Search

Abstract Aim Dengue virus (DENV) and Chikungunya virus (CHIKV) are the most common arthropod-borne viruses (Arboviruses) globally. So far, no autochthonous cases of DENV and CHIKV infections have been reported in Iran. Nevertheless, due to the recent identification of Aedes aegypti in the south and Aedes albopictus in the north of Iran, the country is at a serious risk of local outbreaks of these infections. Methods Between 2020 and 2023, a comprehensive cross-sectional study was conducted to explore the anti-DENV and CHIKV IgG antibodies in the general populations of both southern and northern regions of Iran using ELISA. Results A total of 11,192 participants were included, of whom 2.3% (256 individuals) and 0.1% (11 cases) were DENV seropositive and CHIK seropositive, respectively. Across the eight examined provinces, Sistan and Baluchestan province displayed the highest prevalence of dengue seropositive cases (6.80%) (P

Abstract Background Crimean-Congo haemorrhagic fever (CCHF) is a lethal acute viral zoonosis with a case fatality rate of 5–50%. Due to the potential of human-to human transmission of the disease, healthcare workers (HCWs) are at risk of occupational exposure to CCHF virus. Little is known about CCHF virus route of transmission and risks in Iranian HCWs. Therefore this study was designed to identify the routes of exposure to the CCHF virus among Iranian HCWs. Methods From Oct 2000 to Feb 2023, 96 CCHF suspected healthcare workers referred to national reference laboratory were tested for CCHF virus infection by the use of RT-PCR and IgM Capture Enzyme-Linked Immunosorbent Assay (MAC-ELISA) and exposure history of cases were investigated to determine the CCHF virus routes of transmission in nosocomial settings. Results Twelve CCHF confirmed cases were identified including seven nurses and five physicians, with the median age of 32.5 years (range 23–53 years) and the median incubation period of 6.8 days (range from 1 to 22 days). None of the cases reported a history of tick bite or close contact with tissues or animal blood. The cases were from Razavi Khorasan (seven cases), Sistan and Baluchistan (two cases), Isfahan (one case), South Khorasan (one case) and Fars (one case). Percutaneous exposure (needle stick) (three cases), mucosal exposure (blood splash in to face) (three cases) and skin contact with blood (three cases) constituted the most prevalent routes of transmission. Since 2013, no CCHF cases have been identified among Iranian HCWs. Conclusions In healthcare settings, physicians and nurses are at risk of nosocomial CCHF virus infection. The routes of transmission mainly include direct exposures via needle-stick, mucosal or direct contact with the skin to infected blood. Continuous education and implementation of infection prevention and control measures are key factors to minimize the incidence of healthcare related CCHF.

Little is known about using noninvasive samples for diagnosing Crimean-Congo hemorrhagic fever (CCHF). We investigated detection of CCHF virus in serum, saliva, and urine samples. Our results indicate that serum is the best sample type for CCHF diagnosis; saliva can be used for noninvasive sampling.

Objectives: Crimean-Congo Hemorrhagic Fever (CCHF) is a tick-borne zoonotic viral disease that could be a public health concern. The overlapping of clinical symptoms of some acute bacterial febrile diseases with CCHF is of importance for clinical diagnosis. This study aimed to molecularly examination of Brucella, Coxiella burnetii, Borrelia, and Ehrlichia infections among individuals suspected of CCHF in Iran. Methods: In this study, 260 serum samples of suspected cases of CCHF with definitively negative laboratory test results for CCHF virus infection, were examined for Brucella spp., Coxiella burnetii, Borrelia spp., and Ehrlichia spp. by Real-time PCR. Results: According to the results, 3.46 % and 3.07 % of the patients were positive for brucellosis and Q fever, respectively. Notably, no cases of borreliosis or ehrlichiosis were detected. Among the positive cases for brucellosis (N = 9), three cases were identified as Brucella abortus infection. Individuals under the age of 43 displayed a significantly higher positivity rate for Q fever (p

Abstract The coronavirus disease of 2019 (COVID-19) resulted from an infection by severe acute respiratory syndrome coronavirus 2 (SARS‑CoV‑2) which is the main cause of acute respiratory distress syndrome (ARDS) in global population from 2019 on. It may contribute to higher rate of death among the patients with immunodeficiency based on recent reports. In addition, Good syndrome (GS) as a result of thymoma removal might cause in some long-lasting microbial infections. We described clinical aspects and viral mutations on a case of GS suffering from COVID-19. A 46-year-old man with fever, common respiratory disease symptoms and positive COVID-19 polymerase chain reaction (PCR) test, with the history of thymoma removal surgery was admitted to Masih Daneshvari Hospital, Tehran, Iran. Lung radiographs and oxygen saturation measurement disclosed considerable implication resulted in application of several anti-microbial medication. The delta variant (B.1.617.2 (21 J Clade)) was the strain isolated from the patient by sequencing methods done by the COVID-19 National Reference Laboratory (CNRL), Pasteur Institute of Iran, while the dominant strain circulated mostly among population was Omicron (B.1.1.529) at the time of sampling. Unfortunately, the patient had passed away a month later by sudden respiratory failure progressed in refractory septic shock. Despite the fact that opportunistic infections may lead the GS patients to a major health problematic condition, unusual persistent of infections such as non-dominant variant of SARS-Cov-2 could be observed through the disease timeline. Therefore, a fully screening of thymoma plus intra-host evolution monitoring of SARS-CoV-2 is highly recommended in immunocompromised patients.

ABSTRACTRecent epidemiological studies documented an alarming increase in the prevalence of echinocandin-resistant (ECR) Candida glabrata blood isolates. ECR isolates are known to arise from a minor subpopulation of a clonal population, termed echinocandin persisters. Although it is believed that isolates with a higher echinocandin persistence (ECP) are more likely to develop ECR, the implication of ECP needs to be better understood. Moreover, replacing laborious and time-consuming traditional approaches to determine ECP levels with rapid, convenient, and reliable tools is imperative to advance our understanding of this emerging concept in clinical practice. Herein, using extensive ex vivo and in vivo systemic infection models, we showed that high ECP isolates are less effectively cleared by micafungin treatment and exclusively give rise to ECR colonies. Additionally, we developed a flow cytometry-based tool that takes advantage of a SYTOX-based assay for the stratification of ECP levels. Once challenged with various collections of echinocandin-susceptible blood isolates, our assay reliably differentiated ECP levels in vitro and predicted ECP levels in real time under ex vivo and in vivo conditions when compared to traditional methods relying on colony-forming unit counting. Given the high and low ECP predictive values of 92.3% and 82.3%, respectively, our assay showed a high agreement with traditional approach. Collectively, our study supports the concept of ECP level determination in clinical settings and provides a robust tool scalable for high-throughput settings. Application of this tool facilitates the interrogation of mutant and drug libraries to further our understanding of persister biology and designing anti-persister therapeutics.IMPORTANCECandida glabrata is a prevalent fungal pathogen able to replicate inside macrophages and rapidly develop resistance against frontline antifungal echinocandins. Multiple studies have shown that echinocandin resistance is fueled by the survival of a small subpopulation of susceptible cells surviving lethal concentrations of echinocandins. Importantly, bacterial pathogens that exhibit high antibiotic persistence also impose a high burden and generate more antibiotic-resistant colonies. Nonetheless, the implications of echinocandin persistence (ECP) among the clinical isolates of C. glabrata have not been defined. Additionally, ECP level determination relies on a laborious and time-consuming method, which is prone to high variation. By exploiting in vivo systemic infection and ex vivo models, we showed that C. glabrata isolates with a higher ECP are associated with a higher burden and more likely develop echinocandin resistance upon micafungin treatment. Additionally, we developed an assay that reliably determines ECP levels in real time. Therefore, our study identified C. glabrata isolates displaying high ECP levels as important entities and provided a reliable and convenient tool for measuring echinocandin persistence, which is extendable to other fungal and bacterial pathogens.

Abstract Background To improve the patient care, public health surveillance, and infection control, it is crucial to identify the presence and frequency of the common respiratory infections in individuals with COVID-19 symptoms but tested negative for SARS-CoV-2. This study aimed to shed light on this during the COVID-19 pandemic in Iran. Methods In this cross-sectional study, a total of 1,002 patients with acute respiratory infection who had negative SARS-CoV-2 test results and referred to Valfajr Health Center, the National Collaborating Laboratory of Influenza and COVID-19 National Reference Laboratory at Pasteur Institute of Iran were recruited between January 2020 and January 2022. Nasopharyngeal and oropharyngeal swab samples were collected to detect 17 common respiratory viruses via TaqMan one-step real-time multiplex PCR. Demographic and clinical data of the participants were obtained from their electronic medical records. Results In total, 218 samples (21.8%) were tested positive for at least one respiratory virus infection. Most of the common investigated respiratory viruses belonged to the years 2020 and 2022. The number of investigated patients in 2021 was few, which highlights the impact of health measures following the COVID-19 pandemic in Iran. Influenza A was the most common virus (5.8%), while adenovirus had the lowest prevalence (0.1%). Although the rate of respiratory virus infection was higher in men (24%) compared to women (19.3%), this difference was not statistically significant (P = 0.069). The prevalence of respiratory viruses had an inverse association with increasing age, with the highest rate (55.6%) observed in the age group below 2 years and the lowest rate (12.7%) in those above 65 years. Conclusion Our findings underscore the significance of adopting a comprehensive approach to respiratory infections detection and management. These results can be employed for the development of syndromic surveillance systems and implementation of the effective infection control measures. Furthermore, the results contribute to better understanding of the dynamics of respiratory viruses, both during pandemic periods and in non-pandemic contexts.

Abstract The optimal booster vaccine schedule against COVID-19 is still being explored. The present study aimed at assessment of the immunogenicity and antibody persistency of inactivated-virus based vaccine, BBIP-CorV and protein-subunit based vaccines, PastoCovac/Plus through heterologous and homologous prime-boost vaccination. Totally, 214 individuals who were previously primed with BBIBP-CorV vaccines were divided into three arms on their choice as heterologous regimens BBIBP-CorV/PastoCovac (n = 68), BBIBP-CorV/PastoCovac Plus (n = 72) and homologous BBIBP-CorV (n = 74). PastoCovac booster recipients achieved the highest rate of anti-Spike IgG titer rise with a fourfold rise in 50% of the group. Anti-RBD IgG and neutralizing antibody mean rise and fold rise were almost similar between the PastoCovac and PastoCovac Plus booster receivers. The antibody durability results indicated that the generated antibodies were persistent until day 180 in all three groups. Nevertheless, a higher rate of antibody titer was seen in the heterologous regimen compared to BBIP-CorV group. Furthermore, no serious adverse event was recorded. The protein subunit-based booster led to a stronger humoral immune response in comparison with the BBIP-CorV booster receivers. Both the protein subunit boosters neutralized SARS-CoV-2 significantly more than BBIP-CorV. Notably, PastoCovac protein subunit-based vaccine could be successfully applied as a booster with convenient immunogenicity and safety profile.

Abstract Introduction. The rapid emergence of SARS-CoV-2 variants and their potential to endangering the global health, has increased the demand for a fast-tracking method in comparison to the Next-Generation-Sequencing (NGS) as a gold standard assay, particularly in developing countries. This study was designed to evaluate the performance of a commercial multiplex Real-Time PCR technique (GA SARS-CoV-2 OneStep RT-PCR Kit, Iran) for identification of SARS-CoV-2 variants of concern compared to Oxford Nanopore Next-Generation-Sequencing assay. Methods. A total of 238 SARS-CoV-2 positive respiratory samples from different waves of COVID-19 in Iran were randomly selected in this study. To determine the SARS-CoV-2 VOC, the samples were analyzed via the commercial triple target assay, GA SARS-CoV-2 OneStep RT-PCR Kit, and NGS as well. Results. The results revealed good concordance between GA SARS-CoV-2 OneStep RT-PCR Kit and NGS for identification of SARS-CoV-2 VOCs. GA SARS-CoV-2 OneStep RT-PCR Kit identified Wuhan, Alpha and Delta variants with 100% relative sensitivity and specificity. Regarding Omicron subvariants of BA.1, BA.2 and BA.4/5 the relative sensitivity of 100%, 100% and 81.5% and the relative specificity of 95.3%, 93.5%, and 100% were observed. Discussion/Conclusion. Overall, GA SARS-CoV-2 OneStep RT-PCR Kit can be used as a rapid and cost-effective alternative to NGS for identification of SARS-CoV-2 VOCs.

COVID-19 pandemic has been managed through global vaccination programs. However, the antibody waning in various types of vaccines came to notice. Hereby, PastoCovac Plus as a protein subunit vaccine was investigated in immunized health care workers by COVAXIN (BBV152). The booster vaccine was recommended at least three months post the second dose of COVAXIN. Sera collection was done before and after each injection. SARS-CoV-2 PCR test was done monthly to detect any asymptomatic and symptomatic vaccine breakthrough.47.9 and 24.3% of the participants were seronegative for anti-N and anti-S antibodies three months after the second dose of COVAXIN, respectively. On average, fold-rises of 70, 93, 8 and mean-rises of 23.32, 892.4, 5.59 were recorded regarding neutralizing antibody, quantitative and semi-quantitative anti-Spike antibody, respectively. Anti-Spike and neutralizing antibodies seroconversion was seen 59.3% and 45.7%, respectively. The vaccine breakthrough assessment showed that all the isolated samples belonged to SARS-CoV-2 Delta variant. PastoCovac Plus boosting is strongly recommended in combination with inactivated vaccine platforms against SARS-CoV-2.

Background: Aedes mosquitoes transmit important arboviral diseases such as dengue to humans. This study was conducted to determine dengue virus infection in Aedes mosquitoes, emphasizing Aedes aegypti by Reverse Transcriptase-Polymerase Chain Reaction Assay from different regions in Southern Iran.Methods: Aedes samples were collected by standard methods from different habitats of Hormozgan province, Southern Iran, in 2016-2017, and identified by morphological characteristics. In this study, TissueLyserII was used to homogenize the collected mosquitoes. In addition, the RT-PCR technique was used to identify dengue virus RNA.Results: Overall, 1351 larval and adult Aedes mosquitoes were collected from five sites in Hormozgan Province, including 452 adults and 899 larvae. Five species from Aedes genera were collected (Ae. aegypti, Ae. vittatus, Ae. caballus, Ae. caspius, Ae. vexans). The investigations of dengue virus infection in Aedes mosquitoes showed no dengue virus infection in this species.Conclusion: This study provides important information about Aedes mosquitoes. Vector control strategies must be emphasized and prioritized. Such actions prevent the establishment of Aedes mosquitoes and the spread of arboviral diseases in new areas. In addition, early detection of arboviruses in vectors and entomological monitoring can enhance the control measures for arbovirus diseases.

Background: Understanding the microbiota of disease vectors can help for developing new strategies to prevent the transmis­sion of vector pathogens. Ixodes ricinus is one of the most notorious tick vectors with increasing importance in Iran and other parts of the world while there is limited data on its microbiota. This study aimed to use metagenomics for identifying the I. ricinus tick’s microbiota of Iran. Methods: A total of 39 adult ticks were collected from Mazandaran (21 females), Gilan (17 females), and Golestan (1 male). Five tick pools prepared from 39 adults of I. ricinus were subjected to metagenomics analysis. The data were analyzed by targeting the V6 region of the 16S rRNA gene by Illumina 4000 Hiseq sequencing. Results: Among hundreds of intestinal microbiota identified by metagenomics, various pathogenic microorganisms distributed in 30 genera and species including those responsible for tick-borne diseases resided in the genera Coxiella, Rickettsia, and Burkholderia were found. Conclusion: Our results indicated that metagenomics identifies bacteria genera and species which cannot be easily rec­ognized by routine methods. The presence of such pathogenic bacteria indicates the importance of possible zoonotic diseases in this region which could affect public health. These results further substantiate the importance of advanced metagenomics analyses to identify neglected tick-borne pathogens which enable researchers to provide efficient mapping roads for the management of emerging and re-emerging infectious diseases.

Objectives In 2019, COVID-19 emerged in China and has since spread worldwide. Owing to the virus’s ability to adhere to specific receptors, cats are susceptible to infection with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). The popularity of pet cats in Iran has sparked fears of human–cat–human transmission of the virus. This study aimed to identify positive cases in cats owned by people infected with SARS-CoV-2, to determine if they remained positive for >3 weeks and to examine the virus genome isolated from a number of cats and one of their owners. Methods A total of 30 cats were sampled approximately 3 days after their owners tested positive (day 1), and 3 weeks later, in strict accordance with health regulations. Rectal and oropharyngeal samples were collected. All samples were subjected to a qualitative PCR and reverse transcription PCR. The S -gene region was partially sequenced in positive samples and the results were used to create a phylogenetic tree. Results SARS-CoV-2 was detected in 7/30 (23.3%) cats examined. In the third week, every cat tested negative. The sequence data of positive cats and one of their owners revealed that the retrieved RNAs belonged to the alpha variation. The genetic distance between the samples and the reference sequence (20I/B.1.1.7: OM003849, MZ344997) was minimal, with a 99% similarity. Positive samples of cats had four mutations in gene S . Amino acid substitutions in the spike glycoprotein at positions N501Y, A570D, D614G and P681H were recorded in the isolates compared with 780 other sequences of Iranian strains. Conclusions and relevance This study confirmed the presence of SARS-CoV-2-infected cats living in close contact with infected owners. Despite cats’ susceptibility to COVID-19, the risk of severe infection in these animals is low, as evidenced by the lack of clinical signs in positive cats.

Background Countries in the World Health Organization (WHO) Eastern Mediterranean Region (EMR) are predisposed to highly contagious, severe and fatal, emerging infectious diseases (EIDs), and re-emerging infectious diseases (RIDs). This paper reviews the epidemiological situation of EIDs and RIDs of global concern in the EMR between 2001 and 2018. Methods To do a narrative review, a complete list of studies in the field was we prepared following a systematic search approach. Studies that were purposively reviewed were identified to summarize the epidemiological situation of each targeted disease. A comprehensive search of all published studies on EIDs and RIDs between 2001 and 2018 was carried out through search engines including Medline, Web of Science, Scopus, Google Scholar, and ScienceDirect. Results Leishmaniasis, hepatitis A virus (HAV) and hepatitis E virus (HEV) are reported from all countries in the region. Chikungunya, Crimean Congo hemorrhagic fever (CCHF), dengue fever, and H5N1 have been increasing in number, frequency, and expanding in their geographic distribution. Middle East respiratory syndrome (MERS), which was reported in this region in 2012 is still a public health concern. There are challenges to control cholera, diphtheria, leishmaniasis, measles, and poliomyelitis in some of the countries. Moreover, Alkhurma hemorrhagic fever (AHF), and Rift Valley fever (RVF) are limited to some countries in the region. Also, there is little information about the real situation of the plague, Q fever, and tularemia. Conclusion EIDs and RIDs are prevalent in most countries in the region and could further spread within the region. It is crucial to improve regional capacities and capabilities in preventing and responding to disease outbreaks with adequate resources and expertise.

We report a label-free method for detection of the SARS-CoV-2 virus in nasopharyngeal swab samples without purification steps and multiplication of the target which simplifies and expedites the analysis process. The kit consists of a textile grid on which liquid crystals (LC) are deposited and the grid is placed in a crossed polarized microscopy. The swab samples are subsequently placed on the LCs. In the presence of a particular biomolecule, the direction of LCs changes locally based on the properties of the biomolecule and forms a particular pattern. As the swab samples are not perfectly purified, image processing and machine learning techniques are employed to detect the presence of specific molecules or quantify their concentrations in the medium. The method can differentiate negative and positive COVID-19 samples with an accuracy of 96% and also differentiate COVID-19 from influenza types A and B with an accuracy of 93%. The kit is portable, simple to manufacture, convenient to operate, cost effective, rapid and sensitive. The simplicity of the specimen processing, the speed of image acquisition, and fast diagnostic operations enable the deployment of the proposed technique for performing extensive on-spot screening of COVID-19 in public places.

Flaviviruses are arthropod-borne viruses (arboviruses) that have been recently considered among the significant public health problems in defined geographical regions. In this line, there have been vaccines approved for some flaviviruses including dengue virus (DENV), Japanese encephalitis virus (JEV), yellow fever virus (YFV), and tick-borne encephalitis virus (TBEV), although the efficiency of such vaccines thought to be questionable. Surprisingly, there are no effective vaccine for many other hazardous flaviviruses, including West Nile and Zika viruses. Furthermore, in spite of approved vaccines for some flaviviruses, for example DENV, alternative prophylactic vaccines seem to be still needed for the protection of a broader population, and it originates from the unsatisfying safety, and the efficacy of vaccines that have been introduced. Thus, adenovirus vector-based vaccine candidates are suggested to be effective, safe, and reliable. Interestingly, recent widespread use of adenovirus vector-based vaccines for the COVID-19 pandemic have highlighted the importance and feasibility of their widespread application. In this review, the applicability of adenovirus vector-based vaccines, as promising approaches to harness the diseases caused by Flaviviruses, is discussed.

In recent years, the use of informal writing in Persian has grown significantly due to the increasing expansion of cyberspace and social media and platforms, and the tendency of users to bring the written language closer to colloquial speech. But on the other hand, proper tools to process this language register are not developed very much. One of the tools for low level processing of textual data is an inflectional analyzer. However, such tools are not developed for this register yet. Informal words have their own structures, stems, morphemes and clitics and they also make use of formal structures and units. Moreover, this register also consists of formal words so any analyzer for informal words should have the potential to analyze formal words, too. In this paper, it is tried to cover all inflectional structures of informal Persian language to build an inflectional analyzer. A corpus of most of its known sub-registers is constructed to extract words, morphemes and inflectional rules and morphotactics. A part of this corpus is used for testing the analyzer. After extracting 1786 unique words of the test part, inflectional analyzer f-measure is equal to 97.67%. This tool can be used in computational processing of Persian language and it can also be used in teaching Persian, specifically colloquial Persian to non-Persian learners.

Abstract Crimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease. The widespread geographic distribution of the disease and the increase in the incidence of the disease from new regions, placed CCHF in a list of public health emergency contexts. The rapid diagnosis, in rural and remote areas where the majority of cases occur, is essential for patient management. Aptamers are considered as a specific and sensitive tool for being used in rapid diagnostic methods. The Nucleoprotein (NP) of the CCHF virus (CCHFV) was selected as the target for the isolation of aptamers based on its abundance and conservative structure, among other viral proteins. A total of 120 aptamers were obtained through 9 rounds of SELEX (Systematic Evolution of Ligands by Exponential Enrichment) from the ssDNA aptamer library, including the random 40-nucleotide ssDNA region between primer binding sites (GCCTGTTGTGAGCCTCCTAAC(N40)GGGAGACAAGAATAAGCA). The KD of aptamers was calculated using the SPR technique. The Apt33 with the highest affinity to NP was selected to design the aptamer-antibody ELASA test. It successfully detected CCHF NP in the concentration of 90 ng/ml in human serum. Evaluation of aptamer-antibody ELASA with clinical samples showed 100% specificity and sensitivity of the test. This simple, specific, and the sensitive assay can be used as a rapid and early diagnosis tool, as well as the use of this aptamer in point of care test near the patient. Our results suggest that the discovered aptamer can be used in various aptamer-based rapid diagnostic tests for the diagnosis of CCHF virus infection.

Background & objectives: Crimean-Congo hemorrhagic fever (CCHF) is a tick-borne viral zoonosis with up to 50% mortality rate in humans. In addition to the role of animals in the transmission of the virus and spread of infected ticks through livestock trade, they can be employed as sentinel hosts for monitoring the infection. Iran is one of the endemic counties for CCHF and the disease has been documented in all provinces. However, in some provinces such as Kohgiluyeh and Boyer-Ahmad, the rate of the disease has been dramatically low. Therefore, this serosurvey was designed to investigate CCHF virus (CCHFV) seroprevalence among livestock in different parts of Kohgiluyeh and Boyer-Ahmad Province. Methods: This study was conducted in 2017, in which, blood samples were collected from 501 sheep and goats from eight different cities of Kohgiluyeh and Boyer-Ahmad Province. CCHFV IgG antibodies were detected in livestock serum samples by specific ELISA assays for detection of ovine and caprine antibodies. Results: In total, four sheep serum of out of 501 (0.8%) livestock samples (3 from Gachsaran and 1 from Dena) had CCHFV IgG antibodies. No significant association was found between CCHFV seropositivity and sex or age of animals (P>0.05). Interpretation & conclusion: Our findings suggest a minor CCHFV circulation in Kohgiluyeh and Boyer-Ahmad Province, Iran. However, due to the notion that outbreaks of tick-borne infections is hard to predict; steady and comprehensive monitoring programs especially in ticks and animals would be critical for understanding the circulation on the pathogen in a region.

Introduction: Crimean-Congo hemorrhagic fever (CCHF) is a tick-borne viral zoonosis with a considerable fatality rate. The virus is mainly transmitted to humans and animals through the bites of infected hard ticks belonging to the genus Hyalomma. This study aimed to determine the prevalence of CCHFV in ticks in Shahr-e Ray city, one of the meat supplier counties in Tehran Province, Iran. Methods: A molecular survey was carried out on collected ticks from sheep in slaughterhouses and husbandries of Shahr-e Ray city, during 2016-17. The ticks were identified using taxonomic characteristics, and the presence of CCHF virus RNA was investigated using an RT-PCR amplifying a 536 bp of the small segment of the viral genome. Results: The results of this study showed that the Hyalomma ticks were the dominant species in Shahr-e Ray slaughterhouses and husbandries. In none of the assayed ticks, RT-PCR detected CCHFV RNA. Conclusion: A considerable tick infestation with members of genus Hyalomma, among sheep in Shahr-e Ray slaughterhouses and husbandries, indicates the vulnerability of this county of tick-borne infections outbreaks such as CCHF. Therefore, applying acaricides and other preventive strategies should be adopted to control the tick population in Shahr-e Ray.

Abstract Background Chikungunya virus (CHIKV) is a widespread mosquito-borne virus representing a serious challenge to public health. The largest outbreak in the Middle-East was recorded in 2016–2017 in Pakistan. Sistan and Baluchistan Province of Iran shares a wide border with Pakistan; accordingly, introduction of CHIKV from Pakistan to Iran seems to be probable. The current study is aimed at investigating CHIKV infection in Sistan and Baluchistan Province. Methods Between April 2017 and June 2018, a total of 159 serum samples of CHIK suspected cases from 10 cities of Sistan and Baluchistan Province were tested by molecular and serological assays. Samples obtained up to 4 days after onset of illness were tested by real time PCR (n = 8). Samples collected 5–10 days after disease onset were subjected to ELISA, as well as real time PCR tests (n = 72). Samples obtained after the 10th day of disease onset were tested by only ELISA (n = 79). Phylogenetic analysis of real time PCR positive samples was carried out by sequencing of a 1014-bp region of Envelope 1 gene (E1 gene). Chi-square and independent t tests were used to evaluate the association between variables and CHIKV infection. Results In total, 40 (25.1%) out of 159 samples tested positive either by real time PCR or ELISA tests.Out of 151 samples serologically analyzed, 19 (12.6%) and 28 (18.6%) cases were positive for anti-CHIKV IgM and anti-CHIKV IgG antibodies, respectively. Of 80 samples tested by real time PCR, CHIKV RNA was detected in 11 (13.7%) sera, all of them had recent travel history to Pakistan. Additionally, phylogenetic analysis of 5 samples indicated their similarity with recent isolates of Pakistan outbreak 2016–2017 belonging to Indian Ocean sub-lineage of ECSA genotype. A significant correlation between abroad travel history and CHIKV infection was observed (P

Background: Crimean-Congo hemorrhagic fever (CCHF) is a neglected tick-borne viral zoonotic disease. The aim was to detect CCHF virus (CCHFV) among wild ticks from Artiodactyla, Bos taurus, Ovis aries, and Capra hircus, in a previously declared CCHFV-free province of Kohgiluyeh Boyer-Ahmad, southwest Iran. Methods: From April to November 2015, hard ticks were collected in a cross-sectional study and checked by microscope for species identity from ungulates in 51 study villages. About 55% of the ticks were then subjected to reverse-transcription polymerase chain reaction (RT-PCR) to detect CCHFV genome. Results: Overall, 859 hard ticks were captured, from which 8 different species in two genera were identified. The genus Rhipicephalus was distributed in half (#26) of the study villages. It was the most frequent (≈60%) tick genus. Hyalomma anatolicum, H. asiaticum, H. excavatum, H. marginatum, H. scupense, Rhipicephalus sanguineus, R. turanicus, and R. bursa were identified on the ruminants. From 469 adult ticks subjected to RT-PCR, one (0.2%) tick, R. bursa, was positive with CCHFV genome. It was from a cold hardy highland village in Dena County. It had CCHFV RNA for the first time from this region. Conclusion: The detection of CCHF viral RNA in one hard tick species, R. bursa, was confirmed in the southwest of Iran, thus partially indicating CCHFV presence of ticks in this region.

Temperature is one of the factors affecting plant growth. Hence, in this paper, future temperature trends in Abhar region affected by climate change during future periods was evaluated and compared with the period of observation. Plant yield in the future and different cultivation periods was later simulated and estimated through AquaCrop simulation model of plant yield. The study observation period was considered as 1986-2010 AD, near horizon 2011-2045, the average horizon 2046-2079 and 2080-2100 horizon in the current study. LARS-WG software was used in HadCM3 model and A2 scenario in order to downscale the results of general atmosphere circulation's simulation model. Furthermore, the scenario file was generated in this study. According to the results obtained, the highest yield wil be cultivated on May 26 with 46.29 tons per hectare and the lowest yield will be produced on June 5 with 40.6 tons per hectare. If we change the traditional cultivation time from May 15 to May 26, a growth of 0.28 tons per hectare will be expected. The highest yield will be on May 15 in the future. Moreover, the sorghum's yield will decrease. Lesser photosynthesis during the shorter growing season and C4 photosynthetic system of this product could be involved in this yield loss.

Background & objectives: West Nile virus (WNV) is a neurotropic Flavivirus transmitted to humans through mosquito bites. As there is no specific antiviral treatment or approved vaccine against WNV, control and prevention of the infection is the best strategy to reduce the burden of WNV-related diseases. The circulation of WNV has been indicated in several regions of Iran including the Khuzestan province. Considering the complex ecology of WNV, the latest data are necessary for the implementation of preventive measures. Therefore, the present study was designed to provide updated information on the seroepidemiology of WNV in Khuzestan province. Methods: A total of 408 sera were taken from volunteers living in Khuzestan. The presence of specific immunoglobulin G (IgG) antibody against WNV was tested by the enzyme-linked immunosorbent assay (ELISA) method. All the data and participants’ demographic information were analyzed by SPSS and Esri’s ArcMap GIS software programs. Results: Anti-WNV IgG antibody was detected in 97 (23.8%) out of the 408 tested sera. The highest seropositivity rate was observed in cases aged between 20–29 yr and the lowest seropositivity rate was seen in those

Rickettsia conorii is the causative agent of Mediterranean spotted fever (MSF). Misdiagnosis of MSF may occur with febrile syndromes associated with rash and thrombocytopenia, such as Crimean-Congo hemorrhagic fever (CCHF). This study aimed to determine the prevalence of R. conorii among serum samples obtained from 260 suspected CCHF patients with features of MSF in Iran (2018–2020). The quantitative polymerase chain reaction (qPCR) method detected three (1.15%) positive 16S rDNA Rickettsia spp. samples that were classified as R. conorii subsp. conorii, R. conorii subsp. Israelensis, and R. helvetica using the sequencing of gltA, ompA, and 17kDa genes. Furthermore, R. conorii IgM antibodies presented in 38 (14.62%) patients by the enzyme-linked immunosorbent assay (ELISA) method. Out of 97 MSF patients with available paired serum samples, IgM seroconversion and a four-fold increase were observed in 14 (14.43%) and 12 (12.37%) patients, respectively. We concluded that rickettsial agents are present in Iran and may be misdiagnosed with other febrile syndromes.

Background: Ticks are vectors of a wide variety of pathogens that can be transmitted to humans, and tick-borne diseases are a significant public health issue worldwide. The present study was carried out on the hard tick infestation of livestock transported to Rafsanjan slaughter house in the southeast of Iran. Methods: A cross-sectional survey was carried out biweekly from April to September 2016 to determine tick infestation of the meat-producing animals. All the livestock included in our study were thoroughly inspected for the presence of hard ticks on different parts of their bodies. Results: A total of 258 hard ticks were collected from the body of livestock hosts. The ticks that were sampled were classified into two genera and five species: Hyalomma marginatum, Hy. anatolicum, Hy. asiaticum, Hy. dromedarii, and Rhipicephalus sanguineus. Hyalomma dromedarii was the most abundant species in the study area. More than 50 percent of the sampled ticks were collected from the body of camels brought to the slaughter house however molecular analysis showed no Crimean Congo Hemorrhagic Fever (CCHF) virus infection in tick specimens. The Sex ratio of the sampled hard ticks shows that female tick infestation was more common among the study livestock. Conclusion: Due to the crucial role of hard ticks in the transmission of different pathogens to humans, additional investigations are necessary to determine the risk of consumption of infested meat-producing animals in the study area.

Background: West Nile Virus, a mosquito-borne flavivirus, causes a variety of symptoms in human, from asymp­tomatic infection to neuroinvasive disease. Several studies have been conducted on the seroprevalence of WNV in­fection in dif­ferent areas from Iran. This study was performed to find the presence of antiviral antibodies in human serum among some high risk population and awareness of health care staff about symptom of the WNV infection. Methods: Study performed in five geographical districts based on high population of immigrant and do­mestic birds and prevalence of the antiviral antibodies in horses which was reported previously. Totally 150 human blood sam­ples were collected during 2018. The samples collected from patients referred to the clinics. The ELISA method used to detect IgG and IgM antibody against WNV. Logistic regression models used to analyze the effect of sex, age, keeping birds and urban/rural residence on the risk of infection. The awareness of health care staff about symp­tom of infection surveyed. Results: From all blood donors, 41 samples (27.33%) showed positive to IgG antibody. From which 56.10% were males and remaining females. None of the mentioned factors had a significant relationship. Health care staff had less attention to the infection. Conclusions: Although the prevalence of antibodies was relatively high, due to the similarity to other viral diseases, health care staff had less attention to the disease. The study showed that people in these areas have been exposed to the virus. Further research activities are recommended for control of this arbovirus.

Introduction: Crimean Congo Hemorrhagic Fever (CCHF) is a fatal tick-borne viral zoonosis with a case fatality rate of 5% to 30%. CCHF has been documented as the most frequent tick-borne viral infection in Iran with more than 50 cases annually. Kerman Province in the south of Iran is one of the CCHF-endemic areas of the country, but no data on infection of ticks with this virus from this area is available. This study aimed to investigate the CCHFV infection among ticks collected from 4 different counties in this province. Methods: In 2011, a total of 203 hard ticks were collected from Kerman, Jiroft, Sirjan, and Kuhbanan counties in Kerman Province, southeast of Iran. Infection of ticks with CCHFV was investigated using RT-PCR targeting the small segment of the viral genome. Results: Out of 203 ticks, Dermacentor (50.24%) was the most frequent genus followed by Hyalomma (39.39%), Haemaphysalis (9.85%) and Rhipicephalus (0.49%). Our results showed no CCHFV infection of ticks. Conclusion: Our finding indicates no circulation of CCHFV in ticks from Kerman Province. However, as Kerman Province is an endemic region for CCHF, further investigations are needed to have a better understanding of the CCHFV vectors in this region.

Modeling the dam break phenomenon is more important in order to calculate the approximate discharge flow due to break to perform the measures to control it or to prevent the resulting hazards. In this research, Gambit software was used to generate the form and dimensions of the geometry of the laboratory model. Then, the generated geometry file was transferred to the Fluent hydraulic model. In Fluent environment, all effective parameters were determined. The VOF method was used for modeling. The case study in this research was the rocky sedimentary located near the Nowshan basin, which is located around Urmia city, and the dam break modeling was done for it in a three-dimensional characteristic. The results obtained from the laboratory conditions were compared with the results of the Fluent model, which is related to modeling the dam break phenomenon in two-dimensional form. Various wave characteristics were studied, including wave propagation, wave velocity, and water depth variation at the bottom of the dam in dry and wet bed conditions. Comparison of the results shows that the Fluent model has high accuracy in modeling the flow due to dam break. To construct the geometry of a part of the stream that includes the reservoir and the reservoir, a topographic map of the stream was used in AutoCAD environment.

Human papillomavirus (HPV) is a common viral infection worldwide associated with a variety of cancers. The integration of the HPV genome in these patients causes chromosomal instability and triggers carcinogenesis. The aim of this study was to investigate the HPV-16 genome physical status in four major cancers related to HPV infection. Formalin-fixed paraffin-embedded blocks from our previous projects on head and neck, colorectal, penile, and cervical cancers were collected, and HPV-16–positive specimens were used for further analysis. The DNA extraction copy number of E2 and E7 genes was calculated by qualitative real-time PCR method. Serially diluted standards that were cloned in PUC57 plasmid were used. Standard curve and melting curve analysis was used for quantification. Of the 672 specimens studied, 76 (11.3%) were HPV-16 positive. We found that 35.6% (16/45) were integrated. Statistical analysis showed that there were significant correlations between integration of HPV-16 and cervical cancer end-stage carcinogenesis (P < .0001), episomal form, and ASCUS lesions (P = .045). Significant correlation in penile cancer patients was seen between the episomal form and high-grade cancer stage (P = .037). Integration is a major factor in the carcinogenesis mechanism of HPV and has different prevalence in various cancers with a higher rate in progression except in penile cancer.

Due to the explosion of available information on the Internet, the need for effective means of accessing and processing them has become vital for everyone. Recommender systems have been developed to help users to find what they may be interested in and business owners to sell their products more efficiently. They have found much attention in both academia and industry. A recommender algorithm takes into account user-item interactions, i.e., rating (or purchase) history of users on items, and their contextual information, if available. It then provides a list of potential items for each target user, such that the user is likely to positively rate (or purchase) them. In this paper, we review evaluation metrics used to assess performance of recommendation algorithms. We also survey a number of classical and modern recommendation algorithms and compare their performance in terms of different evaluation metrics on five benchmark datasets. Our experiments show that there is no golden recommendation algorithm showing the best performance in all evaluation metrics. We also find large variability across the datasets. This indicates that one should carefully consider the evaluation criteria in choosing a recommendation algorithm for a particular application.

Abstract The shortest path problem is one of the most fundamental networks optimization problems. Nowadays, individuals interact in extraordinarily numerous ways through their offline and online life (e.g., co-authorship, co-workership, or retweet relation in Twitter). These interactions have two key features. First, they have a heterogeneous nature, and second, they have different strengths that are weighted based on their degree of intimacy, trustworthiness, service exchange or influence among individuals. These networks are known as multiplex networks. To our knowledge, none of the previous shortest path definitions on social interactions have properly reflected these features. In this work, we introduce a new distance measure in multiplex networks based on the concept of Pareto efficiency taking both heterogeneity and weighted nature of relations into account. We then model the problem of finding the whole set of paths as a form of multiple objective decision making and propose an exact algorithm for that. The method is evaluated on five real-world datasets to test the impact of considering weights and multiplexity in the resulting shortest paths. As an application to find the most influential nodes, we redefine the concept of betweenness centrality based on the proposed shortest paths and evaluate it on a real-world dataset from two-layer trade relation among countries between years 2000 and 2015.

Background: The impact of environmental factors and host on Hyalomma spp. community structure and abundance in the main Crimean-Congo haemorrhagic fever (CCHF) foci of Iran is largely unknown. Methods: Biotic and abiotic factors, including host, temperature, humidity, altitude, Köppen-Geiger climate types, sea­son, and precipitation on Hyalomma spp. community structure and abundances in 11 provinces of Iran were investigat­ed. Additionally, the possible infection of ticks with CCHF virus was evaluated using reverse transcription PCR tech­nique. Results: Species analyses demonstrated the presence of Hyalomma anatolicum, H. marginatum, H. dromedarii, H. asi­aticum, H. detritum and H. schulzei in the study area. Hyalomma anatolicum was the dominant species in the southern and northern parts, whereas H. dromedarii was distributed mostly in central parts of the country. The highest tick infestation was recognized in hot season. Spatial variation in tick relative density was observed between habitat types where more ticks were collected in deserts, semi-deserts, and Mediterranean habitats. Except for H. dromedarii, which was more preva­lent on camel (P= 0.044), there were no significant variations in the frequencies of other Hyalomma species on different hosts. Hyalomma anatolicum, H. dromedarii frequencies had significant positive and negative asso­ciation with tempera­ture and precipitation respectively. Also humidity has positive impact on H. asiaticum frequency. Conclusion: Data presented here will help improve ecological models to forecast the distribution of Hyalomma spp. ticks, to evaluate the risk of CCHF and other tick-borne diseases, and to design proper vector control measures to sup­press Hyalomma populations in Iran.

Background: Zika virus infection has recently attracted the attention of medical community. While clinical manifestations of the infection in adult cases are not severe and disease is not associated with high mortality rates, Zika virus infection can have an impact on fetal development and lead to severe neurodevelopmental abnormalities. Methods: To gain insight into different aspects of Zika virus infection, a comprehensive literature review was performed. With regard to epidemiology and geographical distribution of Zika virus infection, relevant information was extracted from CDC and WHO websites. Results: In this review, we discuss different basic and clinical aspects of Zika virus infection including virology, epidemiology and pathogenesis of disease. Laboratory methods required for the diagnosis of disease together with ethical issues associated with Zika virus infection will also be discussed in detail. Conclusion: Herein, we have tried to provide a multi-faceted view of Zika virus infection, with greater emphasis on disease status in Eastern Mediterranean Region.

BACKGROUND:West Nile Virus (WNV), a member of the genus Flavivirus, is one of the most widely distributed arboviruses in the world. Despite some evidence for circulation of WNV in countries summarized by the World Health Organization as the Eastern Mediterrian Regional Office (EMRO), comprehensive knowledge about its epidemiology remains largely unknown. This study aims to provide a concise review of the published literature on WNV infections in the Eastern Mediterranean Regional Office of WHO (EMRO). METHODOLOGY/PRINCIPAL FINDINGS:A systematic review of WNV prevalence studies on humans, animals and vectors in the EMRO region was performed by searching: Web of Science, Science Direct, Scopus, PubMed, Embase and Google Scholar. Finally, 77 citations were included, comprising 35 seroprevalence studies on general population (24460 individuals), 15 prevalence studies among patients (3439 individuals), 22 seroprevalence studies among animals (10309 animals), and 9 studies on vectors (184242 vector species). Of the 22 countries in this region, five had no data on WNV infection among different populations. These countries include Kuwait, Bahrain, Oman, Syria and Somalia. On the other hand, among countries with available data, WNV-specific antibodies were detected in the general population of all investigated countries including Djibouti (0.3-60%), Egypt (1-61%), Iran (0-30%), Iraq (11.6-15.1%), Jordan (8%), Lebanon (0.5-1%), Libya (2.3%), Morocco (0-18.8%), Pakistan (0.6-65.0%), Sudan (2.2-47%), and Tunisia (4.3-31.1%). WNV RNA were also detected in patient populations of Iran (1.2%), Pakistan (33.3%), and Tunisia (5.3% -15.9%). WNV-specific antibodies were also detected in a wide range of animal species. The highest seropositivity rate was observed among equids (100% in Morocco) and dogs (96% in Morocco). The highest seroprevalence among birds was seen in Tunisia (23%). In addition, WNV infection was detected in mosquitoes (Culex, and Aedes) and ticks (Argas reflexus hermanni). The primary vector of WNV (Culex pipiens s.l.) was detected in Djibouti, Egypt, Iran and Tunisia, and in mosquitoes of all these countries, WNV was demonstrated. CONCLUSIONS:This first systematic regional assessment of WNV prevalence provides evidence to support the circulation of WNV in the EMRO region as nearly all studies showed evidence of WNV infection in human as well as animal/vector populations. These findings highlight the need for continued prevention and control strategies and the collection of epidemiologic data for WNV epidemic status, especially in countries that lack reliable surveillance systems.

This paper offers an interdisciplinary study on mechanisms of homophily in virtual social network at Graduate University of Zanjan. Despite the significance of homophily, not many studies have been done on it. It is for this reason this paper sets its objective to study homophily in Iran and considers its unit of analysis to be Graduate University of Zanjan. Theoretically the paper uses a theoretical synthesis based on what homophily means in the discipline of Network Science and Technology and combines it with the concept of homophily in Communication and Sociology. Methodologically, the paper collects its data from among students at Graduate University of Zanjan during a period of 2009 and 2014. We used some interviews and set up some face-to face interviews with questionnaires in addition to observations in order to complete the data gathering. Then we calculated the number of connections with similar characteristics of individuals and subtracted them from total connections expected in a random situation so to measure homophily. Here the paper has measured characteristics or variables such as gender, graduate degree level, discipline, city of residence, marital status, and year of entering university. Some of the results indicate that students, who use social network of Graduate University of Zanjan, select their friends based on the following characteristics and in the following order: similarity in gender, marital status, degree level, discipline, year of entering university, and city of residence. Our observations indicate that religious norms play a special role in communicating with opposite sex.

Introduction: Computer games have attracted remarkable attentions in general publics with different cultures and their effects are subject of research by cognitive neuroscientists. In the present study, possible effects of the game Fifa 2015 on cognitive performance, hormonal levels, and electroencephalographic (EEG) signals were evaluated in young male volunteers. Methods: Thirty two subjects aged 20 years on average participated mutually in playing computer game Fifa 2015. Identification information and general knowledge about the game were collected. Saliva samples from the contestants were obtained before and after the competition. Perceptive and cognitive performance including the general cognitive health, response delay, attention maintenance, and mental fatigue were measured using PASAT test. EEG were recorded during the play using EEG device and analyzed later using QEEG. Simultaneously, the players’ behavior were recorded using a video camera. Saliva cortisol levels were assessed by ELISA kit. Data were analyzed by SPSS program. Results: The impact of playing computer games on cortisol concentration of saliva before and after the game showed that the amount of saliva plasma after playing the game has dropped significantly. Also the impact of playing computer games on mental health, before and after the game indicated that the number of correct answers has not changed significantly. This indicates that sustained attention has increased in participants after the game in comparison with before that. Also it is shown that mental fatigue measured by PASAT test, did not changed significantly after the game in comparison to before that. The impact of game on changes in brain waves showed that the subjects in high activity state during playing the game had higher power of the EEG signals in most of the channels in lower frequency bands in compared to normal state. Discussion: The present study showed that computer games can positively affect the stress system and the perceptual-cognitive system. Even though this impact was not significant in most cases, the changes in cognitive and hormonal test and also in brain waves were visible. Hence, due to the importance of this matter, it is necessary to create control systems in selecting the types of games for playing.

To the editor: In a recent publication entitle “Surveillance of Crimean-Congo haemorrhagic fever in Pakistan” published in “The Lancet Infectious Diseases”, the authors claimed that before the Eid al-Adha, Crimean-Congo Hemorrhagic Fever (CCHF)-livestock infected are imported from Iran and Afghanistan to Baluchistan province of Pakistan and then transferred to other areas of the country

Abstract: Nowadays, the non-traditional processes such as “LASER, EDM and AWJ” used for cutting high thickness sheet metal. Hardox is hard and tough steel alloy and it has many industrialize applications. One best process to cut the Hardox is abrasive water jet (AWJ) cutting. It can cuts complex shape with high quality and accurate tolerance. AWJ cutting offers certain unique benefits such as negligible heat affected zone, high degree of manoeuvrability in cutting process and less machining force exertion. In this research work, first, the effective cutting process “AWJ” parameters were identified. Then, to determine optimum Hardox cutting parameters, some experimental tests were undergone. Finally, the experimental results were analysed using “ANOVA” technique in order to determine regression equations for achieving optimum parameters to set-up equipment for Hardox steel cutting.