Search

Neuroendocrine (NE) differentiation has been histochemically detected in normal and cancer tissues and cells. Immunohistochemical analyses have provided a more detailed understanding of NE biology and pathology. Pulmonary NE cells are a rare lung epithelial type, and small cell carcinoma of the lung (SCLC) is a high-grade NE tumor. Pulmonary NE and SCLC cells share common mechanisms for NE differentiation. Neural or NE cell lineage-specific transcription factors, such as achaete-scute homologue 1 (Ascl1) and insulinoma-associated protein 1 (INSM1), are crucial for the development of pulmonary NE cells, and NE differentiation is influenced by the balance between Ascl1 and the suppressive neural transcription factor, hairy-enhancer of split 1, a representative target molecule of the Notch signaling pathway. In this review, we discuss the importance of Ascl1 and INSM1 in identifying pulmonary NE and SCLC cells and introduce Ascl1-related molecules detected by comparative RNA-sequence analyses. The molecular classification of SCLC based on the expression of lineage-specific transcription or co-transcription factors, including ASCL1, NEUROD1, POU2F3, and YAP1, was recently proposed. We attempted to characterize these 4 SCLC subtypes using integrated immunohistochemical studies, which will provide insights into the molecular characteristics of these subtypes and clarify the inter- and intratumor heterogeneities of SCLC.

Supplementary document

Supplementary Table 1 Primers used for PCR amplification and sequencing Supplementary Table 2 Results of Multiplex PCR based MGH SNAPShot assay, Pyrosequencing and Sanger sequencing in YMG6 patient and xenograft cells Supplementary Table 3 Analysis of microsatellite instability in YMG6 parent and xenograft tumors Supplementary Table 4 Quantitative analysis for MGMT methylation status in YMG6 cells Supplementary Table 5 Multiplex PCR based MGH SnaPShot assay for oligodendroglial tumors Supplementary Table 6 Correlation of xenograft lethality and phosphorylation of PI3K pathway protein Supplementary Table 7 Phosphorylation in PI3K pathway in oligodendroglioma xenograft model Supplementary Table 8 Clinical characteristics in oligodendroglial tumor patients

Supplementary Figure S1-S7

Supplementary Figure 1. A, Hematoxylin and eosin, Ki-67, and IDH1R132H staining in each specimen. B, Sanger sequencing, immunohistochemical analysis, pyrosequencing, and FISH to identify YMG6 tumors as oligodendroglial tumors. C, Multiplex Ligation-dependent Probe Amplification assay demonstrating chromosome 1p and 19q co-deletion in YMG6R3F (left) and YMG6R3T (right). Bars, 50 �m. Supplementary Figure 2. A, DNA fingerprinting showing matched DNA identification in YMG6R3F (upper), YMG6R3T (middle), and YMG6R3T xenograft (YMG6R3Tsc1, lower). Supplementary Figure 3. Sanger sequencing indicating MSH6Ala1293Ser (left, arrow) and STK11Pro281Leu (right, arrow) in YMG6I. B, Immunohistochemical analysis demonstrating MSH6 expression in YMG6I (left) and YMG6R4T (right). C, Immunohistochemical analysis demonstrating LKB1/STK11 expression in YMG6I (left) and YMG23 (right, positive control). D, Sanger sequencing indicating MSH6Gly409Glu (arrow) in YMG6R4T. E, F, Upper gastrointestinal endoscopy (E) and colonoscopy (F) demonstrating no abnormal lesion in YMG6 patient. G, FDG-PET indicating no abnormal uptake in YMG6 patient. Bars, 50 �m. Supplementary Figure 4. Microsatellite instability (MSI)-PCR indicating microsatellite stable (MSS) in YMG6R2 and YMG6R3T. MSI-H, microsatellite instability high. MSS, microsatellite stable. Supplementary Figure 5. Immunohistochemical analysis demonstrating ATRX expression and weak expression of p53 in YMG6R3T. Supplementary Figure 6. Pyrosequencing indicating PIK3CAE542K (arrows) in YMG6I and YMG6R3T. B, Immunohistochemical analysis demonstrating phospho-AKT, -4EBP1, and -S6K expression in YMG6I and YMG6R1. Supplementary Figure 7. A, Multiplex Ligation-dependent Probe Amplification assay indicating 1p and 19q co-deletion in YMG6R3Tsc1. B, Sanger sequencing showing mutation in IDH1 (arrow; c.395G>A, left) and TERT (arrow; c.-124C>T, right) of YMG6R4Tsc1. Supplementary Figure 8. A, Overview and microscopic view of hematoxylin and eosin (H&E, upper), Ki-67 (middle) and IDH1R132H (lower) in first (YMG6R3Tsc1, left), second (YMG6R3Tsc2, middle), and third (YMG6R3Tsc3, right) generation YMG6R3T xenograft. B, H&E (upper), Ki-67 (middle), and IDH1R132H (lower) in YMG6R4Tsc1 (left), YMG6R4Tsc2 (middle), and YMG6R4Tsc3 (right). C, Sanger sequencing showing mutation of IDH1 (arrows, c.395G>A, left) and TERT (arrows, c.-124C>T, right), and PIK3CA (arrows, c.1624G>A) in YMG6R3Tsc2 (upper), YMG6R4Tsc2 (middle), and YMG6R4Tsc3 (lower). D, Immunohistochemical analysis demonstrating strong expression of phospho-AKT (Ser473, left), phospho-4EBP1 (middle), and phospho-S6K (right) in YMG6R4Tsc3. Bars, 50 �m. Supplementary Figure 9. A, Upper, Sanger sequencing showing IDH1 mutation (arrow, c.395 G>A), TERT (arrow, c.-124C>T), and PIK3CA (arrow, c.3140A>G) in YMG23. Lower, MLPA demonstrating chromosome 1p/19q co-deletion and CDKN2A (chr.9p.21) loss in YMG23 patient tumor. B, Immunohistochemical analysis demonstrating negative expression of p16INK4a/CDKN2A in YMG23 (upper). YMG5 (CDKN2A intact) served as positive control. C, Sanger sequencing showing mutations of IDH1 (arrow, c.395G>A, R132H, left) and TERT (arrow, c.-124C>T) in YMG5. D, Sanger sequencing showing mutations of IDH1 (arrow, c.395G>A), TERT (arrow, c.-124C>T), and PIK3CA (arrow, c.3140A>G) in YMG23sc1. E, MLPA demonstrating chromosome 1p/19q co-deletion and CDKN2A loss (chr.9p.21) in YMG23sc1. F, immunohistochemical analysis demonstrating negative expression of p16INK4a/CDKN2A in YMG23sc1. Bars, 50 �m. Supplementary Figure 10. A, B, C, Sanger sequencing showing IDH1 mutation (arrows, c.395G>A, R132H, left) and TERT promoter mutation (c.-124C>T, C228T or c.-146C>T, C250T), and in YMG46 (A), YMG28 (B) and YMG53 (C). PIK3CA mutation (c.1406A>G, E542G, arrow, A, right) in YMG46. D, Contrast enhancing MRI showing non-enhanced tumor recurrence at right frontal lobe (left). H&E (upper) and IDH1R132H staining (lower) in YMG53 (AOD, middle). Overview of H&E staining indicating no xenograft formation in YMG53sc1 (right). Bars, 50 �m. Supplementary Figure 11. A, Overview and magnification of hematoxylin and eosin staining of second passaged YMG23 xenograft model (YMG23sc2). B, C, Immunohistochemical analysis demonstrating expression of IDHR132H (B, left), Ki-67 (B, right), phospho-AKT (C, left), phospho-4EBP1 (C, middle), and phospho-S6K (C, right) in YMG23sc2. D, Sanger sequencing showing mutations in IDH1 (arrow, c.395 G>A), TERT (arrow, c.-124C>T), and PIK3CA (arrow, c.3140A>G) in YMG23sc2. Bars, 50 �m. Supplementary Figure 12. (A-D) Contrast enhanced MRI of the indicated patients at pre-treatment (left) and post-chemotherapy with/without radiotherapy (right). Supplementary Figure 13. Kaplan Meier Curve indicating no survival difference (P = 0.9) of overall survival in PIK3CA/PIK3RI- mutant (blue) and -wild-type (red) oligodendroglial tumor patients. Supplementary Figure 14. A, Relative cell viability of YMG28 (left) and YMG46 (right) cells after 3-day treatment with FK866 combined with DMSO control (blue bars) or TMZ (200 �M, purple bars). *, P

Primary central nervous system lymphoma (PCNSL) is an isolated type of lymphoma of the central nervous system and has a dismal prognosis despite intensive chemotherapy. Recent genomic analyses have identified highly recurrent mutations of MYD88 and CD79B in immunocompetent PCNSL, whereas LMP1 activation is commonly observed in Epstein–Barr virus (EBV)-positive PCNSL. However, a lack of clinically representative preclinical models has hampered our understanding of the pathogenic mechanisms by which genetic aberrations drive PCNSL disease phenotypes. Here, we establish a panel of 12 orthotopic, patient-derived xenograft (PDX) models from both immunocompetent and EBV-positive PCNSL and secondary CNSL biopsy specimens. PDXs faithfully retained their phenotypic, metabolic, and genetic features, with 100% concordance of MYD88 and CD79B mutations present in PCNSL in immunocompetent patients. These models revealed a convergent functional dependency upon a deregulated RelA/p65-hexokinase 2 signaling axis, codriven by either mutated MYD88/CD79B or LMP1 with Pin1 overactivation in immunocompetent PCNSL and EBV-positive PCNSL, respectively. Notably, distinct molecular alterations used by immunocompetent and EBV-positive PCNSL converged to deregulate RelA/p65 expression and to drive glycolysis, which is critical for intracerebral tumor progression and FDG-PET imaging characteristics. Genetic and pharmacologic inhibition of this key signaling axis potently suppressed PCNSL growth in vitro and in vivo. These patient-derived models offer a platform for predicting clinical chemotherapeutics efficacy and provide critical insights into PCNSL pathogenic mechanisms, accelerating therapeutic discovery for this aggressive disease.Significance:A set of clinically relevant CNSL xenografts identifies a hyperactive RelA/p65-hexokinase 2 signaling axis as a driver of progression and potential therapeutic target for treatment and provides a foundational preclinical platform.

Supplementary Table S1-S12

Purpose:Oligodendroglioma has a relatively favorable prognosis, however, often undergoes malignant progression. We hypothesized that preclinical models of oligodendroglioma could facilitate identification of therapeutic targets in progressive oligodendroglioma. We established multiple oligodendroglioma xenografts to determine if the PI3K/AKT/mTOR signaling pathway drives tumor progression.Experimental Design:Two anatomically distinct tumor samples from a patient who developed progressive anaplastic oligodendroglioma (AOD) were collected for orthotopic transplantation in mice. We additionally implanted 13 tumors to investigate the relationship between PI3K/AKT/mTOR pathway alterations and oligodendroglioma xenograft formation. Pharmacologic vulnerabilities were tested in newly developed AOD models in vitro and in vivo.Results:A specimen from the tumor site that subsequently manifested rapid clinical progression contained a PIK3CA mutation E542K, and yielded propagating xenografts that retained the OD/AOD-defining genomic alterations (IDH1R132H and 1p/19q codeletion) and PIK3CAE542K, and displayed characteristic sensitivity to alkylating chemotherapeutic agents. In contrast, a xenograft did not engraft from the region that was clinically stable and had wild-type PIK3CA. In our panel of OD/AOD xenografts, the presence of activating mutations in the PI3K/AKT/mTOR pathway was consistently associated with xenograft establishment (6/6, 100%). OD/AOD that failed to generate xenografts did not have activating PI3K/AKT/mTOR alterations (0/9, P < 0.0001). Importantly, mutant PIK3CA oligodendroglioma xenografts were vulnerable to PI3K/AKT/mTOR pathway inhibitors in vitro and in vivo—evidence that mutant PIK3CA is a tumorigenic driver in oligodendroglioma.Conclusions:Activation of the PI3K/AKT/mTOR pathway is an oncogenic driver and is associated with xenograft formation in oligodendrogliomas. These findings have implications for therapeutic targeting of PI3K/AKT/mTOR pathway activation in progressive oligodendrogliomas.

Primary central nervous system lymphoma (PCNSL) is an isolated type of lymphoma of the central nervous system and has a dismal prognosis despite intensive chemotherapy. Recent genomic analyses have identified highly recurrent mutations of MYD88 and CD79B in immunocompetent PCNSL, whereas LMP1 activation is commonly observed in Epstein–Barr virus (EBV)-positive PCNSL. However, a lack of clinically representative preclinical models has hampered our understanding of the pathogenic mechanisms by which genetic aberrations drive PCNSL disease phenotypes. Here, we establish a panel of 12 orthotopic, patient-derived xenograft (PDX) models from both immunocompetent and EBV-positive PCNSL and secondary CNSL biopsy specimens. PDXs faithfully retained their phenotypic, metabolic, and genetic features, with 100% concordance of MYD88 and CD79B mutations present in PCNSL in immunocompetent patients. These models revealed a convergent functional dependency upon a deregulated RelA/p65-hexokinase 2 signaling axis, codriven by either mutated MYD88/CD79B or LMP1 with Pin1 overactivation in immunocompetent PCNSL and EBV-positive PCNSL, respectively. Notably, distinct molecular alterations used by immunocompetent and EBV-positive PCNSL converged to deregulate RelA/p65 expression and to drive glycolysis, which is critical for intracerebral tumor progression and FDG-PET imaging characteristics. Genetic and pharmacologic inhibition of this key signaling axis potently suppressed PCNSL growth in vitro and in vivo. These patient-derived models offer a platform for predicting clinical chemotherapeutics efficacy and provide critical insights into PCNSL pathogenic mechanisms, accelerating therapeutic discovery for this aggressive disease. Significance: A set of clinically relevant CNSL xenografts identifies a hyperactive RelA/p65-hexokinase 2 signaling axis as a driver of progression and potential therapeutic target for treatment and provides a foundational preclinical platform.

Neuroendocrine carcinoma (NEC) is a rare subtype of malignant gallbladder tumor. Although surgical resection is the only potentially curative therapy for gallbladder NEC, most cases are surgically unresectable because of advanced stage disease and/or biologically aggressive behavior. The standard palliative treatment for malignant gallbladder tumors is chemotherapy; however, the efficacy of chemoradiotherapy in the treatment of gallbladder tumors is controversial. Here, we report a case of gallbladder NEC that showed a durable response to chemoradiotherapy. A 68-year-old Japanese man presented with a huge gallbladder tumor with liver and duodenal invasion. Pathological findings revealed poorly differentiated NEC of the gallbladder. After seven cycles of chemotherapy comprising cisplatin and irinotecan, computed tomography (CT) revealed remarkable tumor shrinkage, but an enlarged portal lymph node. The patient was treated with 50.4 Gy in 28 fractions with two cycles of cisplatin and etoposide. After chemoradiotherapy, the enlarged lymph node also decreased in size. Maximum standardized uptake value of fluorodeoxyglucose-positron emission tomography/CT(FDG-PET/CT) changed from 8.2 to physiological accumulation. We defined this condition as a complete response on both enhanced CT and FDG-PET/CT; therefore, we did not perform systemic treatment and only observed his condition. This patient remained healthy with no recurrence at 3 years after chemoradiotherapy.

Purpose: Oligodendroglioma has a relatively favorable prognosis, however, often undergoes malignant progression. We hypothesized that preclinical models of oligodendroglioma could facilitate identification of therapeutic targets in progressive oligodendroglioma. We established multiple oligodendroglioma xenografts to determine if the PI3K/AKT/mTOR signaling pathway drives tumor progression. Experimental Design: Two anatomically distinct tumor samples from a patient who developed progressive anaplastic oligodendroglioma (AOD) were collected for orthotopic transplantation in mice. We additionally implanted 13 tumors to investigate the relationship between PI3K/AKT/mTOR pathway alterations and oligodendroglioma xenograft formation. Pharmacologic vulnerabilities were tested in newly developed AOD models in vitro and in vivo. Results: A specimen from the tumor site that subsequently manifested rapid clinical progression contained a PIK3CA mutation E542K, and yielded propagating xenografts that retained the OD/AOD-defining genomic alterations (IDH1R132H and 1p/19q codeletion) and PIK3CAE542K, and displayed characteristic sensitivity to alkylating chemotherapeutic agents. In contrast, a xenograft did not engraft from the region that was clinically stable and had wild-type PIK3CA. In our panel of OD/AOD xenografts, the presence of activating mutations in the PI3K/AKT/mTOR pathway was consistently associated with xenograft establishment (6/6, 100%). OD/AOD that failed to generate xenografts did not have activating PI3K/AKT/mTOR alterations (0/9, P < 0.0001). Importantly, mutant PIK3CA oligodendroglioma xenografts were vulnerable to PI3K/AKT/mTOR pathway inhibitors in vitro and in vivo—evidence that mutant PIK3CA is a tumorigenic driver in oligodendroglioma. Conclusions: Activation of the PI3K/AKT/mTOR pathway is an oncogenic driver and is associated with xenograft formation in oligodendrogliomas. These findings have implications for therapeutic targeting of PI3K/AKT/mTOR pathway activation in progressive oligodendrogliomas.

In the revised World Health Organization classification 2016, anaplastic pleomorphic xanthoastrocytoma (PXA) has been newly defined as a variant of the PXA entity. Furthermore, some anaplastic PXA were reported to have extremely poor prognosis which showed a type of pediatric glioblastoma (GBM) molecular profile. Recent integrated molecular classification for primary central nervous system tumors proposed some differences between histological and molecular features. Herein, in a genome‐wide molecular analysis, we show an extreme aggressive anaplastic PXA that resulted in a pediatric GBM molecular profile. A full implementation of the molecular approach is the key to predict prognosis and decide the treatment strategy for anaplastic PXA.

Partial deletions in chromosomes 1p and 19q are found in a subset of astrocytic tumors; however, it remains unclear how these alterations affect their histological features and prognosis. Herein, we present 3 cases of isocitrate dehydrogenase (IDH)-mutant astrocytoma with chromosome 19q13 deletion. In the first case, the primary tumor harbored an IDH1 mutation with chromosome 1p/19q partial deletions, which covered 19q13 and exhibited a durable initial response to radiotherapy and temozolomide (TMZ) treatment. However, the tumor lost the chromosome 1p/19q partial deletions at recurrence and became resistant to TMZ. Histologically, an oligodendroglioma-like feature was found in the primary tumor but not in the recurrent tumor. Capicua transcriptional repressor (CIC), located on 19q13, was less expressed in the primary tumor but was highly expressed in the recurrent tumor. Similar histological findings were observed in 2 other astrocytic tumors with IDH1 or IDH2 mutations. These tumors also had chromosome 19q13 deletion, including the CIC gene, weakly expressed CIC, and oligodendroglioma-like morphology. These tumors recurred at 6 and 32 months, respectively. These findings suggest that IDH-mutant astrocytoma with chromosome 19q13 partial deletion, including the CIC gene, may induce an oligodendroglioma-like phenotype, but the clinical prognosis may not be similar to that of genetically defined oligodendroglioma.

Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle.

Hemangiopericytoma/solitary fibrous tumor (HPC/SFT) is a perivascular mesenchymal tumor often found unexpectedly on histopathological examination, and occasionally shows malignant behavior. The incidence of intraoral HPC/SFT is extremely rare. We report a case of HPC/SFT located in the buccal mucosa. A 50-year-old woman presented with a 5-year history of a painless mass in the left buccal mucosa. Clinical findings showed the lesion was a well-defined tumor between the cheek skin and buccal mucosa with two feeding arteries, indicating hemangioma. The tumor was completely resected under general anesthesia. Histopathologically, immunostaining for STAT6 revealed results consistent with HPC/SFT, and no findings suggestive of malignancy, such as tumor size greater than 5 cm and high proliferative activity as shown by mitotic index and Ki-67 index. No other distinct primary lesion or distant metastasis was detected on whole-body computed tomography. Dealing with the lesion as a precancerous or potentially malignant tumor, follow-up was performed for 5 years after surgery, but neither recurrence nor metastasis was observed. As recurrence or metastasis may be delayed by many years, follow-up needs to be continued long-term according to risk factors of malignant behavior such as tumor size, cell characteristics and proliferative activity.

Background: Intraventricular tumors can generally result in obstructive hydrocephalus as they grow. Rarely, however, some intraventricular tumors develop superficial siderosis (SS) and trigger hydrocephalus, even though the tumor has hardly grown. Here, we present an illustrative case of SS and nonocclusive hydrocephalus caused by subependymoma of the lateral ventricles. Case Description: A 78-year-old man with an intraventricular tumor diagnosed 7 years ago had been suffering from gait disturbance for 2 years. He also developed cognitive impairment. Intraventricular tumors showed little growth on annual magnetic resonance imaging (MRI). MRI T2-star weighted images (T2*WI) captured small intratumoral hemorrhages from the beginning of the follow-up. Three years before, at the same time as the onset of ventricular enlargement, T2*WI revealed low intensity in the whole tumor and cerebral surface. Subsequent follow-up revealed that this hemosiderin deposition had spread to the brain stem and cerebellar surface, and the ventricles had expanded further. Cerebrospinal fluid (CSF) examination revealed xanthochromia. The tumor was completely removed en bloc. Histopathological findings were consistent with those of subependymoma. Although CSF findings improved, SS and hydrocephalus did not improve. Therefore, the patient underwent a lumboperitoneal shunt for CSF diversion after tumor resection. Conclusion: Some intraventricular tumors cause SS and nonobstructive hydrocephalus due to microbleeding, even in the absence of tumor growth. T2*WI and, if necessary, timely CSF examination can allow identification of presymptomatic SS. This follow-up strategy may provide a favorable course by facilitating early intervention in patients with intraventricular lesions, not just subependymomas.

Succinate dehydrogenase-deficient renal cell carcinoma (SDH-deficient RCC) is a newly introduced histological type of RCC, which is caused by loss of subunit genes of SDH. It is known to frequently demonstrate familial occurrence and be frequently associated with gastrointestinal stromal tumors and paraganglioma. To date, only 53 cases have been reported. Here, we present an additional case of SDH-deficient RCC occurring in a 40-year-old female. The tumor was histologically biphasic, consisting of tubular and solid architectures. The tumor cells possessed oval nuclei with small nucleoli, and an eosinophilic granular cytoplasm with occasional vacuoles. These cells completely lost the immunohistochemical expression of B subunit of SDH (SDHB). Consequently, the tumor was diagnosed as SDHB-deficient RCC. We identified a novel germ line mutation of the SDHB gene, and also confirmed a hemizygous deletion of the wild-type allele in the tumor cells. To define the pathological characteristics of SDH-deficient RCC, precise diagnosis and accumulation of more cases are required.

Small cell lung cancer (SCLC) is one of the most malignant neoplasms in common human cancers. The tumor is composed of small immature-looking cells with a round or fusiform shape, which possesses weak adhesion features among them, suggesting that SCLC shows the morphological characteristics of epithelial to mesenchymal transition (EMT). SCLC is characterized by high metastatic and recurrent rates, sensitivity to the initial chemotherapy, and easy acquirement of chemoresistance afterwards. These characters may be related to the EMT phenotype of SCLC. Notch signaling is an important signaling pathway, and could have roles in regulating neuroendocrine differentiation, proliferation, cell adhesion, EMT, and chemoresistance. Notch1 is usually absent in SCLC in vivo, but could appear after chemotherapy. Notch1 can enhance cell adhesion by induction of E-cadherin in SCLC, which indicates mesenchymal to epithelial transition. On the other hand, achaete-scute complex homologue 1 (ASCL1), negatively regulated by Notch signaling, is a lineage-specific gene of SCLC, and functions to promote neuroendocrine differentiation as well as EMT. ASCL1-transfected adenocarcinoma cell lines induced neuroendocrine phenotypes and lost epithelial cell features. SCLC is characterized by neuroendocrine differentiation and EMT-like features, which could be produced by inactive Notch signaling and ASCL1 expression. In addition, chemical and radiation treatments can activate Notch signaling, which suppress neuroendocrine differentiation and induces chemoradioresistance, accompanied by secession from EMT. Thus, the status of Notch signaling and ASCL1 expression may determine the cell behaviors of SCLC partly through modifying EMT phenotypes.

Epithelioid glioblastoma (E-GBM) arises at younger age, commonly disseminates to cerebrospinal fluid, and results in dismal prognosis. About half of E-GBM harbors BRAF V600E mutation, thus BRAF/MEK inhibitors are expected to be specifically sensitive to E-GBM like other BRAF V600E mutant carcinomas. However, therapeutic effect is limited by the emergence of drug resistance. To overcome this issue, it is crucial to elucidate the treatment resistance mechanisms by clinically representative models. Herein, we establish 2 paired E-GBM patient-derived xenograft (PDX) models from young adult patients (YMG62 and YMG89) with BRAF V600E, TERT promoter mutations and CDKN2A homozygous deletions. The YMG62 patient received dabrafenib with trametinib, while YMG89 patient received dabrafenib monotherapy after recurrence with standard treatment. The YMG62 patient was refractory to combination therapy. The YMG89 patient was initially responded to dabrafenib, but gradually became resistant and the 2 patients died due to CNS dissemination. Paired PDX models were established from tumors prior and after molecular target therapy. All PDXs were formed as CNS dissemination model, which were recapitulated to the patient characteristics. BRAF/MEK inhibitors strongly suppressed cell viability in primary tumor (YMG89P). However, BRAF/MEK inhibitors became resistant in recurrent tumor (YMG89R). YMG62 paired PDXs were resistant to molecular target therapy. Western blotting indicated retained MAPK signaling pathway and/or increased AKT phosphorylation after BRAF/MEK inhibitors treatment in refractory and recurrent cells, which indicates crucial role of re-activation in the MAPK signaling pathway and/or PI3 kinase pathway for tumor maintenance in BRAF V600E mutant E-GBM. We have done high throughput drug screening to identify compounds to overcome resistant to molecular target therapy. Our established E-GBM paired PDX models recapitulate patient characteristics, which may uncover treatment resistant mechanism and novel therapeutic target in E-GBM.

Epithelioid glioblastoma (E-GBM) predominantly arises at younger age and promotes dismal prognosis. Because of its rare etiology, pathological and genetical characterization of E-GBM remains elusive. Herein, we report unique patient-derived E-GBM xenograft (PDX) models from 3 E-GBM patients (2 BRAFV600E mutant and 1 BRAFV600E wild-type). Two BRAF mutant E-GBM cells (YMG62 and YMG89) were originated from adolescent and young adult patients and harbored TERT promoter mutation and CDKN2A homozygous deletion, while 1 BRAFV600E E-GBM cell (YMG64) was from elderly patient and had TERT wild-type. YMG62 and YMG89 could be propagated at multiple passage in vitro, while YMG64 could not be maintained. PDX models were established from YMG62, YMG89, and YMG64. All PDX tumors were preferentially disseminated and negative expression of GFAP, which were recapitulated to the patient characteristics. BRAF and MEK inhibitor mildly suppressed cell viability in vitro. Collectively, E-GBM PDX models recapitulate patient characteristics, which may be helpful to elucidate tumor biology and establish novel therapeutic target in E-GBM.

Leukoencephalopathies encompass all clinical syndromes that predominantly affect brain white matter. Genetic diagnosis informs clinical management of these patients, but a large part of the genetic contribution to adult leukoencephalopathy remains unresolved. To examine this genetic contribution, we analyzed genomic DNA from 60 Japanese patients with adult leukoencephalopathy of unknown cause by next generation sequencing using a custom-designed gene panel. We selected 55 leukoencephalopathy-related genes for the gene panel. We identified pathogenic mutations in 8 of the 60 adult leukoencephalopathy patients (13.3%): NOTCH3 mutations were detected in 5 patients, and EIF2B2, CSF1R, and POLR3A mutations were found independently in 1 patient each. These results indicate that cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL) caused by NOTCH3 mutations is the most frequent adult leukoencephalopathy in our cohort. Moreover, brain imaging analysis indicates that CADASIL patients who do not present typical phenotypes may be underdiagnosed if not examined genetically.

Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle.

Ependymomas are primary neuroepithelial malignancies that mainly occur during childhood, and arise from ependymal cells along the ventricular systems of the CNS. Recently, it was elucidated that two-thirds of supratentorial (ST) ependymomas harbor oncogenic fusions of RELA, whose protein product is the principal effector of canonical NF-κB signaling. RELA fusion proteins activate signaling for tumor proliferation and malignant progression, resulting in poorer prognoses in these patients compared to those in patients with other ST ependymomas. In this study, we encountered a case of C11orf–RelA fusion-positive ST anaplastic ependymoma that was diagnosed in first tumor resection surgery of multi-staged gross total resection with molecular evidence. In ependymomas, regardless of tumor location or pathological grade, subtotal resection is associated with higher rates of mortality compared with GTR. Molecular analysis based on the application of recent molecular knowledge for ST ependymomas performs a role in appropriate and individualized treatment strategies.

Succinate dehydrogenase-deficient renal cell carcinoma (SDH-deficient RCC) is a newly introduced histological type of RCC, which is caused by loss of subunit genes of SDH. It is known to frequently demonstrate familial occurrence and be frequently associated with gastrointestinal stromal tumors and paraganglioma. To date, only 53 cases have been reported. Here, we present an additional case of SDH-deficient RCC occurring in a 40-year-old female. The tumor was histologically biphasic, consisting of tubular and solid architectures. The tumor cells possessed oval nuclei with small nucleoli, and an eosinophilic granular cytoplasm with occasional vacuoles. These cells completely lost the immunohistochemical expression of B subunit of SDH (SDHB). Consequently, the tumor was diagnosed as SDHB-deficient RCC. We identified a novel germ line mutation of the SDHB gene, and also confirmed a hemizygous deletion of the wild-type allele in the tumor cells. To define the pathological characteristics of SDH-deficient RCC, precise diagnosis and accumulation of more cases are required.

Endometrial stromal tumors (ESTs) are composed of cells resembling endometrial stroma, and are divided into benign and malignant types based on morphology. Endometrial stromal nodule (ESN) is a benign localized tumor, and endometrial stromal sarcoma (ESS) is an infiltrative and potentially metastatic neoplasm. A series of genetic aberrations contribute to pathological diagnosis of ESTs. At present, subsets of ESN and ESS-low grade (ESS-LG) are characterized as JAZF1-SUZ12/JJAZ1 gene fusion. The ESTs that show higher grade atypia but lack nuclear pleomorphism include YWHAE-FAM22 ESS. Here we report an unusual case of ESTs. Sudden colonic perforation occurred to the patient, and emergency surgery was performed. Pathological findings suggested metastatic ESS. Thorough medical examination of the genital organs detected a 1 cm-sized well-demarcated uterine tumor. Microscopically, the tumor lacked infiltrative features, conforming to the definition of ESN. Both lesions demonstrated identical cytology and shared JAZF1-SUZ12 gene fusion. Endometriosis was not found in any areas of the resected organs, strongly suggesting that the uterine orthotopic tumor metastasized. The current case uncovered the problems of differential diagnosis between ESN and ESS-LG. We demonstrate detailed pathological features of the two lesions, and discuss the possibility of orthotopic EST with limited infiltration to develop into ESS-LG.

Gap junction intercellular communication (GJIC) is considered to play roles in regulation of homeostasis, development and differentiation of many tissues. In the present study, using reverse transcription-polymerase chain reaction (RT-PCR) and in situ RT-PCR, we examined expression of Connexins (Cx26, 32, 37, 40, 43 and 45) in the normal lung and lung tumors of mice to determine whether their expressions change during lung tumorigenesis. Cx26, 32 and 40 were expressed similarly in the normal lung tissue and tumors with smaller size (0.5–1.5 mm) though expression of Cx32 and 40 decreased in tumors with larger size (>2.5 mm). Cx26 was undetectable in larger size tumors. Cx37 and 45 were expressed in both normal lung and larger size tumors but no expression was seen in smaller size tumors. Cx43 was similarly detectable in normal lung, smaller size tumor and larger size tumor, but western blotting showed that Cx43 was phosphorylated during lung tumorigenesis. Thus, it is likely that alteration of expression of these Cx may be involved in expression of the neoplastic phenotype.

A 45-year-old man complained of a palpable mass in his left abdomen. Computed tomography showed a horseshoe kidney with a Bosniak type II complicated cyst from a left segment. Three years after his initial examination, due to the growing cystic lesion and the compression imposed on the urinary collecting system and surrounding organs, we performed a left heminephrectomy. The diagnosis was mucinous cystadenoma of the kidney. No recurrence was observed 6 months after surgery. The histopathology was unique since the inner surface of the cyst was covered by a mucin-positive columnar epithelium connected to a urothelium, with continuous transition between the two. This suggests that the mucinous tumour may have originated from a sequestered segment of the renal pelvic epithelium in the renal parenchyma.

Objectives: To evaluate the effects of the nerve-muscle pedicle (NMP) method on the rat thyroarytenoid (TA) muscle after transection of the recurrent laryngeal nerve (RLN). Study Design: Quantitative histologic assessment of the TA muscle after NMP implantation. Methods: Thirty-six Wistar rats were divided into two groups: animals subjected to transection of the left RLN alone (DNV group) and animals subjected to transection of the left RLN followed by immediate transplantation of a NMP flap containing the sternohyoid (SH) muscle and ansa cervicalis nerve branch (NMP group). Animals were killed 2, 4, and 10 weeks after the treatments. The TA muscle stained with hematoxylin-eosin was evaluated quantitatively. The pre- and postsynaptic structures of the neuromuscular junction (NMJ) in the TA muscle were analyzed histochemically. The myosin heavy chain (MyHC) isoforms were evaluated using immunohistochemistry and reverse-transcriptase polymerase chain reaction (RT-PCR). Results: In the NMP group, the TA muscle fiber recovered to almost normal at 10 weeks, and the ratio of the number of synaptophysin-positive nerve terminals to that of α-bungarotoxin-positive acetylcholine receptors recovered to 79.8 ± 11.8% (P < .05, compared with the control). Immunohistochemistry and the RT-PCR method after laser capture microdissection revealed the expression of MyHC isoforms type 2B and type 2A; the latter was detected in the SH muscle but not in the normal or denervated TA muscle. Conclusion: The NMP method was effective for recovering from the atrophic changes of the TA muscle after transection of the RLN. This was attributed to successful reinnervation by reconstruction of the NMJ, which might change MyHC isoform expression.

Trichoblastic carcinoma is a rare skin cancer originating from hair germ cells. We report a case of an 84-year-old man who presented with a tumor on the stoma of the descending colon, which was preoperatively diagnosed as colon cancer. He underwent colectomy with adjacent skin, and the tumor was diagnosed as trichoblastic carcinoma by postoperative pathological examination. We are not aware of any similar cases published in the English literature. Therefore, we report this case because it is quite a rare condition.

Afferent loop necrosis after Roux-en-Y cholangiojejunostomy biliary reconstruction is rare. We present the case of a 36-year-old woman with acute necrotic afferent loop obstruction. The peripheral area of the Roux-en-Y limb, including the cholangiojejunostomy portion, was twisted just proximal to the cholangiojejunostomy. Cholangiojejunostomy was completely separated due to necrosis of the Roux-en-Y jejunum. In addition to the case report, we discuss features of cholangiojejunostomy that require special attention.

Adult male mice were continuously treated with bromodeoxyuridine (BrdU) for 1, 2, or 4 weeks by an osmotic pump. To detect BrdU-label-retaining cells (LRCs), putative progenitor/stem cells, other animals were continuously treated with BrdU for 2 weeks, and were then kept without any treatments for 2, 6, or 18 months. The lungs were fixed with 4% paraformaldehyde, and were paraffin-embedded. We observed terminal bronchioles with BrdU immunostaining alone or with BrdU immunostaining accompanying immunostaining for Clara cell secretory protein (CCSP), forkhead box protein J1 (FoxJ1), or calcitonin gene-related peptide (CGRP). The average incidences of BrdU-incorporated cells in the terminal bronchioles after 1, 2, and 4 weeks of continuous BrdU infusion were 6.2%, 11.9%, and 23.1%, respectively. Most BrdU-incorporated cells in these periods were CCSP-immunoreactive (91.7%, 91.3%, and 88.2%, respectively), which means progenitor function of Clara cells. FoxJ1-immunoreactive BrdU-incorporated cells were fewer (5.4%, 3.0%, 2.7%, respectively). The average incidences of BrdU-LRCs in the terminal bronchioles after 2, 6, and 18 months were 7.2%, 4.3, and 2.7%, respectively. Most BrdU-LRCs were CCSP-immunoreactive (91.0%, 92.7%, and 89.6%, respectively), and FoxJ1-immunoreactive BrdU-LRCs were fewer (6.0%, 5.7%, and 2.1%, respectively). CGRP-positive BrdU-incorporated cells were occasional. CGRP-positive BrdU-LRCs were detected in 17.6% of neuroepithelial bodies (NEBs) at 2 months, but disappeared at 6 months. BrdU-positive stem cell candidates, which locate at the brochiolo-alveolar duct junction or cover NEB, were few throughout this study. In conclusion, in the lungs treated only with BrdU, CCSP-immunoreactive cells are important to maintain homeostasis in the terminal bronchiolar epithelium.

Semaphorin III/collapsin-1 (Sema3A) guides a specific subset of neuronal growth cones as a repulsive molecule. In this study, we have investigated a possible role of non-neuronal Sema3A in lung morphogenesis. Expression of mRNAs of Sema3A and neuropilin-1 (NP-1), a Sema3A receptor, was detected in fetal and adult lungs. Sema3A-immunoreactive cells were found in airway and alveolar epithelial cells of the fetal and adult lungs. Immunoreactivity for NP-1 was seen in fetal and adult alveolar epithelial cells as well as endothelial cells. Immunoreactivity of collapsin response mediator protein CRMP (CRMP-2), an intracellular protein mediating Sema3A signaling, was localized in alveolar epithelial cells, nerve tissue and airway neuroendocrine cells. The expression of CRMP-2 increased during the fetal, neonate and adult periods, and this pattern paralleled that of NP-1. In a two-day culture of lung explants from fetal mouse lung (E11.5), with exogenous Sema3A at a dose comparable to that which induces growth cone collapse of dorsal root ganglia neurons, the number of terminal buds was reduced in a dose-dependent manner when compared with control or untreated lung explants. This decrease was not accompanied with any alteration of the bromodeoxyuridine-positive DNA-synthesizing fraction. A soluble NP-1 lacking the transmembrane and intracellular region, neutralized the inhibitory effect of Sema3A. The fetal lung explants from neuropilin-1 homozygous null mice grew normally in vitro regardless of Sema3A treatment. These results provide evidence that Sema3A inhibits branching morphogenesis in lung bud organ cultures via NP-1 as a receptor or a component of a possible multimeric Sema3A receptor complex.

To elucidate the role of p53 and apoptosis in the pathogenesis of lung injury, we examined histological changes, expressions of p53 and p21waf1/cip1 (p21), apoptosis, DNA double strand breaks, cell kinetics, and DNA synthesis in C57/BL6 mice (p53+/+) and mice deficient for p53 (p53−/−) at 2 hours to 7 days after a single intravenous administration of bleomycin. We also compared these parameters between the lung cells and small intestinal epithelial cells to explore potential differences in their response to DNA damage. Bleomycin induced p21 expression in a p53-dependent manner in p53+/+ mice but neither p53 nor p21 expression in p53−/− mice. In the lung of both groups of mice, focal inflammation followed by fibrosis was observed, but there was no evidence of apoptosis. Cells with DNA breaks and those undergoing DNA synthesis were unequivocally increased, but the cycling cell fraction remained unchanged, suggesting that the DNA synthesis detected in the lung reflected unscheduled DNA synthesis for repair of damaged DNA. DNA breaks and unscheduled DNA synthesis were prolonged in p53−/− mice compared to p53+/+ mice. By contrast, in the small intestine, marked cell cycle arrest and extensive apoptosis were evoked in the cycling crypt cells of both groups of mice, but these changes were milder and DNA breaks remained detectable for a longer time in p53−/− mice than in p53+/+ mice. Among the resting enterocytes in the villi, apoptosis was observed almost equally in both groups, but repair of DNA breaks was significantly delayed in the p53−/− mice. These observations imply that apoptosis is mediated largely by the p53-dependent pathway in the crypts but exclusively by the p53-independent pathway in the villi, that this pathway is particularly important in DNA repair in the villi, and that despite this difference in the significance of apoptosis, p53 plays an important role in DNA repair in both the crypts and villi. Our results suggest that the lung cells and small intestinal cells respond to the bleomycin treatment in different ways in terms of the induction of apoptosis and that p53 carries out an essential role in the early response to and repair of DNA damage by a non-apoptotic mechanism which appears to be crucial in the noncycling lung cells and enterocytes. Importantly, the p53-p21 pathway and apoptosis are unlikely to be essential for bleomycin-induced tissue injury in the lung.

In order to ascertain that alpha-subunit of guanine nucleotide-binding protein Go (Go alpha)-positive cells in the lung epithelia are pulmonary neuroendocrine cells (PNECs), we carried out an immunohistochemical study in young adult and fetal lungs of rodents and in cultured fetal lung explants. Serial sections showed that Go alpha-positive cells were immunostained for calcitonin gene-related peptide and serotonin in young adult mouse, rat, and hamster lungs and that these cells are, therefore, PNECs. In the fetal lungs of hamster and mouse, Go alpha-positive PNECs appeared in the epithelium of the lobar bronchus by gestational day 13 in hamster and by day 15.5 in mouse, and they increased with a proximal-to-distal wave during the late fetal period. Explants of immature lung from the fetal hamster on gestational day 11 were cultured. After 2 days of culture, Go alpha-positive PNEC clusters appeared in the main and lobar bronchi and many PNEC clusters were seen after 4 days of culture. To determine the functional significance of Go in the development of the fetal lung, pertussis toxin, a Go inhibitor, was added to the medium, and changes in branching morphogenesis and PNEC development were studied. Although branching morphogenesis was not disturbed by pertussis toxin, the toxin treatment induced large PNEC clusters in the cultured lung explant. In summary, we showed that Go alpha is a neuroendocrine marker for PNECs and that Go alpha-positive cells appear along with development of PNECs in fetal hamster lung in vivo and in vitro. The functional significance of Go in the development of fetal lung is obscure, but signals mediated through this GTP-binding protein could be related to some functions of PNECs.

To clarify the process and mechanisms of the development and progression of peripheral lung adenocarcinoma, we investigated the relationships among the patterns of basement membrane (BM), stromal fibrosis, and the expressions of gelatinase A and tissue inhibitor of metalloproteinases-2 (TIMP-2) in 33 lesions of atypical alveolar cell hyperplasia (AAH) and 48 lesions of lung adenocarcinoma, including 24 lesions of bronchioloalveolar carcinoma (BAC). We found that the architecture of alveolar BM was intact in all 33 AAH lesions and 11 nonsclerosing BAC lesions that formed no central scar, suggesting that these lesions are early-stage intraepithelial neoplasia. The preexistent BM of the lung was disrupted, and the BM components around the neoplastic glands were disrupted or absent in the area of the central scar of some sclerosing BAC lesions with collapse fibrosis alone (2 of 4) and in those of all of the adenocarcinoma lesions associated with desmoplastic stromal fibrosis (nine sclerosing BAC and 24 non-BAC tumors). These results suggested that, in lung adenocarcinomas, destruction of the BM was correlated with the formation of a central scar, particularly with desmoplasia. It is likely that adenocarcinomas with a central scar are advanced and invasive cancers potentially having metastatic activity. The expression of gelatinase A and TIMP-2 was associated with central scar formation as well as with destruction of the BM components. Both the neoplastic and stromal cells expressed gelatinase A and TIMP-2 and probably play a role in tumor cell invasion.

We have examined the distribution of calcium-binding proteins (CaBPs) in adult and fetal lungs of Syrian golden hamsters (Mesocricetus auratus) using immunostaining with confocal laser microscopy and electron microscopy. Single and grouped (neuroepithelial body; NEB) endocrine cells were distributed from bronchi to alveolar ducts in the adult lung. Serial frozen sections immunostained for CaBPs in combination with immunostaining for endocrine markers such as calcitonin gene-related peptide, serotonin, PGP9.5, and synaptophysin revealed that positive immunostaining for calbindin-D28K (CB-D28K) was seen in single endocrine cells and NEBs. However, other so-called EF-hand family CaBPs, parvalbumin and calretinin, were not detected. Electron microscopically, positive immunoreaction for CB-D28K was mainly in the organelle-free cytoplasmic matrix of endocrine cells, and partly in nuclei and associated with secretory granules and endoplasmic reticulum. In fetal developing lungs, endocrine cells appeared first on gestational day 13, and they were positive for all the endocrine markers used. However, pulmonary endocrine cells were positively immunostained for CB-D28K from gestational days 15 and 16 onward. In summary, our observations suggest that CB-D28K is a useful marker for endocrine cells of the lung, and CB-D28K could function as a mediator of endocrine stimulation or calcium homeostasis in pulmonary endocrine cells.

Endometrial stromal tumors (ESTs) are composed of cells resembling endometrial stroma, and are divided into benign and malignant types based on morphology. Endometrial stromal nodule (ESN) is a benign localized tumor, and endometrial stromal sarcoma (ESS) is an infiltrative and potentially metastatic neoplasm. A series of genetic aberrations contribute to pathological diagnosis of ESTs. At present, subsets of ESN and ESS-low grade (ESS-LG) are characterized as JAZF1-SUZ12/JJAZ1 gene fusion. The ESTs that show higher grade atypia but lack nuclear pleomorphism include YWHAE-FAM22 ESS. Here we report an unusual case of ESTs. Sudden colonic perforation occurred to the patient, and emergency surgery was performed. Pathological findings suggested metastatic ESS. Thorough medical examination of the genital organs detected a 1 cm-sized well-demarcated uterine tumor. Microscopically, the tumor lacked infiltrative features, conforming to the definition of ESN. Both lesions demonstrated identical cytology and shared JAZF1-SUZ12 gene fusion. Endometriosis was not found in any areas of the resected organs, strongly suggesting that the uterine orthotopic tumor metastasized. The current case uncovered the problems of differential diagnosis between ESN and ESS-LG. We demonstrate detailed pathological features of the two lesions, and discuss the possibility of orthotopic EST with limited infiltration to develop into ESS-LG.

The subcellular localization of five isoforms of facilitated-diffusion glucose transporters (GLUTs), from GLUT1 to GLUT5, in rat pancreatic islets was studied by immunohistochemistry using rabbit polyclonal antisera against mouse or rat GLUT peptides. Animals were perfusion-fixed with phosphate-buffered 4% paraformaldehyde and the pancreases were removed. Some specimens were embedded in paraffin, serially sectioned, and immunostained for glucagon, insulin, somatostatin, and the GLUTs for light microscopic observation. Others were prepared for immunoelectron microscopy by the post-embedding method. By these methods, GLUT2 immunostaining was observed on the lateral membranes of pancreatic beta-cells, whereas GLUT3 immunoreaction was predominantly localized in the cytoplasm of beta-cells and was not found in alpha-cells. In contrast, GLUT5 immunostaining was preferentially localized in the cytoplasm of alpha-cells compared to that of beta-cells. However, GLUT1 and GLUT4 were either barely or not at all detectable in any cells. These results suggest that rat islets take up glucose by at least three different processes and that blood glucose levels could be modulated differentially by: a high Km glucose transporter, GLUT2, in beta-cells; by a low Km glucose transporter, GLUT3, in beta-cells; and by a low Km glucose transporter, GLUT5, in alpha-cells.

Brefeldin A induces a rapid redistribution of coat proteins associated with clathrin-coated vesicles that bud from the trans-Golgi network but not of those associated with vesicles derived from the plasma membrane. Its effect on glucose transport and the subcellular distribution of the glucose transporter GLUT4 were therefore investigated in the absence or in the presence of insulin in order to characterize the mechanism of insulin-induced GLUT4 recycling. Exposure of rat adipose cells to brefeldin A in the absence of insulin resulted in a slight increase both in 3-O-methy-d-glucose transport and in the amount of GLUT4 in the plasma membrane as determined by immunoblot analysis. In contrast, it had no effect on the insulin-induced increase in 3-O-methyl-glucose transport and plasma-membrane-associated GLUT4. Immunohistochemical analysis revealed clathrin immunoreactivity in the juxtanuclear region and in the cell periphery, and the staining in the perinuclear region decreased after exposure of cells to 35 μM brefeldin A. However, it had no effect on the basal pattern of GLUT4 staining or on the insulin-induced redistribution of GLUT4 staining to the cell periphery. These results suggest that basal recycling of GLUT4 responsible for maintaining the intracellular location of the transporter may include a membrane budding step sensitive to brefeldin A, possibly associated with clathrin-coated vesicles, but that the insulin-stimulated GLUT4 recycling pathway is mediated predominantly by a brefeldin A-insensitive mechanism.

We examined the immunolocalization of stage-specific embryonic antigen-1 (SSEA-1) and related antigens in the developing trachea and lungs of fetal hamsters both in vitro and in vitro. On gestational days 10-16 (the day ot birth), fetal tracheas and lungs were fixed in phosphate-buffered paraform-aldehyde and frozen. Frozen sections were incubated with monoclonal antibodies against SSEA-1 (Lex hapten), sialyl SSEA-1 carrying i antigen and fucosyl SSEA-1 (LeYhapten). Some sections were treated with FITC-labeled secondary antibody for observation by confocal laser microscopy, and others were treated with colloidal gold-labeled secondary antibody for ultrastructural observation. In the developing tracheas, preferential staining in the ventral and lateral tracheal epithelium appeared for all of the antibodies by day 15, and ultrastructural study demonstrated that the regional difference in staining occurred regardless of cell type. In the developing lungs, positive sialyl SSEA-1-i antigen immunostaining was seen in the terminal portion of the epithelium by day 14, and the staining disappeared during the postnatal period. An in vitro study using explant organ culture of gestational day-11 lung with trachea revealed similar immuno-localization patterns. In the cultured trachea, the regional difference in immuno-staining was also seen with development of cartilage and smooth muscle, and in the cultured lung, the staining intensity became stronger in the terminal epithelium than in larger airway epithelium.

We examined the roles of the PI3K-AKT signalling pathway in fetal lung development. By Western blotting, phosphorylated AKT (pAKT) was highly expressed in fetal days 12 and 14 with decreased expression thereafter. By immunohistochemistry, pAKT was expressed mainly in the respiratory epithelium of early fetal days. We examined the effects of fibroblast growth factor 1 (FGF1), PI3K inhibitors (LY294002 and wortmannin), MAPK inhibitor (PD98059) and both of FGF1 and each inhibitor on lung morphogenesis, BrdU incorporation and apoptosis. In the FGF1-treated explants, the number of terminal buds and BrdU-labelled cells increased significantly, while the LY294002-, wortmannin-, PD98059-treated explants demonstrated obvious decreases. The effects by FGF1 were inhibited by LY294002, wortmannin and PD98059. Regardless of the presence of FGF1, the LY294002-, wortmannin- and PD98059-treated explants increased apoptosis revealed by terminal deoxynucleotidyl transferase-mediated dUTP nick end labelling assay in the mesenchyme of the explants. At the same time, the effect of LY294002, wortmannin, PD98059 on expression of surfactant apoprotein C (SPC) were also studied. The LY294002 and wortmannin treatments showed decreased expression of SPC. These findings suggest that the PI3K-AKT signalling pathway plays a pivotal role in mouse lung development through various biological processes.

Calcitonin gene-related peptide (CGRP) is one of the major neuropeptides released from sensory nerve endings and neuroendocrine cells of the lung. Two CGRP isoforms, alpha-and beta-CGRP, have been identified in rats and humans, but no studies have attempted to reveal direct evidence of differences in action or location of these isoforms in allergic inflammation (AI). We investigated mRNA expressions of alpha-and beta-CGRP in lungs, nodose ganglia (NG), and dorsal root ganglia (DRG) of an animal model for AI of the airways, utilizing a model created by sensitizing Brown Norway (BN) rats with ovalbumin (OVA). By semiquantitative RT-PCR analysis, long-lasting enhanced expression of the beta-CGRP mRNA was shown in the lungs of the AI rats (14.5-fold enhancement at 6 hr, 8.1-fold at 24 hr, and 3.7-fold at 120 hr after OVA-challenge compared to the level in the lungs of phosphate-buffered saline (PBS)-challenged control rats). In contrast, the mRNA expression of the alpha-CGRP in AI lungs showed only a transient increase after OVA-challenge (2.7-fold at 6 hr) followed by a lower level of expression (0.5-fold at 48 hr and 0.6-fold at 120 hr). The mRNA expressions of both isoforms in NG, but not in DRG, were transiently up-regulated at 6 hr after antigen challenge. In situ RT-PCR in combination with immunohistochemical analysis revealed that beta-CGRP was expressed in neuroendocrine cells in clusters (termed neuroepithelial bodies [NEBs]) in AI lungs. These results indicate that the long-term induction of beta-CGRP in NEBs may play an important role in pulmonary AI such as bronchial asthma.

To clarify the mechanisms that regulate neuroendocrine differentiation of fetal lung epithelia, we have studied the expression of the mammalian homologs of achaete-scute complex (Mash1) (Ascl1 – Mouse Genome Informatics); hairy and enhancer of split1 (Hes1); and the expression of Notch/Notch-ligand system in the fetal and adult mouse lungs, and in the lungs of Mash1- or Hes1-deficient mice. Immunohistochemical studies revealed that Mash1-positive cells seemed to belong to pulmonary neuroendocrine cells (PNEC) and their precursors. In mice deficient for Mash1, no PNEC were detected. Hes1-positive cells belong to non-neuroendocrine cells. In the mice deficient in Hes1, in which Mash1 mRNA was upregulated, PNEC appeared precociously, and the number of PNEC was markedly increased. NeuroD (Neurod1 – Mouse Genome Informatics) expression in the lung was detected in the adult, and was enhanced in the fetal lungs of Hes1-null mice. Expression of Notch1, Notch2, Notch3 and Notch4 mRNAs in the mouse lung increased with age, and Notch1 mRNA was expressed in a Hes1-dependent manner. Notch1, Notch2 and Notch3 were immunohistochemically detected in non-neuroendocrine cells. Moreover, analyses of the lungs from the gene-targeted mice suggested that expression of Delta-like 1 (Dll1 – Mouse Genome Informatics) mRNA depends on Mash1. Thus, the neuroendocrine differentiation depends on basic helix-loop-helix factors, and Notch/Notch-ligand pathways may be involved in determining the cell differentiation fate in fetal airway epithelium.

We report a fatal case of death due to unusual aspiration of sardine fry in an elderly Japanese man with lung cancer. The cause of death was sudden respiratory arrest while eating. Autopsy revealed peculiar materials with cell nests and pigmented particles, together with striated muscle and skin, in the ectatic bronchioles of the left lower lobe. Serial histologic sections suggested that the structures observed were the eyeballs of small animals that appeared to have been inhaled. The patient had habitually eaten sardine fry and rice gruel, which were also detected in the gastric contents. Therefore, the eyes were considered to be those of the fry, which is a popular food item in Japan. This was confirmed by histologic examination of fry that were obtained commercially.

We examined the hypothesis that superoxide mediates infiltration of neutrophils to the airways through nuclear factor (NF)-kappaB and interleukin-8 (IL-8) after acute exposure to cigarette smoke (CS) in vivo. Male Hartley strain guinea pigs were exposed to air or 20 puffs of CS and killed 5 h after the exposure. The differential cell count of bronchoalveolar lavage fluid and specific myeloperoxidase enzyme assay demonstrated that acute exposure to CS caused neutrophil accumulation to the airways and parenchyma, respectively. Acute exposure to CS increased DNA-binding activity of NF-kappaB in the lung. Acute exposure to CS also increased IL-8 messenger RNA (mRNA) expression in the lung. Pretreatment of guinea pigs with recombinant human superoxide dismutase (rhSOD) aerosols reduced the CS-induced neutrophil accumulation to the airways. Both activation of NF-kappaB and increased IL-8 mRNA expression were also inhibited by the pretreatment of rhSOD aerosols. Strong immunoreactivities for p65 and p50 were detected in the nuclei of alveolar macrophages after acute exposure to CS. The signal for IL-8 mRNA expression was demonstrated in the alveolar space after acute exposure to CS. Neither significant immunoreactivities for p65 and p50 nor IL-8 mRNA signals were observed in airway epithelium. These observations suggest that acute exposure to CS initiates superoxide-dependent mechanism that, through NF-kappaB activation and IL-8 mRNA expression, produces infiltration of neutrophils to the airways in vivo. It was also suggested that the alveolar macrophage is one potential source of NF-kappaB activation and IL-8 mRNA expression after acute exposure to CS.