Search

Protein glycosylation plays a crucial role in central nervous system, and abnormal glycosylation has major implications for human diseases. This study aims to evaluate an etiological implication of the variation in glycosylation for Parkinson's disease (PD), a neurodegenerative disorder. Based on a PD mouse model constructed by the intraperitoneal injection with 1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine, glycosylation variation was accessed using biotinylated lectin of dolichos biflorus agglutinin (DBA) specific for the exposed N-acetylgalactosamine linked to glycoprotein. Consequently, a glycoprotein with a significantly reduced N-acetylgalactosamination was identified as ADP/ATP translocase 1 (ANT1) by lectin affinity chromatography coupled with MALDI-TOF MS/MS (mass spectrometry), and confirmed by the analysis of dual co-immunofluorescence and Western blot. A tissue-specific distribution of de-N-acetylgalactosaminated ANT1 was found to be correlated with high risk of PD. At cellular level, an obvious co-aggregation between ANT1 and DBA was only found in the MPP+-induced PD-like cell model using dual co-immunofluorescence. Thus, we found that ANT1 was a potential glycoprotein with terminal N-acetylgalactosamine moiety, and the variation of glycosylation in ANT1 was associated with PD. This investigation provides an innovative insight in protein glycosylation with PD pathogenesis. [ABSTRACT FROM AUTHOR]

Glycoside hydrolase family 31 (GH31) is a diversified family of anomer-retaining α-glycoside hydrolases, such as α-glucosidase and α-xylosidase, among others. Recently, GH31 α- N -acetylgalactosaminidases (Nag31s) have been identified to hydrolyze the core of mucin-type O -glycans and the crystal structure of a gut bacterium Enterococcus faecalis Nag31 has been reported. However, the mechanisms of substrate specificity and hydrolysis of Nag31s are not well investigated. Herein, we show that E. faecalis Nag31 has the ability to release N -acetylgalactosamine (GalNAc) from O -glycoproteins, such as fetuin and mucin, but has low activity against Tn antigen. Mutational analysis and crystal structures of the Michaelis complexes reveal that residues of the active site work in concert with their conformational changes to act on only α- N -acetylgalactosaminides. Docking simulations using GalNAc-attached peptides suggest that the enzyme mainly recognizes GalNAc and side chains of Ser/Thr, but not strictly other peptide residues. Moreover, quantum mechanics calculations indicate that the enzyme preferred p -nitrophenyl α- N -acetylgalactosaminide to Tn antigen and that the hydrolysis progresses through a conformational itinerary, 4 C 1 → 1 S 3 → 4 C 1 , in GalNAc of substrates. Our results provide novel insights into the diversification of the sugar recognition and hydrolytic mechanisms of GH31 enzymes. [Display omitted] • EfGH31 released N -acetylgalactosamine from fetuin and bovine submaxillary mucin. • Crystal structures of EfGH31 complexed with substrates were determined. • The active site residues important for hydrolysis and substrate-binding were identified. • QM calculation revealed its conformational itinerary and reactivity. [ABSTRACT FROM AUTHOR]

The aim. Experimental selection of paracetamol and N-acetyl-D-glucosamine (NAG) ratio and combined dose and bioavailability study of the pharmaceutical composition and active pharmaceutical ingredient (API) in the model of cell biomembranes. Materials and methods. The following substances were used: paracetamol, Actimask Acetaminophen (gelatin-coated paracetamol), and NAG. For pharmacological studies were used laboratory rats, which received test objects intragastrically. The study was performed on the model of inflammatory hyperalgesia according to the Randall-Selitto method. The values of pain threshold before and after pathology induction were established. For biopharmaceutical studies, dry L-α-dimyristoylphosphatidylcholine purchased from Avanti Polar Lipids (purity 99.9 %) was used, hydrated with an appropriate amount of double-distilled water to obtain 70 % wt./wt. water dispersion. Differential scanning calorimetry (DSC) studies were performed employing DSC 1 microcalorimeter (Mettler Toledo). Pharmaceuticals investigated were placed on the bottom of a crucible, then a proper amount of the lipid membrane was added and this moment was taken as the time reference point (t=0). Then a crucible was sealed with a lid and a sample was undergone consecutive temperature scans, heating from 0 to 35 ºC at a scanning rate of 2 ºC/min. The procedure was repeated until no more changes in DSC profiles were observed, i.e. system equilibrium was reached. Results. It has been experimentally proven that the combination of paracetamol and NAG in the ratio of 4:1 showed better analgesic efficacy. The dose of active ingredients was determined to be 50 mg/kg by the sum of API. The active interaction of paracetamol with the bilayer of biomembranes was established and it was determined that Actimask has a worse rate of penetration into the membrane due to the coating of paracetamol with a gelatin shell. NAG didn't significantly affect the rate of penetration of Actimask through the bilayer of membranes, but the auxiliary components of the tablet mixture significantly improved the rate and completeness of penetration of paracetamol through the bilayer of biomembranes. Conclusions. The study found the most effective ratio between paracetamol and NAG in the composition, which is 4:1. The next step was to determine the dose of API, which is 50 mg/kg of the sum of active substances. It has been determined that paracetamol has good permeability through the bilayer of biomembranes, and the tablet mass significantly improves the permeability of paracetamol. [ABSTRACT FROM AUTHOR]

Negative ion collision-induced dissociation (CID) of underivatized N-glycans has proved to be a simple, yet powerful method for their structural determination. Recently, we have identified a series of such structures with GalNAc rather than the more common galactose capping the antennae of hybrid and complex glycans. As part of a series of publications describing the negative ion fragmentation of different types of N-glycan, this paper describes their CID spectra and estimated nitrogen cross sections recorded by travelling wave ion mobility mass spectrometry (TWIMS). Most of the glycans were derived from the recombinant glycoproteins gp120 and gp41 from the human immunodeficiency virus (HIV), recombinantly derived from human embryonic kidney (HEK 293T) cells. Twenty-six GalNAc-capped hybrid and complex N-glycans were identified by a combination of TWIMS, negative ion CID, and exoglycosidase digestions. They were present as the neutral glycans and their sulfated and α2→3-linked sialylated analogues. Overall, negative ion fragmentation of glycans generates fingerprints that reveal their structural identity. [ABSTRACT FROM AUTHOR]

N -glycosylated proteins produced in human embryonic kidney 293 (HEK 293) cells often carry terminal N -acetylgalactosamine (GalNAc) and only low levels of sialylation. On therapeutic proteins, such N -glycans often trigger rapid clearance from the patient's bloodstream via efficient binding to asialoglycoprotein receptor (ASGP-R) and mannose receptor (MR). This currently limits the use of HEK 293 cells for therapeutic protein production. To eliminate terminal GalNAc, we knocked-out GalNAc transferases B4GALNT3 and B4GALNT4 by CRISPR/Cas9 in FreeStyle 293-F cells. The resulting cell line produced a coagulation factor VII-albumin fusion protein without GalNAc but with increased sialylation. This glyco-engineered protein bound less efficiently to both the ASGP-R and MR in vitro and it showed improved recovery, terminal half-life and area under the curve in pharmacokinetic rat experiments. By overexpressing sialyltransferases ST6GAL1 and ST3GAL6 in B4GALNT3 and B4GALNT4 knock-out cells, we further increased factor VII-albumin sialylation; for ST6GAL1 even to the level of human plasma-derived factor VII. Simultaneous knock-out of B4GALNT3 and B4GALNT4 and overexpression of ST6GAL1 further lowered factor VII-albumin binding to ASGP-R and MR. This novel glyco-engineered cell line is well-suited for the production of factor VII-albumin and presumably other therapeutic proteins with fully human N -glycosylation and superior pharmacokinetic properties. [ABSTRACT FROM AUTHOR]

[Display omitted] • Glycan-lectin interactions between Neoparamoeba perurans and the host were explored. • Glycan and lectin arrays were employed in amoeba and gill cells, respectively. • A series of glycans bound by the amoeba were also detected on gill epithelial cells. • Mannobiose and N -acetylgalactosamine showed the strongest binding affinity. • Increased binding was seen on mannobiose and N -acetylgalactosamine-coated surfaces. One of the first critical steps in the pathogenesis of amoebic gill disease (AGD) of farmed salmon is the adhesion of the causative amoeba to the host. The current study aimed to investigate the potential involvement of glycan-binding proteins expressed on the extracellular surface of Neoparamoeba perurans in gill tissue recognition and binding. The glycan-binding properties of the surface membrane of N. perurans and the carbohydrate binding profile of Atlantic salmon gill-derived epithelial cells were identified through the use of glycan and lectin microarrays, respectively. The occurrence of specific carbohydrate-mediated binding was then further assessed by in vitro attachment assays using microtitre plates pre-coated with the main glycan candidates. Adhesion assays were also performed in the presence of exogenous saccharides with the aim of blocking glycan-specific binding activity. Comparative analysis of the results from both lectin and glycan arrays showed significant overlap, as some glycans to which binding by the amoeba was seen were reflected as being present on the gill epithelial cells. The two main candidates proposed to be involved in amoeba attachment to the gills are mannobiose and N -acetylgalactosamine (GalNAc). Adhesion of amoebae significantly increased by 33.5 and 23% when cells were added to α1,3-Mannobiose-BSA and GalNAc-BSA coated plates. The observed increased in attachment was significantly reduced when the amoebae were incubated with exogenous glycans, further demonstrating the presence of mannobiose- and GalNAc-binding sites on the surfaces of the cells. We believe this study provides the first evidence for the presence of a highly specific carbohydrate recognition and binding system in N. perurans. These preliminary findings could be of extreme importance given that AGD is an external parasitic infestation and much of the current research on the development of alternative treatment strategies relies on either instant amoeba detachment or blocking parasite attachment. [ABSTRACT FROM AUTHOR]

Polypeptide N -acetylgalactosamine transferase 9 (GALNT9) catalyzes the initial step of mucin-type O-glycosylation via linking N -acetylgalactosamine (GalNAc) to serine/threonine in a protein. To unravel the association of GALNT9 with Parkinson's disease (PD), a progressive neurodegenerative disorder, GALNT9 levels were evaluated in the patients with PD and mice treated with 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine, and statistically analyzed based on the GEO datasets of GSE114918 and GSE216281. Glycoproteins with exposing GalNAc were purified using lectin affinity chromatography and identified by LC-MS/MS. The influence of GALNT9 on cells was evaluated via introducing a GALNT9 -specific siRNA into SH-SY5Y cells. Consequently, GALNT9 deficiency was found to occur under PD conditions. GALNT9 silencing contributed to a causative factor in PD pathogenesis via reducing the levels of intracellular dopamine, tyrosine hydroxylase and soluble α-synuclein, and promoting α-synuclein aggregates. MS identification revealed 14 glycoproteins. 5 glycoproteins, including ACO 2 , ATP5B, CKB, CKMT1A, ALDOC, were associated with energy metabolism. GALNT9 silencing resulted in mitochondrial dysfunctions via increasing ROS accumulation, mitochondrial membrane depolarization, mPTPs opening, Ca2+ releasing and activation of the CytC-related apoptotic pathway. The dysfunctional mitochondria then triggered mitophagy, possibly intermediated by adenine nucleotide translocase 1. Our study suggests that GALNT9 is potentially developed into an auxiliary diagnostic index and therapeutic target of PD. • GALNT9 deficiency occurred under PD conditions. • Fourteen glycoproteins with terminal GalNAc were identified, and most of them were associated with energy metabolism. • GALNT9 silencing was a causative factor for PD since it reduced the levels of DA and TH, promoted α-synuclein depositions. • GALNT9 silencing led to mitochondrial dysfunctions via increasing ROSgeneration, △Ψm , mPTPopening, and Ca2+ releasing. [ABSTRACT FROM AUTHOR]

The development of oligonucleotide conjugates for in vivo targeting is one of the most exciting areas for oligonucleotide therapeutics. A major breakthrough in this field was the development of multifunctional GalNAc-oligonucleotides with high affinity to asialoglycoprotein receptors (ASGPR) that directed therapeutic oligonucleotides to hepatocytes. In the present study, we explore the use of G-rich sequences functionalized with one unit of GalNAc at the 3′-end for the formation of tetrameric GalNAc nanostructures upon formation of a parallel G-quadruplex. These compounds are expected to facilitate the synthetic protocols by providing the multifunctionality needed for the binding to ASGPR. To this end, several G-rich oligonucleotides carrying a TGGGGGGT sequence at the 3′-end functionalized with one molecule of N-acetylgalactosamine (GalNAc) were synthesized together with appropriate control sequences. The formation of a self-assembled parallel G-quadruplex was confirmed through various biophysical techniques such as circular dichroism, nuclear magnetic resonance, polyacrylamide electrophoresis and denaturation curves. Binding experiments to ASGPR show that the size and the relative position of the therapeutic cargo are critical for the binding of these nanostructures. The biological properties of the resulting parallel G-quadruplex were evaluated demonstrating the absence of the toxicity in cell lines. The internalization preferences of GalNAc-quadruplexes to hepatic cells were also demonstrated as well as the enhancement of the luciferase inhibition using the luciferase assay in HepG2 cell lines versus HeLa cells. All together, we demonstrate that tetramerization of G-rich oligonucleotide is a novel and simple route to obtain the beneficial effects of multivalent N-acetylgalactosamine functionalization.

In recent years, mesoporous silica particles have been revealed as promising drug delivery systems combining high drug loading capacity, excellent biocompatibility, and easy and affordable synthetic and post-synthetic procedures. In fact, the straightforward functionalization approaches of these particles allow their conjugation with targeting moieties in order to surpass one of the major challenges in drug administration, the absence of targeting ability of free drugs that reduces their therapeutic efficacy and causes undesired side effects. In this context, the main goal of this work was to develop a new targeted mesoporous silica nanoparticle formulation with the capability to specifically and efficiently deliver an anticancer drug to hepatocellular carcinoma (HCC) cells. To this purpose, and as proof of concept, we developed redox-responsive mesoporous silica nanoparticles functionalized with the targeting ligand triantennary N-acetylgalactosamine (GalNAc) cluster, which has high affinity to asialoglycoprotein receptors overexpressed in HCC cells, and loaded them with epirubicin, an anthracycline drug. The produced nanocarrier exhibits suitable physicochemical properties for drug delivery, high drug loading capacity, high biocompatibility, and targeting ability to HCC cells, revealing its biopharmaceutical potential as a targeted drug carrier for therapeutic applications in liver diseases.

N-Glycosylation is one of the most important post-translational protein modifications in eukaryotic cells. Although more than 200 N-glycogenes contributing to N-glycan biosynthesis have been identified and characterized, the information on insect N-glycosylation is still limited. Here, focusing on insect N-glycosylation, we characterized Bombyx mori N-acetylgalactosaminyltransferase (BmGalNAcT) participating in complex N-glycan biosynthesis in mammals. BmGalNAcT localized at the Golgi and was ubiquitously expressed in every organ and in the developmental stage of the middle silk gland of fifth instar larvae. Analysis of recombinant BmGalNAcT expressed in Sf9 cells showed that BmGalNAcT transferred GalNAc to non-reducing terminals of GlcNAcβ1,2-R with β1,4-linkage. In addition, BmGalNAcT mediated transfer of galactose and N-acetylglucosamine residues but not transfer of either glucose or glucuronic acid from the UDP-sugar donor substrate to the N-glycan. Despite this tri-functional sugar transfer activity, however, most of the endogenous glycoproteins of insect cells were present without GalNAc, Gal, or GlcNAc residues at the non-reducing terminal of β1,2-GlcNAc residue(s). Moreover, overexpression of BmGalNAcT in insect cells had no effect on N-acetylgalactosaminylation, galactosylation, or N-acetylglucosaminylation of the major N-glycan during biosynthesis. These results suggested that B. mori has a novel multifunctional glycosyltransferase, but the N-glycosylation is highly and strictly regulated by the endogenous N-glycosylation machineries. [ABSTRACT FROM AUTHOR]

In this study, we describe a novel synthesis of galactosylated lipids by lipase catalysis. Lactitol (Lac), galactose (Gal), or N-acetyl galactosamine (GalNAc) was coupled with cholesterol (CHS) as target head groups by enzyme-catalyzed regioselective esterification to produce three kinds of lipids: CHS-1-Gal, CHS-6-Gal, or CHS-6-GalNAc1. The biological effects of galactosylated lipids carrying different constitutional isomers of the pendent sugar species were investigated. LP-1-Gal (liposomes containing 5.0 molar% of CHS-1-Gal) showed strong binding to tetrameric lectins of Ricinus communis agglutinin (RCA120) in vitro, while LP-6-Gal (liposomes containing 5.0 molar% of CHS-6-Gal) and LP-6-GalNAc (liposomes containing 5.0 molar% of CHS-6-GalNAc) did not. After intravenous injection, LP-6-GalNAc, LP-1-Gal and LP-6-Gal rapidly disappeared from the blood and accumulated rapidly in liver (up to 74.88 ± 4.11%, 58.67 ± 5.75%, and 47.66 ± 4.56% of injected dose/g organ within 4 h, respectively). This is significantly higher than the uptake of unmodified liposomes (Unmod-LP) (18.67 ± 6.07%). Pre-injection of asialofetuin significantly inhibits liver uptake of Gal-liposomes (P < 0.01), with the degree of inhibition appearing in the following order: LP-6-GalNAc (73.29%) > LP-1-Gal (67.06%) > LP-6-Gal (53.61%). More importantly, LP-6-GalNAc was preferentially taken up by hepatocytes and the uptake ratio by parenchymal cells (PC) and nonparenchymal cells (NPC) (PC/NPC ratio) was 11.03 higher than LP-1-Gal (7.32), LP-6-Gal (5.83) and Unmod-LP (2.39). We suggest that liposomes containing the novel galactosylated lipid CHS-6-GalNAc have potential as drug delivery carriers for hepatocyte-selective targeting. [ABSTRACT FROM AUTHOR]

Liver is the main organ for metabolism but is also subject to various pathologies, from viral, genetic, cancer or metabolic origin. There is thus a crucial need to develop efficient liver-targeted drug delivery strategies. Asialoglycoprotein receptor (ASGPR) is a C-type lectin expressed in the hepatocyte plasma membrane that efficiently endocytoses glycoproteins exposing galactose (Gal) or N-acetylgalactosamine (GalNAc). Its targeting has been successfully used to drive the uptake of small molecules decorated with three or four GalNAc, thanks to an optimisation of their spatial arrangement. Herein, we assessed the biological properties of highly stable nanostructured lipid carriers (NLC) made of FDA-approved ingredients and formulated with increasing amounts of GalNAc. Cellular studies showed that a high density of GalNAc was required to favour hepatocyte internalisation via the ASGPR pathway. Interaction studies using surface plasmon resonance and the macrophage galactose-lectin as GalNAc-recognising lectin confirmed the need of high GalNAc density for specific recognition of these NLC. This work is the first step for the development of efficient nanocarriers for prolonged liver delivery of active compounds. [ABSTRACT FROM AUTHOR]

Whole genome sequencing has revealed that the genome of Staphylococcus aureus possesses an uncharacterized 5-gene operon (SAOUHSC&#95;00088-00092 in strain 8325 genome) that encodes factors with functions related to polysaccharide biosynthesis and export, indicating the existence of a new extracellular polysaccharide species. We designate this locus as ssc for staphylococcal surface carbohydrate. We found that the ssc genes were weakly expressed and highly repressed by the global regulator MgrA. To characterize Ssc, Ssc was heterologously expressed in Escherichia coli and extracted by heat treatment. Ssc was also conjugated to AcrA from Campylobacter jejuni in E. coli using protein glycan coupling technology (PGCT). Analysis of the heat-extracted Ssc and the purified Ssc-AcrA glycoconjugate by tandem mass spectrometry revealed that Ssc is likely a polymer consisting of N -acetylgalactosamine. We further demonstrated that the expression of the ssc genes in S. aureus affected phage adsorption and susceptibility, suggesting that Ssc is surface-exposed., Importance: Surface polysaccharides play crucial roles in the biology and virulence of bacterial pathogens. Staphylococcus aureus produces four major types of polysaccharides that have been well-characterized. In this study, we identified a new surface polysaccharide containing N-acetylgalactosamine (GalNAc). This marks the first report of GalNAc-containing polysaccharide in S. aureus . Our discovery lays the groundwork for further investigations into the chemical structure, surface location, and role in pathogenesis of this new polysaccharide., Competing Interests: The authors declare no conflict of interest.

N-Acetylhexosamine 1-kinase (NahK) catalyzes the direct addition of a phosphate from adenosine 5'-triphosphate (ATP) to the anomeric position of N-acetylhexosamine and shows similar activity towards N-acetylglucosamine (GlcNAc) and N-acetylgalactosamine (GalNAc). Herein we report the cloning, characterization, and substrate specificity studies of two NahKs from Bifidobacterium infantis ATCC15697 and Bifidobacterium longum ATCC55813, respectively. A new capillary electrophoresis assay method has been developed for enzyme activity assays. Both enzymes have a good expression level in E. coli (180-185 mg/L culture) and can tolerate diverse modifications at C2 of GlcNAc and GalNAc. Various GlcNAc derivatives with C6, both C2 and C6, as well as both C2 and C3 modifications are tolerable substrates for the newly cloned NahKs. Quite interestingly, despite of their low activities toward glucose and galactose, the activities of both NahKs are much higher for mannose and some of its C2, C4, and C6 derivatives. These NahKs are excellent catalysts for enzymatic and chemoenzymatic synthesis of carbohydrates.

Wendu Duan, Yan Liu Department of Hepatobiliary Surgery, Affiliated Hospital of Hebei University, Baoding, Hebei Province 071000, People’s Republic of China Purpose: Targeted hepatocellular carcinoma therapy was carried out to improve the efficacy of liver cancer treatment. The purpose of this study was to design an N-acetylgalactosamine (NAcGal) modified and pH sensitive doxorubicin (DOX) prodrug (NAcGal-DOX) for the construction of lipid nanoparticles (LNPs). Methods: NAcGal-DOX and sorafenib (SOR) co-loaded LNPs were designed and the synergistic effects were evaluated on human hepatic carcinoma (HepG2) cells in vitro and anti-hepatic carcinoma mice model in vivo. Results: Cellular uptake efficiency of NAcGal modified LNPs was significantly higher than unmodified LNPs. NAcGal modified LNPs showed the most significant inhibition effect among all the samples tested. The results revealed that the LNPs system achieved significant synergistic effects, best tumor inhibition ability and the lowest systemic toxicity. Conclusion: These results proved that the NAcGal conjugated and pH sensitive co-delivery nano-system could be a promising strategy for treatment of hepatocellular carcinoma. Keywords: hepatocellular carcinoma, asialoglycoprotein receptor, N-acetylgalactosamine, pH sensitive, prodrug

Synthetic approaches towards N-acetylgalactosamine (GalNAc) have been attracting considerable interest since this compound is known for its pivotal role in cell–cell interaction and receptor induced cell signaling. Herein, we present a synthetic route in which two of the four stereogenic centers present in the target compound are derived from enantiopure tartaric acid being selectively converted to epoxy alcohols. The key step is the Pd-catalyzed, stereo- and regioselective epoxide opening and subsequent nucleophilic substitution of an azide functionality. This approach enables the synthesis of the naturally D- and unnaturally L-configured GalNAc, as well as both enantiomers of the largely unknown N-acetylidosamine (IdoNAc).

Abstract Background Receptors specific for the sugar N-acetylgalactosamine (GalNAc) include the human type II, C-type lectin receptor macrophage galactose-type lectin/C-type lectin receptor family member 10A (MGL/CLEC10A/CD301) that is expressed prominently by human peripheral immature dendritic cells, dendritic cells in the skin, alternatively-activated (M2a) macrophages, and to lesser extents by several other types of tissues. CLEC10A is an endocytic receptor on antigen-presenting cells and has been proposed to play an important role in maturation of dendritic cells and initiation of an immune response. In this study, we asked whether a peptide that binds in the GalNAc-binding site of CLEC10A would serve as an effective tool to activate an immune response against ovarian cancer. Methods A 12-mer sequence emerged from a screen of a phage display library with a GalNAc-specific lectin. The peptide, designated svL4, and a shorter peptide consisting of the C-terminal 6 amino acids, designated sv6D, were synthesized as tetravalent structures based on a tri-lysine core. In silico and in vitro binding assays were developed to evaluate binding of the peptides to GalNAc-specific receptors. Endotoxin-negative peptide solutions were administered by subcutaneous injection and biological activity of the peptides was determined by secretion of cytokines and the response of peritoneal immune cells in mice. Anti-cancer activity was studied in a murine model of ovarian cancer. Results The peptides bound to recombinant human CLEC10A with high avidity, with half-maximal binding in the low nanomolar range. Binding to the receptor was Ca2+-dependent. Subcutaneous injection of low doses of peptides into mice on alternate days resulted in several-fold expansion of populations of mature immune cells within the peritoneal cavity. Peptide sv6D effectively suppressed development of ascites in a murine ovarian cancer model as a monotherapy and in combination with the chemotherapeutic drug paclitaxel or the immunotherapeutic antibody against the receptor PD-1. Toxicity, including antigenicity and release of cytotoxic levels of cytokines, was not observed. Conclusion sv6D is a functional ligand for CLEC10A and induces maturation of immune cells in the peritoneal cavity. The peptide caused a highly significant extension of survival of mice with implanted ovarian cancer cells with a favorable toxicity and non-antigenic profile.

The asialoglycoprotein receptor (ASGPr) and N-acetylgalactosamine (GalNAc) is one of the most reliable receptor-ligand combinations for delivering antisense oligonucleotides (ASOs) to the liver. Here, we show that a modular GalNAc conjugation strategy allows us to reinforce the activity of the parent, naked 2′,4′-BNA/LNA gapmer targeting apolipoprotein B. The conjugation partly reduced a possible hepatotoxicity of the parent ASO. The structure-activity study revealed the significance of the metabolic susceptibility of the GalNAc moiety to nucleolytic cleavage that results in exposure of the parent gapmer. The broad usefulness of our delivery strategy of ASOs to the liver has been demonstrated. [ABSTRACT FROM AUTHOR]

β-N-Acetylhexosaminidases (EC 3.2.1.52) are a unique family of glycoside hydrolases with dual substrate specificity and a particular reaction mechanism. Though hydrolytic enzymes per se, their good stability, easy recombinant production, absolute stereoselectivity, and a broad substrate specificity predestine these enzymes for challenging applications in carbohydrate synthesis. This mini-review aims to demonstrate the catalytic potential of β-N-acetylhexosaminidases in a range of unusual reactions, processing of unnatural substrates, formation of unexpected products, and demanding reaction designs. The use of unconventional media can considerably alter the progress of transglycosylation reactions. By means of site-directed mutagenesis, novel catalytic machineries can be constructed. Glycosylation of difficult substrates such as sugar nucleotides was accomplished, and the range of afforded glycosidic bonds comprises unique non-reducing sugars. Specific functional groups may be tolerated in the substrate molecule, which makes β-N-acetylhexosaminidases invaluable allies in difficult synthetic problems. [ABSTRACT FROM AUTHOR]

Targeted drug delivery platforms can increase the concentration of drugs in specific cell populations, reduce adverse effects, and hence improve the therapeutic effect of drugs. Herein, we designed two conjugates by installing the targeting ligand GalNAc (N- acetylgalactosamine) onto atorvastatin (AT). Compared to the parent drug, these two conjugates, termed G2-AT and G2-K-AT, showed increased hepatic cellular uptake. Moreover, both conjugates were able to release atorvastatin, and consequently showed dramatic inhibition of β-hydroxy-β-methylglutaryl-CoA (HMG-CoA) reductase and increased LDL receptors on cell surface. [ABSTRACT FROM AUTHOR]

Hyperoxia therapy is often required to treat newborns with respiratory disorders. Prolonged hyperoxia exposure increases oxidative stress and arrests alveolar development in newborn rats. Tn antigen is N-acetylgalactosamine residue that is one of the most remarkable tumor-associated carbohydrate antigens. Tn immunization increases the serum anti-Tn antibody titers and attenuates hyperoxia-induced lung injury in adult mice. We hypothesized that maternal Tn immunizations would attenuate hyperoxia-induced lung injury through the suppression of oxidative stress in neonatal rats. Female Sprague–Dawley rats (6 weeks old) were intraperitoneally immunized five times with Tn (50 μg/dose) or carrier protein at biweekly intervals on 8, 6, 4, 2, and 0 weeks before the day of delivery. The pups were reared in room air (RA) or 2 weeks of 85% O2, creating the four study groups: carrier protein + RA, Tn vaccine + RA, carrier protein + O2, and Tn vaccine + O2. The lungs were excised for oxidative stress, cytokine, vascular endothelial growth factor (VEGF) and platelet-derived growth factor (PDGF) expression, and histological analysis on postnatal day 14. Blood was withdrawn from dams and rat pups to check anti-Tn antibody using western blot. We observed that neonatal hyperoxia exposure reduced the body weight, increased 8-hydroxy-2-deoxyguanosine (8-OHdG) expression and lung cytokine (interleukin-4), increased mean linear intercept (MLI) values, and decreased vascular density and VEGF and PDGF-B expressions. By contrast, Tn immunization increased maternal and neonatal serum anti-Tn antibody titers on postnatal day 14, reduced MLI, and increased vascular density and VEGF and PDGF-B expressions to normoxic levels. Furthermore, the alleviation of lung injury was accompanied by a reduction in lung cytokine and 8-OHdG expression. Therefore, we propose that maternal Tn immunization attenuates hyperoxia-induced lung injury in neonatal rats through the suppression of oxidative stress and inflammation. [ABSTRACT FROM AUTHOR]

Graphical abstract Highlights • GalNAc conjugation improved potency of 2′- O -methyl Gapmer ASO 10-fold. • Potency of FHNA Gapmer ASO improved 14-fold by GalNAc conjugation. • LNA and cEt BNA ASO GalNAc conjugates showed similar activity in mice liver. • GalNAc conjugation improved activity of ASOs designed to correct pre-mRNA splicing. Abstract The potency of antisense oligonucleotide (ASO) drugs has significantly improved in the clinic after exploiting asialoglycoprotein receptor (ASGR) mediated delivery to hepatocytes. To further this technology, we evaluated the structure–activity relationships of oligonucleotide chemistry on in vivo potency of GalNAc-conjugated Gapmer ASOs. GalNAc conjugation improved potency of ASOs containing 2′- O -methyl (2′- O -Me), 3′-fluoro hexitol nucleic acid (FHNA), locked nucleic acid (LNA), and constrained ethyl bicyclo nucleic acid (cEt BNA) 10–20-fold compared to unconjugated ASOs. We further demonstrate that GalNAc conjugation improves activity of 2′- O -(2-methoxyethyl) (2′- O -MOE) and Morpholino ASOs designed to correct splicing of survival motor neuron (SMN2) pre-mRNA in liver after subcutaneous administration. GalNAc modification thus represents a viable strategy for enhancing potency of ASO with diverse nucleic acid modifications and mechanisms of action for targets expressed in hepatocytes. [ABSTRACT FROM AUTHOR]

Plant lectins are gaining interest because of their interesting biological properties. Several Adenia species, that are being used in traditional medicine to treat many health ailments have shown presence of lectins or carbohydrate binding proteins. Here, we report the purification, characterization and biological significance of N-Acetyl galactosamine specific lectin from Adenia hondala (AHL) from Passifloraceae family. AHL was purified in a single step by affinity chromatography on asialofetuin Sepharose 4B column, characterized and its fine sugar specificity determined by glycan array analysis. AHL is human blood group non specific and also agglutinates rabbit erythrocytes. AHL is a glycoprotein with 12.5% of the carbohydrate, SDS-PAGE, MALDI-TOF-MS and ESI-MS analysis showed that AHL is a monomer of 31.6 kDa. AHL is devoid of DNase activity unlike other Ribosome inactivating proteins (RIPs). Glycan array analysis of AHL revealed its highest affinity for terminal lactosamine or polylactosamine of N- glycans, known to be over expressed in hepatocellular carcinoma and colon cancer. AHL showed strong binding to human hepatocellular carcinoma HepG2 cells with MFI of 59.1 expressing these glycans which was effectively blocked by 93.1% by asialofetuin. AHL showed dose and time dependent growth inhibitory effects on HepG2 cells with IC50 of 4.8 μg/ml. AHL can be explored for its clinical potential. [ABSTRACT FROM AUTHOR]

BACKGROUND: Studies show that insects can adapt to the toxins of Bacillus thuringiensis under field and laboratory conditions through the development of resistance to the bacterium and its formulations. This has been demonstrated in the failure to control Tuta absoluta populations in Brazil. This study evaluated membrane receptors using peroxidase‐labeled lectins and the midgut histochemistry of T. absoluta populations to assess susceptibility to the insecticides Bt fomulations. The histochemistry analysis used Periodic Acid–Schiff for glycogen and Ponceau Xylidine for total proteins. The presence of glucose/mannose and N‐acetylgalactosamine (GalNAc) was analyzed using specific lectins. One susceptible and one tolerant population were used in the study; insects were exposed to the insecticide concentrations recommended by the manufacturers. The midgut was collected after an interval of 20 min and analyzed using optical microscopy. RESULTS: Bt fomulation interferes with the glycogen content, whereas XenTari® interferes with the protein content, irrespective of the level of susceptibility. High expression of GalNAc residues was observed using soybean lectin labeling, indicating a direct relationship between the glycosylation pattern and susceptibility to Bt fomulation in the Pelotas population. CONCLUSION: The use of Bt fomulation caused greater alterations in the larval intestinal histophysiology compared to the use of XenTari®. © 2018 Society of Chemical Industry This study evaluated membrane receptors using peroxidase‐labeled lectins and the midgut histochemistry of Tuta absoluta populations in order to assess susceptibility to the insecticides Bt fomulations. [ABSTRACT FROM AUTHOR]

Short interfering RNAs (siRNAs) and antisense oligonucleotides (ASOs) are the most clinically advanced oligonucleotide-based platforms. A number of N-acetylgalactosamine (GalNAc)-conjugated siRNAs (GalNAc-siRNAs), also referred to as RNA interference (RNAi) therapeutics, are currently in various stages of development, though none is yet approved. While the safety of ASOs has been the subject of extensive review, the nonclinical safety profiles of GalNAc-siRNAs have not been reported. With the exception of sequence differences that confer target RNA specificity, GalNAc-siRNAs are largely chemically uniform, containing limited number of phosphorothioate linkages, and 2’-O-methyl and 2’-deoxy-2’-fluoro ribose modifications. Here, we present the outcomes of short-term (3–5 week) rat and monkey weekly repeat-dose toxicology studies of six Enhanced Stabilization Chemistry GalNAc-siRNAs currently in clinical development. In nonclinical studies at supratherapeutic doses, these molecules share similar safety signals, with histologic findings in the organ of pharmacodynamic effect (liver), the organ of elimination (kidney), and the reticuloendothelial system (lymph nodes). The majority of these changes are nonadverse, partially to completely reversible, correlate well with pharmacokinetic parameters and tissue distribution, and often reflect drug accumulation. Furthermore, all GalNAc-siRNAs tested to date have been negative in genotoxicity and safety pharmacology studies. [ABSTRACT FROM AUTHOR]

The display of N -acetylgalactosamine (NAcGal) ligands has shown great potential in improving the targeting of various therapeutic molecules to hepatocellular carcinoma (HCC), a severe disease whose clinical treatment is severely hindered by limitations in delivery of therapeutic cargo. We previously used the display of NAcGal on generation 5 (G5) polyamidoamine (PAMAM) dendrimers connected through a poly(ethylene glycol) (PEG) brush (i.e. G5- c PEG-NAcGal; monoGal) to effectively target hepatic cancer cells and deliver a loaded therapeutic cargo. In this study, we were interested to see if tri-valent NAcGal ligands (i.e. NAcGal 3 ) displayed on G5 dendrimers (i.e. G5- c PEG-NAcGal 3 ; triGal) could improve their ability to target hepatic cancer cells compared to their monoGal counterparts. We therefore synthesized a library of triGal particles, with either 2, 4, 6, 8, 11, or 14 targeting branches (i.e. c PEG-NAcGal 3 ) attached. Conventional flow cytometry studies showed that all particle formulations can label hepatic cancer cells in a concentration-dependent manner, reaching 90–100% of cells labeled at either 285 or 570 nM G5, but interestingly, monoGal labeled more cells at lower concentrations. To elucidate the difference in internalization of monoGal versus triGal conjugates, we turned to multi-spectral imaging flow cytometry and quantified the amount of internalized (I) versus surface-bound (I 0 ) conjugates to determine the ratio of internalization (I/I 0 ) in all treatment groups. Results show that regardless of NAcGal valency, or the density of targeting branches, all particles achieve full internalization and diffuse localization throughout the cell (I/I 0  ∼ 3.0 for all particle compositions). This indicates that while tri-valent NAcGal is a promising technique for targeting nanoparticles to hepatic cancer cells, mono-valent NAcGal is more efficient, contrary to what is observed with small molecules. [ABSTRACT FROM AUTHOR]

Avibacterium paragallinarum is a Gram-negative bacterium that causes infectious coryza in chicken. It was reported that the capsule polysaccharides extracted from Av. paragallinarum genotype A contained chondroitin. Chondroitin synthase of Av. paragallinarum (ApCS) encoded by one gene within the presumed capsule biosynthesis gene cluster exhibited considerable homology to identified bacterial chondroitin synthases. Herein, we report the identification and characterization of ApCS. This enzyme indeed displays chondroitin synthase activity involved in the biosynthesis of the capsule. ApCS is a bifunctional protein catalyzing the elongation of the chondroitin chain by alternatively transferring the glucuronic acid (GlcA) and N-acetyl-D-galactosamine (GalNAc) residues from their nucleotide forms to the non-reducing ends of the saccharide chains. GlcA with a para-nitrophenyl group (pNP) could serve as the acceptor for ApCS; this enzyme shows a stringent donor tolerance when the acceptor is as small as this monosaccharide. Then, UDP-GalNAc and GlcA-pNP were injected sequentially through the chip-immobilized chondroitin synthases, and the surface plasmon resonance data demonstrated that the up-regulated extent caused by the binding of the donor is one possibly essential factor in successful polymerization reaction. This conclusion will, therefore, enhance the understanding of the mode of action of glycosyltransferase. Surprisingly, high activity at near-zero temperature as well as weak temperature dependence of this novel bacterial chondroitin synthase indicate that ApCS was a cold-active enzyme. From all accounts, ApCS becomes the fourth known bacterial chondroitin synthase, and the potential applications in artificial chondroitin sulfate and glycosaminoglycan synthetic approaches make it an attractive glycosyltransferase for further investigation. [ABSTRACT FROM AUTHOR]

Cryptosporidium spp. are the causative agents of diarrheal disease worldwide, but effective treatments are lacking. Cryptosporidium employs mucin-like glycoproteins with O-glycans to attach to and infect host intestinal epithelial cells. The Tn antigen (GalNAcα1-Ser/Thr) is an O-glycan essential for these processes, as Tn-specific lectins and a Tn-specific monoclonal antibody block attachment to and infection of host cells in vitro. The enzymes in Cryptosporidium catalyzing their synthesis, however, have not been studied. Previously, we identified four genes encoding putative UDP N-acetyl-α- d -galactosamine:polypeptide N-acetylgalactosaminyltransferases (ppGalNAc-Ts) in the genomes of three Cryptosporidium spp. Here we report the in silico analysis, cloning, expression, purification, and characterization of one of the four enzymes Cryptosporidium parvum (C p ) - ppGalNAc-T4. This enzyme contains the characteristic domains and motifs conserved in ppGalNAc-Ts and is expressed at multiple time points during in vitro infection. Recombinant soluble Cp- ppGalNAc-T4 was enzymatically active against an unmodified EA2 peptide suggesting that it may function as an “initiating” ppGalNAc-T. Cp- ppGalNAc-T4 also exhibited a strong preference for UDP-GalNAc over other nucleotide sugar donors and was active against unmodified and O-glycosylated versions of the C. parvum gp40-derived peptide, with a preference for the former, suggesting it may play a role in modifying this glycoprotein in vivo. Given the importance of mucin-type O-glycosylation in Cryptosporidium spp., the enzymes that catalyze their synthesis may serve as potential therapeutic targets. [ABSTRACT FROM AUTHOR]

Although it has been shown that some mannose-binding lectins (MBLs) exhibit significant activity against HIV infection, little is known about whether N-acetylgalactosamine (GalNAc)-binding lectins have the ability to inhibit HIV infection. Here, we demonstrate that a soybean-derived lectin (SBL) with GalNAc-binding affinity could potently suppress HIV infection of macrophages in a dose-dependent fashion. Unlike the MBLs, which block HIV only through binding to the glycosylated envelope proteins (gp120 and gp41) of the virus, SBL inhibited HIV at multiple steps of the virus infection/replication cycle. SBL could activate the beta interferon (IFN-β)-STAT signaling pathway, resulting in the upregulation of a number of antiviral interferon-stimulated genes (ISGs) in macrophages. In addition, SBL treatment of macrophages induced the production of C-C chemokines, which bind to HIV entry coreceptor CCR5. Deglycosylation of cell surface galactosyl moieties or presaturation of GalNAc-binding capacity could compromise SBL-mediated induction of the antiviral factors. Furthermore, SBL exerted its anti-HIV activity in the low nanomolar range with no mitogenic effect on CD4α T cells, a major advantage in the development of SBL as a potential anti-HIV agent compared with MBLs. These data indicate a necessity to further investigate SBL as an alternative and cost-effective anti-HIV natural product. [ABSTRACT FROM AUTHOR]

Recently, some studies have reported nephrotoxicity associated with a certain class of antisense oligonucleotides (ASOs) in humans. One possibility for reducing the potential nephrotoxicity of ASOs is to alter their pharmacokinetics. In this study, we investigated the effect of a ligand conjugation strategy on the renal accumulation of ASOs. We selected two ligands, cholesterol and N-acetylgalactosamine (GalNAc), with the purpose of reducing renal distribution and liver targeting, and then designed a series of cholesterol-GalNAc dual conjugated ASOs. The gene-silencing activity of the cholesterol-GalNAc dual conjugated ASO in the liver was slightly lower than that of a GalNAc-conjugated ASO. On the other hand, the renal distribution of the cholesterol-GalNAc dual conjugated ASO was considerably decreased compared with the GalNAc-conjugated ASO, as we expected. As dual conjugation was successful in reducing the renal distribution of ASO, it should be an effective strategy for reducing the nephrotoxic potential of ASOs. [ABSTRACT FROM AUTHOR]

Capsule of Escherichia coli O5:K4:H4 is formed of a chondroitin-repeat disaccharide unit of glucuronic acid (GlcA)- N-acetylgalactosamine (GalNAc). This polysaccharide, commonly referred to as K4CP, is a potentially important source of precursors for chemoenzymatic or bioengineering synthesis of chondroitin sulfate. KfoA, encoded by a gene from region 2 of the K4 capsular gene cluster, shows high homology to the UDP-glucose-4-epimerase (GalE) from E. coli. KfoA is reputed to be responsible for uridine 5′-diphosphate- N-acetylgalactosamine (UDP-GalNAc) supply for K4CP biosynthesis in vivo, but it has not been biochemically characterized. Here, we probed the substrate specificity of KfoA by a capillary electrophoresis (CE)-based method. KfoA could epimerize both acetylated and non-acetylated substrates, but its k / K value for UDP-GlcNAc was approximately 1300-fold that for UDP-Glc. Recombinant KfoA showed a strong preference for acetylated substrates in vitro. The conclusion that KfoA is a higher efficiency UDP-GalNAc provider than GalE was supported by a coupled assay developed based on the donor-acceptor combination specificity of E. coli K4 chondroitin polymerase (KfoC). Furthermore, residue Ser-301, located near the UDP-GlcNAc binding pocket, plays an important role in the determination of the conversion ratio of UDP-GlcNAc to UDP-GalNAc by KfoA. Our results deepen the understanding of the mechanism of KfoA and will assist in the research into the metabolic engineering for chondroitin sulfate production. [ABSTRACT FROM AUTHOR]

The polypeptide GalNAc-transferases (GalNAc-Ts), that initiate mucin-type O-glycosylation, consist of a catalytic and a lectin domain connected by a flexible linker. In addition to recognizing polypeptide sequence, the GalNAc-Ts exhibit unique long-range N- and/or Cterminal prior glycosylation (GalNAc-O-Ser/Thr) preferences modulated by the lectin domain. Here we report studies on GalNAc-T4 that reveal the origins of its unique N-terminal long-range glycopeptide specificity, which is the opposite of GalNAc-T2. The GalNAc-T4 structure bound to a monoglycopeptide shows that the GalNAc-binding site of its lectin domain is rotated relative to the homologous GalNAc-T2 structure, explaining their different long-range preferences. Kinetics and molecular dynamics simulations on several GalNAc-T2 flexible linker constructs show altered remote prior glycosylation preferences, confirming that the flexible linker dictates the rotation of the lectin domain, thus modulating the GalNAc-Ts' long-range preferences. This work for the first time provides the structural basis for the different remote prior glycosylation preferences of the GalNAc-Ts. [ABSTRACT FROM AUTHOR]

RNA interference (RNAi) has the potential to reversibly silence any gene with high efficiency and specificity. To fulfill the clinical potential of RNAi, delivery vehicles are required to transport the short interfering RNA (siRNA) to the site of action in the cells of target tissues. Here, we describe the features of novel liver-targeted siRNA nanoparticles (NPs), co-assembled due to the complexation of alginate sulfate (AlgS) with siRNA, mediated by calcium ions bridges (AlgS–Ca 2+ -siRNA NPs) and then bioconjugation of a targeting ligand onto the AlgS upon the NP surface. To gain insight into the complexation process and confirm AlgS accessibility on NP surface, we investigated different schemes for fabrication. All resulting NPs, independently of the component addition order, were of average size of 130–150 nm, had surface charge of <− 10 mV, exhibited a similar atomic composition on their surface, were efficiently uptaken by HepG2 cells and induced approx. ~ 90% silencing of STAT3 gene. Ca 2+ and AlgS concentrations in NPs affected cell uptake and gene silencing. Bioconjugation of N-acetylgalactosamine (GalNAc), a ligand to the asialoglycoprotein receptor (ASGPR) overexpressed on hepatocytes, was validated by XPS analysis and cell uptake by receptor-mediated mechanism. After intravenous ( i.v. ) injection to BALB/c mice, GalNAc-NPs were targeted to liver by a factor of ~ 3 with lesser renal clearance compared to non-targeted NPs. We foresee that the combined advantages of site-specific targeting and reversibility of the tri-component NPs as well as the simplicity of their fabrication make them an attractive system for targeted delivery of siRNA. [ABSTRACT FROM AUTHOR]

Background: FSH, LH, and TSH are glycoprotein hormones secreted from the pituitary as fully and low-asparagine-glycosylated hormones. These glycoforms of the hormones exist as a large number of isoforms varying in their glycan contents of terminal anionic monosaccharides (AMS), i.e. sialic acid (SA) and sulfonated N-acetylgalactosamine (SU). Due to the immense heterogeneity and the low concentrations in serum it has been a challenge to develop reliable analytical methods to measure and characterize the circulating glycoforms of these hormones. Methods: The hormones were separated with respect to AMS content per molecule by calibrated 0.1% agarose suspension electrophoreses. Glycoforms in separated fractions were then analyzed with respect to size by 180 calibrated Sephadex G-100 gel filtrations. The hormones were measured with timeresolved sandwich fluoroimmunoassays. All separations and assays were performed in veronal buffer at pH 8.7. Sera and fractions were also analyzed after removal of terminal SA. Results: In addition to the fully glycosylated FSH, LH, and TSH, also tri-glycosylated FSH and di-glycosylated LH and TSH forms could be identified in serum samples. The low- and fully glycosylated hormones differed both with respect to size and to median number of AMS per molecule. Algorithms, based on the distributions by electrophoreses, were developed for each hormone to estimate percent low-glycosylated forms in serum. The median numbers of SA and SU per glycoform molecule were estimated using results obtained after desialylation. Conclusion: The methods can be used for identification and characterization of glycoforms of circulating FSH, LH, and TSH in physiological and clinical studies. [ABSTRACT FROM AUTHOR]

CD206 is a macrophage mannose receptor involved in variety of autoimmune and inflammatory diseases. This study aimed to identify the pathogenic role of CD206 in a herpes simplex virus (HSV) induced Behçet's disease (BD) mouse model. CD206 positive cells were detected in peripheral blood mononuclear cells and quantified by flow cytometry. Levels of cytokines were measured by ELISA. CD206 was found to be down-regulated both in vitro (10 -6 M) and in vivo (200 μg/mouse) after treatment with N-acetylgalactosamine (GalNAc), a ligand for CD206. The down-regulation of CD206 was correlated with improvement in BD symptoms. Colchicine (2 μg/mouse) or pentoxifylline (400 μg/mouse) treated mice displayed improvement in BD symptoms with fewer CD206 positive cells. The prevalence of CD206-positive cells differed between ligand-responsive and non-responsive BD mice. Inhibition of CD206 was associated with down-regulated serum level of interleukin-17 in GalNAc-treated BD mice. These results suggest that the expression of CD206 is correlated with HSV-induced BD symptoms in mice, implicating that CD206 might have a pathogenic role in BD. [ABSTRACT FROM AUTHOR]

O-linked β-N-acetylglucosamine (O-GlcNAc) is an essential regulatory post-translational modification of thousands of nuclear, cytoplasmic and mitochondrial proteins. O-GlcNAc is dynamically added and removed from proteins by the O-GlcNAc transferase and the O-GlcNAcase (OGA), respectively. Dysregulation of O-GlcNAc-cycling is implicated in the etiology of numerous diseases including tumorigenesis, metabolic dysfunction and neurodegeneration. To facilitate studies focused on the role of O-GlcNAc and OGA in disease, we sought to identify commercially available antibodies that enable the enrichment of full-length OGA (fOGA) from lysates of mouse and human origin. Here, we report that antibodies from Abcam and Bethyl Laboratories can be used to immunoprecipitate OGA to near-saturation from human and mouse cell lysates. However, western blotting analysis indicates that both antibodies, as well as three noncommercially available antibodies (345, 346, 352), detect fOGA and numerous cross-reacting proteins. These nonspecific signals migrate similarly to fOGA and are detected robustly, suggesting that the use of appropriate controls is essential to avoid the misidentification of OGA. [ABSTRACT FROM AUTHOR]

Hepatocellular carcinoma (HCC) is the 2nd leading cause of cancer-related deaths every year globally. The most common form of treatment, hepatic arterial infusion (HAI), involves the direct injection of doxorubicin (DOX) into the hepatic artery. It is plagued with limited therapeutic efficacy and the occurrence of severe toxicities (e.g. cardiotoxicity). We aim to improve the therapeutic index of DOX delivered via HAI by loading the drug onto generation 5 (G5) poly(amidoamine) (PAMAM) dendrimers targeted to hepatic cancer cells via N-acetylgalactosamine (NAcGal) ligands. DOX is attached to the surface of G5 molecules via two different enzyme-sensitive linkages, L3 or L4, to achieve controllable drug release inside hepatic cancer cells. We previously reported on P1 and P2 particles that resulted from the combination of NAcGal-targeting with L3- or L4-DOX linkages, respectively, and showed controllable DOX release and toxicity towards hepatic cancer cells comparable to free DOX. In this study, we demonstrate that while the intratumoral delivery of free DOX (1 mg/kg) into HCC-bearing nod scid gamma (NSG) mice achieves a 2.5-fold inhibition of tumor growth compared to the saline group over 30 days, P1 and P2 particles delivered at the same DOX dosage achieve a 5.1- and 4.4-fold inhibition, respectively. Incubation of the particles with human induced pluripotent stem cell derived cardiomyocytes (hiPSC CMs) showed no effect on monolayer viability, apoptosis induction, or CM electrophysiology, contrary to the effect of free DOX. Moreover, magnetic resonance imaging revealed that P1- and P2-treated mice maintained cardiac function after intraperitoneal administration of DOX at 1 mg/kg for 21 days, unlike the free DOX group at an equivalent dosage, confirming that P1/P2 can avoid DOX-induced cardiotoxicity. Taken together, these results highlight the ability of P1/P2 particles to improve the therapeutic index of DOX and offer a replacement therapy for clinical HCC treatment. [ABSTRACT FROM AUTHOR]

Cryptosporidium parvum (studied here) and Cryptosporidium hominis are important causes of diarrhea in infants and immunosuppressed persons. C. parvum vaccine candidates, which are on the surface of sporozoites, include glycoproteins with Ser- and Thr-rich domains (Gp15, Gp40, and Gp900) and a low complexity, acidic protein (Cp23). Here we used mass spectrometry to determine that O-linked GalNAc is present in dense arrays on a glycopeptide with consecutive Ser derived from Gp40 and on glycopeptides with consecutive Thr derived from Gp20, a novel C. parvum glycoprotein with a formula weight of ~20 kDa. In contrast, the occupied Ser or Thr residues in glycopeptides from Gp15 and Gp900 are isolated from one another. Gly at the N-terminus of Cp23 is N-myristoylated, while Cys, the second amino acid, is S-palmitoylated. In summary, C. parvum O-GalNAc transferases, which are homologs of host enzymes, densely modify arrays of Ser or Thr, as well as isolated Ser and Thr residues on C. parvum vaccine candidates. The N-terminus of an immunodominant antigen has lipid modifications similar to those of host cells and other apicomplexan parasites. Mass spectrometric demonstration here of glycopeptides with O-glycans complements previous identification C. parvum O-GalNAc transferases, lectin binding to vaccine candidates, and human and mouse antibodies binding to glycopeptides. The significance of these post-translational modifications is discussed with regards to the function of these proteins and the design of serological tests and vaccines. [ABSTRACT FROM AUTHOR]

The oral pathogen Aggregatibacter actinomycetemcomitans uses pga gene locus for the production of an exopolysaccharide made up of a linear homopolymer of β-1,6-N-acetyl-d-glucosamine (PGA). An enzyme encoded by the pgaB of the pga operon in A. actinomycetemcomitans is a de-N-acetylase, which is used to alter the PGA. The full length enzyme (AaPgaB) and the N-terminal catalytic domain (residues 25-290, AaPgaBN) from A. actinomycetemcomitans were cloned, expressed and purified. The enzymatic activities of the AaPgaB enzymes were determined using 7-acetoxycoumarin-3-carboxylic acid as the substrate. The AaPgaB enzymes displayed significantly lower de-N-acetylase activity compared with the activity of the deacetylase PdaA from Bacillus subtilis, a member of the CE4 family of enzymes. To delineate the differences in the activity and the active site architecture, the structure of AaPgaBN was determined. The AaPgaBN structure has two metal ions in the active site instead of one found in other CE4 enzymes. Based on the crystal structure comparisons among the various CE4 enzymes, two residues, Q51 and R271, were identified in AaPgaB, which could potentially affect the enzyme activity. Of the two mutants generated, Q51E and R271K, the variant Q51E showed enhanced activity compared with AaPgaB, validating the requirement that an activating aspartate residue in the active site is essential for higher activity. In summary, our study provides the first structural evidence for a di-nuclear metal site at the active site of a member of the CE4 family of enzymes, evidence that AaPgaBN is catalytically active and that mutant Q51E exhibits higher de-N-acetylase activity. [ABSTRACT FROM AUTHOR]

Purpose: To investigate the expression patterns of N-acetyl galactosamine transferases (GalNAc-Ts)-3 and GalNAc-T6 in clinicopathologically characterized endometriosis (EMS), and to explore their clinical significance.Methods: Ectopic and eutopic endometrial tissue samples were obtained and confirmed with CD-10 immunohistochemistry in patients with EMS (n = 12), whereas normal control endometrium was obtained from patients with uterine septum (n = 12). The mRNA and protein levels of GalNAc-T3 and GalNAc-T6 were detected in these samples using quantitative real-time PCR, immunohistochemistry, and western blotting.Results: GalNAc-T3 and GalNAc-T6 were expressed in the endometrium of all groups, with no significant changes observed during the menstrual cycle. The expression of GalNAc-T3 and GalNAc-T6 in ectopic endometrium was significantly lower than that in eutopic (P < 0.05) or control endometrium (P < 0.05), whereas there were no significant differences (P > 0.05) between eutopic and control endometria. Furthermore, the expression of GalNAc-T3 and GalNAc-T6 was significantly lower in patients with stage III/IV EMS compared to patients with stage I/II (P < 0.05).Conclusions: Both GalNAc-T3 and GalNAc-T6 expression levels were downregulated in ectopic endometrium, which may increase the adhesion and invasion of endometrial cells and contribute to the development of EMS. Moreover, we found a strong correlation between the expression of GalNAc-T3 and GalNAc-T6 and different stages of EMS. [ABSTRACT FROM AUTHOR]

The year 2023 marks the 25th anniversary of the discovery of RNAi. RNAi-based therapeutics enable sequence-specific gene knockdown by eliminating target RNA molecules through complementary base-pairing. A systematic review of published and ongoing clinical trials was performed. Web of Science, PubMed, and Embase were searched from January 1, 1998, to December 30, 2022 for clinical trials using RNAi. Following inclusion, data from the articles were extracted according to a predefined protocol. A total of 90 trials published in 81 articles were included. In addition, ongoing clinical trials were retrieved from ClinicalTrials.gov, resulting in the inclusion of 48 trials. We investigated how maturation of RNAi-based therapeutics and developments in delivery platforms, administration routes, and potential targets shape the current landscape of clinically applied RNAi. Notably, most contemporary clinical trials used either N -acetylgalactosamine delivery and subcutaneous administration or lipid nanoparticle delivery and intravenous administration. In conclusion, RNAi therapeutics have gained great momentum during the past decade, resulting in five approved therapeutics targeting the liver for treatment of severe diseases, and the trajectory depicted by the ongoing trials emphasizes that even more RNAi-based medicines also targeting extra-hepatic tissues are likely to be available in the years to come., Competing Interests: The authors declare no competing interests., (© 2023 The Author(s).)

Introduction: SiRNA molecules with a feature of good gene-silencing are critical for drug discovery and development based on RNA interference. GalNAc-RNA therapeutics is a rapid growing area in RNA therapeutics., Areas Covered: This article provides patent landscape and modification feature of GalNAc-RNA therapeutics. The US-granted patents from January 2004 to April 2023 were retrieved and analyzed., Expert Opinion: Globally, our study is the first one to holistically depict a map of modifications and therapeutic applications for GalNAc-RNA therapeutics by patent data analysis. The results showed there were 8 major modifications and 5 new emerged modifications for GalNAc-RNA therapeutic agents. Especially, the study provides recent new emerged modifications in sugar, base, and internucleotide linkage of GalNAc-RNA therapeutic agents, e.g. morpholino-type ring, 5-methylcytosine, and phosphorodithioates. In addition, our study systematically demonstrated major therapeutic applications for GalNAc-RNA therapeutics, including liver or gallbladder disorders, anticancer, antihyperlipidemics, and disorders of the nervous system etc.

Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa). Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17) to that grown in GM17 (0.5% Glucose + M17) revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon), which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR) in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’) in the promoter region of the aga operon (PbgaC), which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.