DNA-derived polymorphism (CDDP)) were used. With respect to Astragalus L. indentations, universal ITS1 and ITS4 gene sequencing was used, and the discovered sequences were subjected to BLAST searches in the NCBI database. A phylogenetic tree was generated with two main clades. Regarding detecting genetic diversity between the taxa, 24 molecular markers (14 ISSR and 10 CDDP) were used. High values of polymorphic materials and gene diversity were detected. ISSR markers had an average of 22.71 polymorphic bands per primer, while CDDP markers had the highest mean values for polymorphic information content (0.37), Shannon's information index (0.27), expected heterozygosity (0.19), and unbiased expected heterozygosity (0.23). Cluster and principal coordinate analyses divided the Astragalus L. taxa into four main groups using the two molecular data sets. According to the results of the molecular variance analysis, the highest variation was detected within sections, with values of 92.01 and 89.48% for ISSR and CDDP markers, respectively. These outcomes suggest the effectiveness of molecular markers and the ITS region in determining and identifying genetic correlations between Astragalus species. [ABSTRACT FROM AUTHOR]

The presented research, comprising characterization of nine species of the wild rose (Rosa L.), came from various regions of Northern Iraq. The study proceeded in 2021-2022 at the College of Education of Pure Science, University of Mosul, Mosul, Iraq. Employing the random amplification polymorphism DNA (RAPD) helped determine the genetic variation relationships among the species using the statistical program Numerical Taxonomy and Multivariate Analysis System (NTSYSpc 2.02). The use of 10 random primers attained amplifications observed with agarose gel electrophoresis. The RAPD primers generated 523 random bands, making it possible to separate Rosa species from each other. Among the studied species, the genetic distance ranged from 0.067 to 1.027. The least genetic dimension (0.067) came from the species Rosa canina var. deseglisei and Rosa canina var. canina, with the highest genetic breadth reaching 1.027 between Rosa x centifolia and Rosa foetida. The dendrogram revealed three main clusters based on the genetic distance values, with the third one getting split into three distinct groups. RAPD proved as an effective method for studying the relatedness among the species. [ABSTRACT FROM AUTHOR]

This study was conducted to investigate the complete sequences of nuclear ITS region, which determined five species of Eryngium L. Apiaceae in Iraq to inference phylogenetic relationships. Pycnocycla aucheriana was used as outgroups. Phylogenetic analysis was performed using ClastalW in MEGA6 version 7.0.4.1 with high supported (bootstrapping) value for each clade in a dendrogram. The phylogenetic trees showed Eryngium glomerutum as the basal lineage in a dendrogram. The sister clade to E. glomerutum was E. billardieri which form the second clade in phylogenetic trees. The third clade included only E. creticum which is considered as a sister clade to the E. campestre and E. thyrosoideum in the dendrogram. Finally, the monophylly of each clade was well supported, and phylogenetic relationships between Enyngium species was cleared based on DNA Sequencing character.

Lice are permanent, obligate ectoparasites for birds and mammals. Bovicola caprae causes hypersensitivity, irritation, dermatitis, anemia, lower weight gain, and lower productivity in goats. This study was conducted to investigate B. caprae by molecular methods based on the mitochondrial genome in the West and Northwest of Iran. A total of 1017 samples of chewing lice collected from ten cities in five provinces were identified using diagnostic keys. After DNA extraction and PCR, samples were sent for sequencing. Morphological results were consistent with molecular examinations. Nucleotide sequencing of samples isolated from different cities based on mitochondrial genome showed 100% intraspecific similarity. The sequences of B. caprae isolated in this study appeared in a branch next to the Canadian and Chinese samples in the phylogenetic tree with more than 90% similarity. The results of mitochondrial gene analysis in the present research showed that this fragment is useful for showing intraspecific similarity and species and genus differentiation of B. caprae.

In this study, we determined the complete mitochondrial genome of the invasive insect species Melanoplus differentialis captured in Korea. The complete mitochondrial genome of M. differentialis is 15,625 bp long and comprises 13 protein‐coding genes, two ribosomal RNA genes, and 22 transfer RNAs, with a GC ratio of 25.2%. In total, 353 SNPs and 11 INDEL regions (total length 67 bp) were found against the previously sequenced M. differentialis mitochondrial genome recorded as public genome data. The number of interspecific variations was greater than the number of intraspecific variations in this insect. Phylogenetic tree analysis showed that the mitochondrial genome clustered the Melanoplus clade with two previously reported Melanoplus sequences. However, the sequences were not divided at the species‐level clade possibly as a consequence of misidentification caused by an error in the public database. Our results extend the molecular database status of Melanoplus by providing a novel complete mitochondrial genome sequence for M. differentialis that could serve as reference for further molecular studies. [ABSTRACT FROM AUTHOR]

Mothbeanis a drought and heat tolerant pulse crop grown in arid and semi-arid regions of India. The extent of genetic variability, correlation, path analysis for seed yield and nine yield attributes was studied in thirty-eight genotypes during the kharif, 2019 in randomized complete block design in four replications. The differences among all the genotypes were significant for all the traits. Days to flowering recorded high genotypic and phenotypic coefficient of variation followed by plant height and low magnitudes were reported for protein content, pod length and the number of seeds per pod. The broad sense heritability was high for days to flowering, days to maturity, the number of pods per plant, hundred seed weight, plant height, seed yield per plant, the number of branches per plant and the number of seeds per pod. A low genetic advance as per cent mean was recorded for protein content and pod length. The trait, seed yield per plant was significantly and positively correlated with the number of pods per plant at both genotypic (0.662) and phenotypic (0.618) levels. The path analysis revealed that the number of pods per plant, days to maturity, the number of seeds per pod and plant height exhibited a high direct effect on seed yield per plant. The microsatellites were used to analyse the polymorphisms among mothbean genotypes. The polymorphic information content value of the microsatellites ranged from 0.23 to 0.57, while the heterozygosity value ranged from 0.26 to 0.64. The cluster diagram revealed a similarity index value ranged from 0.08 to 1.00 and the genotypes were clustered in two main groups. Based on the results it could be concluded that microsatellites are efficient in discriminating among the mothbean genotypes and the study showed a narrow gene base of the genotypes.

Abstract Background Niemann-Pick disease type C (NPC) is a rare lysosomal neurovisceral storage disease caused by mutations in the NPC 1 (95%) or NPC2 (5%) genes. The products of NPC1 and NPC2 genes play considerable roles in glycolipid and cholesterol trafficking, which could consequently lead to NPC disease with variable phenotypes displaying a broad spectrum of symptoms. Materials In the present study 35 Iranian NPC unrelated patients were enrolled. These patients were first analysed by the Filipin Staining test of cholesterol deposits in cells for NPC diagnostics. Genomic DNA was extracted from the samples of peripheral blood leukocytes in EDTA following the manufacturer's protocol. All exon–intron boundaries and coding exons of the NPC1gene were amplified by polymerase chain reaction (PCR) using appropriate sets of primers. Thereafter, the products of PCR were sequenced and analysed using the NCBI database ( https://blast.ncbi.nlm.nih.gov/Blast.cgi ). The variants were reviewed by some databases including the Human Gene Mutation Database (HGMD) ( http://www.hgmd.cf.ac.uk/ac/index.php ) and ClinVar ( https://www.ncbi.nlm.nih.gov/clinvar (. Moreover, all the variants were manually classified in terms of the American College of Medical Genetics and Genomics (ACMG) guideline. Results The sequence analysis revealed 20 different variations, 10 of which are new, including one nonsense mutation (c.406C > T); three small deletions, (c.3126delC, c.2920_2923delCCTG, and c.2037delG); and six likely pathogenic missense mutations, (c.542C > A, c.1970G > A, c.1993C > G, c.2821 T > C, c.2872C > G, and c.3632 T > A). Finally, the pathogenicity of these new variants was determined using the ACMG guidelines. Conclusion The present study aimed to facilitate the prenatal diagnosis of NPC patients in the future. In this regard, we identified 10 novel mutations, and verified that the majority of them occurred in six NPC1 exons (5, 8, 9, 13, 19, and 21), that should be considered with a high priority for Iranian patients' cost-effective evaluation.

Astragalus L. is one of the main genera of blossoming plants, and its diversity of species and forms is well known. The Astragalus L. taxa make a significant contribution to the mountainous and steppe ecosystems of the Kurdistan region of Iraq. Although the species within this genus have been the subject of several molecular studies, the evolutionary relationships among these species remain unidentified. Despite extensive research, little is known about the phylogenetic relationships among the various subgenera of Astragalus. This research is intended to investigate the molecular variation of 33 species of the genus Astragalus L. found in the Kurdistan area of Iraq. For molecular validations, three separate techniques (nuclear ribosomal DNA (rDNA), inter simple sequence repeats (ISSR), and conserved DNA-derived polymorphism (CDDP)) were used. With respect to Astragalus L. indentations, universal ITS1 and ITS4 gene sequencing was used, and the discovered sequences were subjected to BLAST searches in the NCBI database. A phylogenetic tree was generated with two main clades. Regarding detecting genetic diversity between the taxa, 24 molecular markers (14 ISSR and 10 CDDP) were used. High values of polymorphic materials and gene diversity were detected. ISSR markers had an average of 22.71 polymorphic bands per primer, while CDDP markers had the highest mean values for polymorphic information content (0.37), Shannon’s information index (0.27), expected heterozygosity (0.19), and unbiased expected heterozygosity (0.23). Cluster and principal coordinate analyses divided the Astragalus L. taxa into four main groups using the two molecular data sets. According to the results of the molecular variance analysis, the highest variation was detected within sections, with values of 92.01 and 89.48% for ISSR and CDDP markers, respectively. These outcomes suggest the effectiveness of molecular markers and the ITS region in determining and identifying genetic correlations between Astragalus species.

Milk and milk products are important sources of nutrients to humans as they comprise of water, total solids, carbohydrates, fats, proteins and ash in balanced forms. Dairy products are highly nutritious due to the content and excellent medium for contaminants like molds, bacteria, yeasts and the mycotoxin produced by the molds which poses a great health risk to humans. The aim of the study is to isolate and molecularly identify by PCR, mycotoxinproducing fungi from fermented milk (nono) samples. A total of 35 samples of milk comprising thirty fermented milk (nono) and five infant formula processed milk samples were purchased. Isolation and identification of fungi isolates were conducted on PDA and SDA using morphological features. All positive isolates were confirmed using PCR. Four different mold species were isolated from the fermented milk (nono) samples: A. niger (20.8) P. citrinum (18.8), C. cladosporoides (6.2), A. flavus (16.7). Three of the isolates A. niger (27.2), P. citrinum (36.4) and A. flavus (36.4) were also observed in the infant formula processed milk samples. Molecular identification by PCR also revealed the presence of A. niger, P. citrinum and C. cladosporoides. The presence of these mycotoxin-producing fungi poses a great risk to human health most especially children, who are more vulnerable to the disease. [ABSTRACT FROM AUTHOR]

This study was conducted to investigate the complete sequences of nuclear ITS region, which determined five species of Eryngium L. Apiaceae in Iraq to inference phylogenetic relationships. Pycnocycla aucheriana was used as outgroups. Phylogenetic analysis was performed using ClastalW in MEGA6 version 7.0.4.1 with high supported (bootstrapping) value for each clade in a dendrogram. The phylogenetic trees showed Eryngium glomerutum as the basal lineage in a dendrogram. The sister clade to E. glomerutum was E. billardieri which form the second clade in phylogenetic trees. The third clade included only E. creticum which is considered as a sister clade to the E. campestre and E. thyrosoideum in the dendrogram. Finally, the monophylly of each clade was well supported, and phylogenetic relationships between Enyngium species was cleared based on DNA Sequencing character.. [ABSTRACT FROM AUTHOR]

ABSTRACT Members of the family Diclidophoridae are potentially dangerous species for the puffer fish aquaculture worldwide. They are parasitic polyopisthocotyleans, with a posterior haptor equipped with clamps for attachment to the host's surface, allowing the worm to resist the flow of water to maintain its position on gills. The anterior body of the worm is deformable, allows the worm to feed on blood sucked from fish gills. The present study is the first description of a Heterobothrium species from the gills of the tiger puffer Lagocephalus sceleratus (Tetraodontidae) from the coasts of the Arabian Gulf at Jubail, Saudi Arabia morphologically by light microscopy as well as by molecular analysis of the parasite partial 28S rRNA through multiple sequence alignments and phylogeny by maximum likelihood analysis which is provided for the first time for the described species. Seventeen tiger puffer fish were captured alive from marine water off Saudi Arabia; gills were separated and further examined for parasitic infection. Nine fish were found infected with a monogenean parasite which was robust, equipped by two buccal organs at the tapered anterior end; the posterior haptor was rectangular with four symmetrically arranged clamps, with no isthmus. Marginal hooks absent. Ovary elongated, U-shaped, testes numerous, irregularly shaped and extended from the posterior part of the ovary to the anterior margin of the haptor. Copulatory organ muscular, as a spherical cup armed with 12 to 15 genital hooks. The molecular analysis of the parasite 28s rRNA and phylogeny revealed a percentage of identities between 87.47-89.09%, with Diclidophoridae species within the monophyletic clade of Mazocraeidea where a maximum percentage of 89.09% were obtained for the morphologically different sister taxon H. okamotoi. The results obtained from molecular analysis are consistent with the conclusions drawn from morphological classification where that the parasite recorded was morphologically similar to H. lamothei which was not characterized by molecular analysis before. The recovered sequences were deposited into the GeneBank under accession number MT322610.

BACKGROUND: Anaplasmosis is caused by an obligate intracellular, gram-negative microorganism, which be-longs to the family Anaplasmatacea and can be transmitted by ticks and other arthropods. OBJECTIVES: The present study aimed to investigate the status of Anaplasma spp. infection by microscopy and molecular methods in dromedary camels in Bushehr province, Iran. METHODS: A total of 139 blood samples were collected from dromedary camels in Bushehr province. Giemsa staining and nested-polymerase chain reaction (PCR) were conducted to detect Anaplasma infection in the drome-dary camels. RESULTS: We found that 27 (19.4%) out of the total 139 blood samples were suspected for the presence of Ana-plasma spp. by morphological study. The PCR and nested-PCR sequencing results showed 111 (80%) and 134 (96%) samples positive for Anaplasma spp. and BLAST search in NCBI GenBank presented 100% identity with Candidatus Anaplasma camelii. CONCLUSIONS: The molecular results presented the high frequency of Candidatus Anaplasma camelii in camels, in Bushehr city.

The prevalence of multiple primary tumors has significantly increased last time. The question of choosing the optimal tactics of therapy today not fully resolved. Particular interest is the simultaneous detection of two neoplasms of similar origin in one study biopsy material. This publication presents a case of simultaneous diagnosis of myeloid sarcoma and mantle cell lymphoma in a 65-year-old patient, which required use of two different chemotherapy protocols. This example shows the need to use an extended diagnostic approach at all stages of the therapy, which allows choosing right tactics of therapy and achieving complete remission of two neoplasms.

Composite pheochromocytoma (CP) is a very rare tumor originating from neural crest cells, predominantly composed of pheochromocytoma (PCC), a chromaffin cell tumor arising in adrenal medulla, and ganglioneuroma, a tumor derived from autonomic ganglion cells of the nervous system. Moreover, CP may be present in the hereditary syndromes of which pheochromocytoma is part. Literature offers scarce data on this subject, and particularly about its biological behavior, clinical evolution, and molecular profile. We report the phenotype and outcome of three cases of CP (PCC and ganglioneuroma components), followed up at the Endocrine Service of the Clementino Fraga Filho University Hospital, Federal University of Rio de Janeiro, UFRJ, Rio de Janeiro, Brazil. Two nonsyndromic patients (cases 1 and 2) were negative to germline mutations in genes VHL, SDHB, SDHC, SDHD, SDHAF2, TMEM127, and MAX, while the third case (case 3) had clinical diagnosis of neurofibromatosis syndrome. Cases 1, 2, and 3 were diagnosed at 29, 39, and 47 years old, respectively, and were followed up for 3, 17, and 9 years without no CP recurrence. All cases had apparent symptoms of catecholaminergic excess secreted by PCC. Ganglioneuroma, the neurogenic component present in all three cases, had a percentage representation ranging from 5% to 15%. Tumors were unilateral and large, measuring 7.0 cm × 6.0 cm × 6.0 cm, 6.0 cm × 4.0 cm × 3.2 cm, and 7.5 cm × 6.0 cm × 4.5 cm, respectively. All cases underwent adrenalectomy with no recurrence, metastasis, or development of contralateral tumor during follow-up. Genetic testing has been scarcely offered to CP cases. However, a similar frequency of genetic background is found when compared with classic PCC, mainly by the overrepresentation of NF1 cases in the CP subset. By literature review, we identified a notorious increase in cases reported with CP in the last decade, especially in the last 3 years, indicating a recent improvement in the diagnosis of this rare disorder in clinical practice. [ABSTRACT FROM AUTHOR]

Copyright of Iranian Journal of Veterinary Science & Technology is the property of Ferdowsi University of Mashhad Press and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Objective: Acute Myeloid Leukemia (AML) and Acute Lymphoblastic Leukemia (ALL) are clinically and biologically diverse phenotypic diseases amongst hematological malignancies. The current study objectives were to diagnose and classify cases of AL as per revised 4th edition of WHO 2016 classification of AL's and study their clinicopathological profiles. Material and Method: This cross-sectional, observational study included 68 patients, diagnosed with AL were recruited. Diagnosis was based on peripheral blood smear examination, bone marrow aspiration, flowcytometry, and cytogenetic and molecular studies. Results: Sixty-eight cases of AL were diagnosed in a period of 2 years, where 25 cases were of ALL and 43 cases were of AML. In the subclassification of AML as per WHO 2016, 20 cases were of AML, RGA, 21 cases were of AML, NOS, and 2 cases were of AML, MRC. In AML, RGA, APL with PML-RARA positive cases were 10 out of 20 cases, AML with (8;21) RUNX1-RUNX1T1 were 7/20 cases; there were two cases of AML with mutated NPM1 gene and one case of AML with biallelic mutation of CEBPA. In AML, NOS subcategory AML with maturation was more common with 9/21cases. In subcategory of ALL, B-ALL was more common than T-ALL. B-ALL, NOS was more common than B-ALL, RGA and we had 1 case of NK cell Leukemia. Conclusion: The application of revised 4th edition WHO 2016 classification confers uniformity in reporting acute leukemia cases that aids in the treatment by using targeted therapies and helps in the prediction of prognosis. The WHO classification for acute leukemias is very objective, therapy oriented and the need of the hour.

Composite pheochromocytoma (CP) is a very rare tumor originating from neural crest cells, predominantly composed of pheochromocytoma (PCC), a chromaffin cell tumor arising in adrenal medulla, and ganglioneuroma, a tumor derived from autonomic ganglion cells of the nervous system. Moreover, CP may be present in the hereditary syndromes of which pheochromocytoma is part. Literature offers scarce data on this subject, and particularly about its biological behavior, clinical evolution, and molecular profile. We report the phenotype and outcome of three cases of CP (PCC and ganglioneuroma components), followed up at the Endocrine Service of the Clementino Fraga Filho University Hospital, Federal University of Rio de Janeiro, UFRJ, Rio de Janeiro, Brazil. Two nonsyndromic patients (cases 1 and 2) were negative to germline mutations in genes VHL, SDHB, SDHC, SDHD, SDHAF2, TMEM127, and MAX, while the third case (case 3) had clinical diagnosis of neurofibromatosis syndrome. Cases 1, 2, and 3 were diagnosed at 29, 39, and 47 years old, respectively, and were followed up for 3, 17, and 9 years without no CP recurrence. All cases had apparent symptoms of catecholaminergic excess secreted by PCC. Ganglioneuroma, the neurogenic component present in all three cases, had a percentage representation ranging from 5% to 15%. Tumors were unilateral and large, measuring 7.0 cm × 6.0 cm × 6.0 cm, 6.0 cm × 4.0 cm × 3.2 cm, and 7.5 cm × 6.0 cm × 4.5 cm, respectively. All cases underwent adrenalectomy with no recurrence, metastasis, or development of contralateral tumor during follow-up. Genetic testing has been scarcely offered to CP cases. However, a similar frequency of genetic background is found when compared with classic PCC, mainly by the overrepresentation of NF1 cases in the CP subset. By literature review, we identified a notorious increase in cases reported with CP in the last decade, especially in the last 3 years, indicating a recent improvement in the diagnosis of this rare disorder in clinical practice.

Introduction: A novel coronavirus has recently been discovered in Wuhan, China in December 2019 named SARS-COV-2. Sensitive molecular assays are now available for detection of SARS-COV-2. The aims of this study were to detect positive subjects of SARS-COV-2 and to survey some challenges that are encountered practically in detection of the virus by Real-time RT-PCR (rRT-PCR) technique. Materials and methods: 271 subjects including 105 women and 166 men were registered by census method from 15 April to 15 Jun of 2020. Nasopharyngeal and oropharyngeal swab samples of suspicious cases were collected for RNA extraction to identify SARS-COV-2 by rRT-PCR amplification. Results: 69% of the positive SARS-COV-2 patients over the age 50 were men. However, technically the results showed that in the time period of 15 April to 15 May of 2020 the contents of received rRT - PCR kits were infected with positive control. 8 % of certain negative control samples showed a signal resembling to that of the positive samples in the rRT - PCR process. In addition, the results showed that in some of the rRT - PCR kits the master mix would produce signals like positive control without adding the sample to it automatically in 7 % of the tests. Conclusion: Having different types of negative control for diagnosis of SARS-COV-2 is necessary to reduce the chance of having false positive results.

Lysosomal storage diseases (LSDs) are known as genetic disorders with an overall prevalence of 1 per 7700 live births. Sphingolipidosis, which is a subgroup of LSDs, is resulted from mutations in the coding genes of specific enzymes of sphingolipid hydrolases. The current study aimed to provide additional knowledge on the genotype of sphingolipidoses disease among Iranian patients affected by the disease. In this research, we studied 68 unrelated Iranian patients diagnosed with one kind of sphingolipidoses from 2014 to 2019. Thereafter, genomic DNA was isolated from their peripheral blood leukocytes samples in EDTA in terms of the manufacturer's protocol. All the coding exons and exon–intron boundaries of the related genes were sequenced and then analyzed using the NCBI database. Finally, they were reviewed using some databases such as the Human Gene Mutation Database (HGMD) and ClinVar (https://www.ncbi.nlm.nih.gov/clinva). By studying 22 MLD patients, 18 different variations of the ARSA gene were found, one of which was new including, named as c.472 T > G p. (Cys158Gly). Out of 15 Sandhoff disease (SD) patients, 11 different variations of the HEXB gene were found. Correspondingly, the c.1083-2delA was not reported earlier. By investigating 21 Iranian patients with Tay-Sachs disease (TSD), one new variant was found as c.622delG. The study of 10 Niemann–Pick disease A/B (NPDA/B (patients has led to the identification of 9 different SMPD1 gene variations, among which 3 variations were novel mutations. The results of the present study can be expanded to the genotypic spectrum of Iranian patients with MLD, SD, TSD, and NPD diseases and also used to innovate more effective methods for the detection of genetic carriers as well as diagnosing and counseling of Iranian patients affected with these disorders. [ABSTRACT FROM AUTHOR]

Background: Niemann-Pick disease type C (NPC) is a rare lysosomal neurovisceral storage disease caused by mutations in the NPC 1 (95%) or NPC2 (5%) genes. The products of NPC1 and NPC2 genes play considerable roles in glycolipid and cholesterol trafficking, which could consequently lead to NPC disease with variable phenotypes displaying a broad spectrum of symptoms. Materials: In the present study 35 Iranian NPC unrelated patients were enrolled. These patients were first analysed by the Filipin Staining test of cholesterol deposits in cells for NPC diagnostics. Genomic DNA was extracted from the samples of peripheral blood leukocytes in EDTA following the manufacturer's protocol. All exon–intron boundaries and coding exons of the NPC1gene were amplified by polymerase chain reaction (PCR) using appropriate sets of primers. Thereafter, the products of PCR were sequenced and analysed using the NCBI database (https://blast.ncbi.nlm.nih.gov/Blast.cgi). The variants were reviewed by some databases including the Human Gene Mutation Database (HGMD) (http://www.hgmd.cf.ac.uk/ac/index.php) and ClinVar (https://www.ncbi.nlm.nih.gov/clinvar (. Moreover, all the variants were manually classified in terms of the American College of Medical Genetics and Genomics (ACMG) guideline. Results: The sequence analysis revealed 20 different variations, 10 of which are new, including one nonsense mutation (c.406C > T); three small deletions, (c.3126delC, c.2920_2923delCCTG, and c.2037delG); and six likely pathogenic missense mutations, (c.542C > A, c.1970G > A, c.1993C > G, c.2821 T > C, c.2872C > G, and c.3632 T > A). Finally, the pathogenicity of these new variants was determined using the ACMG guidelines. Conclusion: The present study aimed to facilitate the prenatal diagnosis of NPC patients in the future. In this regard, we identified 10 novel mutations, and verified that the majority of them occurred in six NPC1 exons (5, 8, 9, 13, 19, and 21), that should be considered with a high priority for Iranian patients' cost-effective evaluation. [ABSTRACT FROM AUTHOR]

The members of the genus Asota are widely distributed from Africa, India, Sri Lanka, Myanmar, and Malayan regions to the Australian region containing 55 described species. Asota ficus (Fabricius, 1775) is one among the nine species of the genus described from India having a wide range of distribution. The present study includes the first mitochondrial DNA barcode generated from India for A. ficus with a valid voucher describing external morphological characters together with the male and female genitalia. Discussions pertain to the utility of DNA barcodes for studies on moths in India with a comment on the identity of other sequences showing shallow genetic divergence with our sequences. [ABSTRACT FROM AUTHOR]

The proliferation of invasive plants in ecosystems is one of the main causes of biodiversity loss. These invasive plants not only negatively affect native species but also influence the environment, causing economic and public health damage to humans. The control and eradication of these plants is an essential strategy for the conservation of native species. In the present study, we report the first molecular-level data for the invasive plant Cortaderia selloana (pampas grass) in the Iberian Peninsula. Our results indicate that the use of microsatellites is a highly recommended tool to establish patterns of genetic variation in this invasive species. The techniques used (chloroplast DNA sequencing and microsatellites) can be the starting point for analyzing the global diversity of the species and is the prevalence and extent of local adaptation among invasive plant species in comparison to native plant species in the south of Europe. [ABSTRACT FROM AUTHOR]

Monogenea is a class of ectoparasitic flatworms on the skin, gills, or fins of fish. Microcotylidae is a family of polyopisthocotylean monogeneans parasitising only marine fishes. This work describes and taxonomically determines a microcotylid polyopisthocotylean monogenean in an important fish in Saudi aquaculture.

Objective: Acute Myeloid Leukemia (AML) and Acute Lymphoblastic Leukemia (ALL) are clinically and biologically diverse phenotypic diseases amongst hematological malignancies. The current study objectives were to diagnose and classify cases of AL as per revised 4th edition of WHO 2016 classification of AL's and study their clinicopathological profiles. Material and Method: This cross-sectional, observational study included 68 patients, diagnosed with AL were recruited. Diagnosis was based on peripheral blood smear examination, bone marrow aspiration, flowcytometry, and cytogenetic and molecular studies. Results: Sixty-eight cases of AL were diagnosed in a period of 2 years, where 25 cases were of ALL and 43 cases were of AML. In the subclassification of AML as per WHO 2016, 20 cases were of AML, RGA, 21 cases were of AML, NOS, and 2 cases were of AML, MRC. In AML, RGA, APL with PML-RARA positive cases were 10 out of 20 cases, AML with (8;21) RUNX1-RUNX1T1 were 7/20 cases; there were two cases of AML with mutated NPM1 gene and one case of AML with biallelic mutation of CEBPA. In AML, NOS subcategory AML with maturation was more common with 9/21cases. In subcategory of ALL, B-ALL was more common than T-ALL. B-ALL, NOS was more common than B-ALL, RGA and we had 1 case of NK cell Leukemia. Conclusion: The application of revised 4th edition WHO 2016 classification confers uniformity in reporting acute leukemia cases that aids in the treatment by using targeted therapies and helps in the prediction of prognosis. The WHO classification for acute leukemias is very objective, therapy oriented and the need of the hour. [ABSTRACT FROM AUTHOR]

BACKGROUND: Anaplasmosis is caused by an obligate intracellular, gram-negative microorganism, which belongs to the family Anaplasmatacea and can be transmitted by ticks and other arthropods. OBJECTIVES: The present study aimed to investigate the status of Anaplasma spp. infection by microscopy and molecular methods in dromedary camels in Bushehr province, Iran. METHODS: A total of 139 blood samples were collected from dromedary camels in Bushehr province. Giemsa staining and nested-polymerase chain reaction (PCR) were conducted to detect Anaplasma infection in the dromedary camels. RESULTS: We found that 27 (19.4%) out of the total 139 blood samples were suspected for the presence of Anaplasma spp. by morphological study. The PCR and nested-PCR sequencing results showed 111 (80%) and 134 (96%) samples positive for Anaplasma spp. and BLAST search in NCBI GenBank presented 100% identity with Candidatus Anaplasma camelii. CONCLUSIONS: The molecular results presented the high frequency of Candidatus Anaplasma camelii in camels, in Bushehr city. [ABSTRACT FROM AUTHOR]