Search

A small phylogenetically conserved sequence of 11,231 bp termed FAM247 is repeated in human chromosome 22 by segmental duplications. This sequence forms part of diverse genes that span evolutionary time, the protein genes being the earliest as they are present in zebrafish and/or mice genomes, the long non-coding RNA genes and pseudogenes the most recent as they appear to be present only in the human genome. We propose that the conserved sequence provides a nucleation site for new gene development at evolutionary conserved chromosomal loci where the FAM247 sequences reside. The FAM247 sequence also carries information in its open reading frames that provides protein exon amino acid sequences; one exon plays an integral role in immune system regulation, specifically, the function of ubiquitin specific protease (USP18) in the regulation of interferon. An analysis of this multifaceted sequence and the genesis of genes that contain it are presented.

Intergenic regions of bacteria contain small regulatory ribonucleic acid (sRNA) genes whose transcripts control expression of distal genes. These transcripts, referred to as sRNAs, primarily act at the level of translation where they bind messenger ribonucleic acids (mRNAs) and inhibit or activate a target mRNA. Base pairing with mRNAs is generally imperfect and can include noncanonical base pairs. The RNA chaperone protein Hfq is involved in many RNA/RNA interactions and ribonucleases RNase E and RNase III have been implicated in destabilisation of target mRNAs. Many sRNAs can inhibit multiple mRNAs; however, some sRNAs bind proteins and can regulate transcription or translation indirectly. Some act like ‘sponges’ that bind and sequester proteins involved in global gene regulation. Many sRNA genes are activated by environmental stress factors, and the sRNA genes have complex upstream regulatory sites. Further insight into broad functions of sRNAs comes from human host cells infected by pathogenic bacteria, which reveals a role of sRNA in both virulence and response in human host cell molecular functions, for example changes in long noncoding RNAs and microRNAs. Bacterial regulatory RNAs are proving to be remarkable factors in both cell physiology and bacterial pathogenesis and these RNAs have opened a new world in molecular biology. Key Concepts Small regulatory RNA genes have been found in most bacterial species. sRNA transcripts are generally less than 200 nt. sRNAs can control gene expression at the level of translation or transcription. sRNAs respond to environmental or internal stress conditions. sRNAs generally form small and imperfect RNA/RNA base pairing with target mRNA; noncanonical base pairs can also be present. sRNAs can inhibit translational and/or induce degradation of target mRNA. Many sRNAs regulate multiple target mRNAs. sRNAs can indirectly regulate the expression of global genes, some by binding proteins that control gene expression. sRNAs can play a major role in bacterial pathogenicity and influence eukaryotic host molecular functions such as levels of host cell microRNA and long noncoding RNA. Keywords: small regulatory RNAs; control of gene regulation; RNA/RNA interactions; translational or transcriptional inhibition by sRNAs; sRNAs and pathogenicity

This Special Issue of IJMS is devoted to regulation by non-coding RNAs and contains both original research and review articles. An attempt is made to provide an up-to-date analysis of this very fast moving field and cover regulatory roles of both microRNAs and long non-coding RNAs. Multifaceted functions of these RNAs in normal cellular processes, as well as in disease progression, are highlighted.

Growing evidence shows a close association of transposable elements (TE) with non-coding RNAs (ncRNA), and a significant number of small ncRNAs originate from TEs. Further, ncRNAs linked with TE sequences participate in a wide-range of regulatory functions. Alu elements in particular are critical players in gene regulation and molecular pathways. Alu sequences embedded in both long non-coding RNAs (lncRNA) and mRNAs form the basis of targeted mRNA decay via short imperfect base-pairing. Imperfect pairing is prominent in most ncRNA/target RNA interactions and found throughout all biological kingdoms. The piRNA-Piwi complex is multifunctional, but plays a major role in protection against invasion by transposons. This is an RNA-based genetic immune system similar to the one found in prokaryotes, the CRISPR system. Thousands of long intergenic non-coding RNAs (lincRNAs) are associated with endogenous retrovirus LTR transposable elements in human cells. These TEs can provide regulatory signals for lincRNA genes. A surprisingly large number of long circular ncRNAs have been discovered in human fibroblasts. These serve as “sponges” for miRNAs. Alu sequences, encoded in introns that flank exons are proposed to participate in RNA circularization via Alu/Alu base-pairing. Diseases are increasingly found to have a TE/ncRNA etiology. A single point mutation in a SINE/Alu sequence in a human long non-coding RNA leads to brainstem atrophy and death. On the other hand, genomic clusters of repeat sequences as well as lncRNAs function in epigenetic regulation. Some clusters are unstable, which can lead to formation of diseases such as facioscapulohumeral muscular dystrophy. The future may hold more surprises regarding diseases associated with ncRNAs andTEs.

Studies on the regulatory RNA MicF in Enterobacteriaceae reveal a pivotal role in gene regulation. Multiple target gene mRNAs were identified and, importantly, MicF RNA regulates the expression of the global regulatory gene lrp (Holmqvist et al., 2012; Corcoran et al., 2012). Thus MicF RNA is a central factor in a regulatory network that regulates bacterial cell physiology.

Background DiGeorge Syndrome is a genetic abnormality involving ~3 Mb deletion in human chromosome 22, termed 22q.11.2. To better understand the non-coding regions of 22q.11.2, a small 10,000 bp non-protein-coding sequence close to the DiGeorge Critical Region 6 gene (DGCR6) was chosen for analysis and functional entities as the homologous sequence in the chimpanzee genome could be aligned and used for comparisons. Methods The GenBank database provided genomic sequences. In silico computer programs were used to find homologous DNA sequences in human and chimpanzee genomes, generate random sequences, determine DNA sequence alignments, sequence comparisons and nucleotide repeat copies, and to predicted DNA secondary structures. Results At its 5′ half, the 10,000 bp sequence has three distinct sections that represent phylogenetically variable sequences. These Variable Regions contain biased mutations with a very high A + T content, multiple copies of the motif TATAATATA and sequences that fold into long A:T-base-paired stem loops. The 3′ half of the 10,000 bp unit, highly conserved between human and chimpanzee, has sequences representing exons of lncRNA genes and segments of introns of protein genes. Central to the 10,000 bp unit are the multiple copies of a sequence that originates from the flanking 5′ end of the translocation breakpoint Type A sequence. This breakpoint flanking sequence carries the exon and intron motifs. The breakpoint Type A sequence seems to be a major player in the proliferation of these RNA motifs, as well as the proliferation of Variable Regions in the 10,000 bp segment and other regions within 22q.11.2. Conclusions The data indicate that a non-coding region of the chromosome may be reserved for highly biased mutations that lead to formation of specialized sequences and DNA secondary structures. On the other hand, the highly conserved nucleotide sequence of the non-coding region may form storage sites for RNA motifs. Electronic supplementary material The online version of this article (doi:10.1186/s12864-015-1958-6) contains supplementary material, which is available to authorized users.

The micF gene is a stress response gene found in Escherichia coli and related bacteria that post-transcriptionally controls expression of the outer membrane porin gene ompF. The micF gene encodes a non-translated 93 nt antisense RNA that binds its target ompF mRNA and regulates ompF expression by inhibiting translation and inducing degradation of the message. In addition, other factors, such as the RNA chaperone protein StpA also play a role in this regulatory system. Expression of micF is controlled by both environmental and internal stress factors. Four transcriptional regulators are known to bind the micF promoter region and activate micF expression. The crystal structure of one these transcriptional activators, Rob, complexed with the micF promoter has been reported. Here, we review new developments in the micF regulatory network.

Antisense oligonucleotide (ASO) biotechnology has been widely used to inhibit the expression of proteins involved in human disease. ASOs are designed to bind messenger RNA transcripts via Watson-Crick base-pairing and inhibit synthesis of targeted proteins. These proteins include protein kinases, growth factors, glutamate receptors, anti-apoptotic proteins, and proteins involved in genetic disorders. Non-mRNA targets such as the RNA component of the telomerase enzyme are also being explored. Pre-clinical and clinical trials using ASO biotechnology have progressed with standard ASOs such as phosphorothioates, but newer ASO analogs are rapidly being developed with the idea of enhancing specificity and biological activity. A current major research thrust is the design and testing of antisense oligonucleotides as anti-cancer drugs. The primary focus of this review is an analysis of recent uses of ASO biotechnology to inhibit anti-apoptotic gene expression in tumor cells.

Bactericidal effects of polylysine on different bacterial species were measured. Marked differences in sensitivity were observed. Based on the concentration of polylysine required to reduce cell viability by 50%, Mycobacterium smegmatis and Mycobacterium tuberculosis were found to be the most sensitive and Escherichia coli the most resistant. In addition, two Gram-positive organisms, Staphylococcus epidermidis and Streptococcus salivarius exhibited significant differences in sensitivity which suggests that the relationship between sensitivity towards polylysine and bacterial cell type is not necessarily a function of the overall cell envelope structure. The high sensitivity of mycobacteria suggests the possible use of polylysine, or a conjugate of polylysine and another agent in anti-mycobacterial drug design.

The Escherichia coli micF RNA is a prototype for a class of antisense RNAs encoded by genes at different loci from those that code for their target RNAs. RNAs in this class exhibit only partial complementarity to their targets. micF RNA binds to and regulates the stability of ompF mRNA in response to a variety of environmental stimuli. The secondary structures of micF RNA, ompF-213 mRNA (a segment containing the 213 nucleotides at the 5'-terminus of the target message), and the micF RNA/ompF-213 mRNA duplex were analyzed in vitro by partial digestion with structure-specific ribonucleases and chemical modification. Both micF RNA and ompF mRNA have single-stranded 5'-ends and contain stable stem-loop structures. Strong phylogenetic support for the proposed secondary structure for E. coli micF RNA is provided by a comparison of structural models derived from micF sequences from related bacteria. The micF RNA/ompF-213 mRNA duplex interaction appears to involve only a short segment of micF RNA. Unfolding of only one stem-loop of micF RNA and a minor stem-loop of ompF-213 mRNA appears to be necessary to form the duplex. The probing data suggest that the Shine-Dalgarno sequence and AUG start codon of ompF mRNA, found in single-stranded regions in the free message, are base-paired to micF RNA in the RNA/RNA duplex.

Intergenic regions of prokaryotic genomes carry multiple copies of terminal inverted repeat (TIR) sequences, the nonautonomous miniature inverted-repeat transposable element (MITE). In addition, there are the repetitive extragenic palindromic (REP) sequences that fold into a small stem loop rich in G–C bonding. And the clustered regularly interspaced short palindromic repeats (CRISPRs) display similar small stem loops but are an integral part of a complex genetic element. Other classes of repeats such as the REP2 element do not have TIRs but show other signatures. With the current availability of a large number of whole-genome sequences, many new repeat elements have been discovered. These sequences display diverse properties. Some show an intimate linkage to integrons, and at least one encodes a small RNA. Many repeats are found fused with chromosomal open reading frames, and some are located within protein coding sequences. Small repeat units appear to work hand in hand with the transcriptional and/or post-transcriptional apparatus of the cell. Functionally, they are multifaceted, and this can range from the control of gene expression, the facilitation of host/pathogen interactions, or stimulation of the mammalian immune system. The CRISPR complex displays dramatic functions such as an acquired immune system that defends against invading viruses and plasmids. Evolutionarily, mobile repeat elements may have influenced a cycle of active versus inactive genes in ancestral organisms, and some repeats are concentrated in regions of the chromosome where there is significant genomic plasticity. Changes in the abundance of genomic repeats during the evolution of an organism may have resulted in a benefit to the cell or posed a disadvantage, and some present day species may reflect a purification process. The diverse structure, eclectic functions, and evolutionary aspects of repeat elements are described.

micF RNA regulates the levels of outer membrane protein F (OmpF) in Escherichia coli in response to temperature increase and other stress conditions by decreasing the levels of ompF mRNA (Andersen et al., 1989). A 93-nucleotide micF RNA was synthesized in vitro directly from polymerase chain reaction generated DNA which was designed to contain a functional T7 RNA polymerase promoter upstream of the micF RNA gene and an appropriate restriction site for transcription termination. A transcript (150 nucleotides) containing the ribosomal binding domain of ompF mRNA messenger was synthesized in vitro from the ompF gene cloned into a T7 expression vector. A stable duplex was formed between micF RNA and the 150-nucleotide 5' transcript of ompF mRNA after incubation at 37 degrees C in a physiological buffer. The melting curve of the duplex formed by micF RNA and 150-nucleotide transcript revealed a Tm of 56 degrees C and a delta Tm that spans about 20 degrees C; both are consistent with the proposed structure for the micF/ompF duplex. In addition, as determined by competition studies and UV cross-linking/label-transfer analyses, an E. coli protein was found to bind specifically to micF RNA. The protein also bound weakly to the 150-nucleotide ompF transcript. The data are the first to demonstrate the complex between micF RNA and the 5' end of ompF mRNA and suggest that in vivo a micF ribonucleoprotein (RNP) particle may participate in the destabilization ompF mRNA during thermoregulation of OmpF porin.

Current antisense oligonucleotides designed for drug therapy rely on Watson-Crick base pairing for the specificity of interactions between antisense and target molecules. However, thermodynamically stable duplexes containing non-Watson-Crick pairs have been formed with synthetic oligonucleotides. There are also numerous examples of non-canonical base pairs that participate in stable intra- and inter-molecular RNA/RNA pairing in prokaryotic and eukaryotic cells. Several natural antisense RNA/target RNA duplexes contain looped-out and bulged positions as well as non-canonical pairs as exemplified by formation of the Escherichia coli antisense micF RNA/ompF mRNA duplex. Secondary structures and the phylogenetic conservation of nucleotide sequences are well characterized in this system. Natural antisense/ target interactions may serve as models for determining possible and optimal antisense/target interactions in oligonucleotide drug design.

The first evidence that RNA can function as a regulator of gene expression came from experiments with prokaryotes in the 1980s. It was shown that Escherichia coli micF is an independent gene, has its own promoter, and encodes a small non-coding RNA that base pairs with and inhibits translation of a target messenger RNA in response to environmental stress conditions. The micF RNA was isolated, sequenced and shown to be a primary transcript. In vitro experiments showed binding to the target ompF mRNA. Secondary structure probing revealed an imperfect micF RNA/ompF RNA duplex interaction and the presence of a non-canonical base pair. Several transcription factors, including OmpR, regulate micF transcription in response to environmental factors. micF has also been found in other bacterial species, however, recently Gerhart Wagner and Jörg Vogel showed pleiotropic effects and found micF inhibits expression of multiple target mRNAs; importantly, one is the global regulatory gene lrp. In addition, micF RNA was found to interact with its targets in different ways; it either inhibits ribosome binding or induces degradation of the message. Thus the concept and initial experimental evidence that RNA can regulate gene expression was born with prokaryotes.

Antisense nucleic acids are natural or synthetic polymers that base pair with target RNAs and inhibit target functions. Natural antisense RNAs are found in both prokaryotic and eukaryotic organisms and regulate gene expression during cell growth or development. Synthetic and vector-encoded antisense nucleic acids are used in experimental molecular genetics to determine the function of target genes, and are being developed for use in human disease management and in agriculture. Keywords: antisense polynucleotides; antisense drugs; biotechnology; control of gene expression

Outer membrane protein F (OmpF) found in E. coli and related bacteria is post-transcriptionally regulated by antisense micF RNA. During down regulation of ompF expression, micF RNA binds to the 5' UTR of ompF mRNA, blocks translation of the message, and also participates in the chemical destabilization of the ompF mRNA. Only about one third of the micF RNA sequence binds the target ompF mRNA. Phylogenetic analyses of micF RNA and ompF mRNA show: 1) a high degree of conservation of nucleotide sequence in regions of both RNAs involved in RNA/RNA interaction, 2) a low nucleotide sequence conservation but high degree of secondary structure conservation in regions of antisense and target RNAs not involved in the RNA/RNA interaction. Whereas conserved sequences are associated with RNA/RNA binding and blockage of translation, conservation of secondary structure may be related to protein interactions associated with chemical destabilization of the message.

Ribonuclease E (RNase E) is known to play an important role in mRNA decay and RNA processing in Escherichia coli. While several substrates for RNase E have been identified, the specificity for the recognition and cleavage sites has not been completely determined. In this study, micF RNA, an antisense RNA found in E. coli and related bacteria, was found to be a substrate for RNase E in vitro. Two cleavage sites were mapped, and both are found in the sequence context UA/UUU and are located within 10 nucleotides upstream of stem-loop structures. These results help define a generalized RNase E cleavage/recognition pattern.

Members of a class of antisense RNAs are encoded by genes that are located at loci other than those of their target genes. Three examples of antisense RNA genes are discussed here. micF is found in Escherichia coli and other bacteria and functions to control outer membrane protein F levels in response to environmental stimuli. dicF is also found in E. coli and is involved in the regulation of cell division. lin-4 is found in the nematode Caenorhabditis elegans and functions during larval development. Nucleotide sequences of at least two of these genes appear to be phylogenetically conserved. The trans-encoded antisense RNAs are small RNAs which display only partial complementarity to their target RNAs. Models for RNA/RNA interactions have been proposed. It is possible that currently known unlinked antisense RNA genes are part of a larger class of heretofore undiscovered regulatory RNA genes. Possible ways of detecting other unlinked antisense RNA genes are discussed.

micF RNA post-transcriptionally regulates Escherichia coli outer membrane protein F (OmpF), in response to temperature increase and other environmental stress conditions, by binding to ompF mRNA and destabilizing the message. Southern analyses show that the micF gene is present in related Gram-negative bacteria, including Salmonella typhimurium, Klebsiella pneumoniae, and Pseudomonas aeruginosa. In addition, Northern analyses indicate that micF RNA and ompF mRNA levels are thermally regulated in several related species in a manner similar to the thermoregulation in Escherichia coli. DNA sequences from Salmonella typhi, Salmonella typhimurium, and Klebsiella pneumoniae show greater than 96% homology in the micF gene when compared to the Escherichia coli micF sequence. Upstream of micF, sequences show considerable variation, although several distinct regions are highly conserved. Some of these conserved regions correspond to known binding sites for the transcription factor OmpR and the DNA-binding protein integration host factor. In addition, E. coli micF RNA incubated with protein extracts from other species forms heterologous ribonucleoproteins (RNPs). The formation of these heterologous RNPs indicates both the presence of micF RNA-binding protein homologues in other species and a conservation of RNA-protein recognition sites. This work demonstrates that the micF RNA regulatory system is present in other Gram-negative bacterial species and that this system appears to be phylogenetically conserved.

Background Borrelia species are unusual in that they contain a large number of linear and circular plasmids. Many of these plasmids have long intergenic regions. These regions have many fragmented genes, repeated sequences and appear to be in a state of flux, but they may serve as reservoirs for evolutionary change and/or maintain stable motifs such as small RNA genes. Results In an in silico study, intergenic regions of Borrelia plasmids were scanned for phylogenetically conserved stem loop structures that may represent functional units at the RNA level. Five repeat sequences were found that could fold into stable RNA-type stem loop structures, three of which are closely linked to protein genes, one of which is a member of the Borrelia lipoprotein_1 super family genes and another is the complement regulator-acquiring surface protein_1 (CRASP-1) family. Modeled secondary structures of repeat sequences display numerous base-pair compensatory changes in stem regions, including C-G→A-U transversions when orthologous sequences are compared. Base-pair compensatory changes constitute strong evidence for phylogenetic conservation of secondary structure. Conclusion Intergenic regions of Borrelia species carry evolutionarily stable RNA secondary structure motifs. Of major interest is that some motifs are associated with protein genes that show large sequence variability. The cell may conserve these RNA motifs whereas allow a large flux in amino acid sequence, possibly to create new virulence factors but with associated RNA motifs intact.

The repressor RNA, micF RNA, is regulated by temperature, osmolarity, and other stress conditions during growth of Escherichia coli. Northern (RNA) blot analyses showed that levels of micF RNA differ widely in various ompB mutant strains when cells are grown at 24 degrees C in LB broth. For example, relative to the parental strain MC4100, the ompR101 mutant strain (which contains no functional OmpR) had about a 10-fold reduction in micF RNA, whereas the envZ11 strain showed about a 5-fold increase. At 37 degrees C, however, micF RNA levels in the ompR101 and envZ11 strains and other ompB mutants differed by less than two-fold compared with the level in strain MC4100, thus indicating that a factor(s) independent of the ompB locus regulates micF RNA expression with temperature increase and that there is an additional control mechanism(s) which maintains the levels of micF RNA in these mutants close to that of the wild type during growth at high temperatures. In a plasmid strain containing the micF gene but without the upstream OmpR-binding site, steady-state levels of micF RNA increased with temperature increase but did not change with osmolarity increase. This showed that osmolal regulation but not temperature regulation of micF depends on these upstream sequences and suggested that while osmolal regulation of the micF gene depends on OmpR, thermal regulation does not.

Intergenic repeat units of 127-bp (RU-1) and 168-bp (RU-2), as well as a newly-found class of 103-bp (RU-3), represent small mobile sequences in enterobacterial genomes present in multiple intergenic regions. These repeat sequences display similarities to eukaryotic miniature inverted-repeat transposable elements (MITE). The RU mobile elements have not been reported to encode amino acid sequences. An in silico approach was used to scan genomes for location of repeat units. RU sequences are found to have open reading frames, which are present in annotated gene loci whereby the RU amino acid sequence is maintained. Gene loci that display repeat units include those that encode large proteins which are part of super families that carry conserved domains and those that carry predicted motifs such as signal peptide sequences and transmembrane domains. A putative exported protein in Y. pestis and a phylogenetically conserved putative inner membrane protein in Salmonella species represent some of the more interesting constructs. We hypothesize that a major outcome of RU open reading frame fusions is the evolutionary emergence of new proteins.

Three major outer membrane protein genes of Escherichia coli, ompF, ompC, and ompA respond to stress factors. Transcripts from these genes are regulated by the small non-coding RNAs micF, micC, and micA, respectively. Here we examine Photorhabdus luminescens, an organism that has a different habitat from E. coli for outer membrane protein genes and their regulatory RNA genes. By bioinformatics analysis of conserved genetic loci, mRNA 5'UTR sequences, RNA secondary structure motifs, upstream promoter regions and protein sequence homologies, an ompF -like porin gene in P. luminescens as well as a duplication of this gene have been predicted. Gene loci for micF RNA, as well as OmpC protein and its associated regulatory micC RNA, were not found. Significantly, a sequence bearing the appropriate signatures of the E. coli micA RNA was located. The ompA homolog was previously annotated in P. luminescens. Presence of an ompF-like porin in P. luminescens is in keeping with the necessity to allow for passage of small molecules into the cell. The apparent lack of ompC, micC and micF suggests that these genes are not essential to P. luminescens and ompC and micF in particular may have been lost when the organism entered its defined life cycle and partially protected habitat. Control of porin gene expression by RNA may be more prevalent in free- living cells where survival is dependent on the ability to make rapid adjustments in response to environmental stress. Regulation of ompA by micA may have been retained due to a necessity for ompA control during one or both stages of the P. luminescens life cycle. This article was reviewed by Tal Dagan (nominated by Dan Graur), Mikhail Gelfand and Anna Gerasimova (nominated by Mikhail Gelfand) and J Peter Gogarten. Reviewed by Tal Dagan (nominated by Dan Graur), Mikhail Gelfand and Anna Gerasimova (nominated by Mikhail Gelfand) and J Peter Gogarten. For the full reviews, please go to the Reviewers' comments section.

micF RNA, a small regulatory RNA found in bacteria, post-transcriptionally regulates expression of outer membrane protein F (OmpF) by interaction with the ompF mRNA 5'UTR. Phylogenetic data can be useful for RNA/RNA duplex structure analyses and aid in elucidation of mechanism of regulation. However micF and associated genes, ompF and ompC are difficult to annotate because of either similarities or divergences in nucleotide sequence. We report by using sequences that represent "gene signatures" as probes, e.g., mRNA 5'UTR sequences, closely related genes can be accurately located in genomic sequences. Alignment and search methods using NCBI BLAST programs have been used to identify micF, ompF and ompC in Yersinia pestis and Yersinia enterocolitica. By alignment with DNA sequences from other bacterial species, 5' start sites of genes and upstream transcriptional regulatory sites in promoter regions were predicted. Annotated genes from Yersinia species provide phylogenetic information on the micF regulatory system. High sequence conservation in binding sites of transcriptional regulatory factors are found in the promoter region upstream of micF and conservation in blocks of sequences as well as marked sequence variation is seen in segments of the micF RNA gene. Unexpected large differences in rates of evolution were found between the interacting RNA transcripts, micF RNA and the 5' UTR of the ompF mRNA. micF RNA/ompF mRNA 5' UTR duplex structures were modeled by the mfold program. Functional domains such as RNA/RNA interacting sites appear to display a minimum of evolutionary drift in sequence with the exception of a significant change in Y. enterocolitica micF RNA. Newly annotated Yersinia micF and ompF genes and the resultant RNA/RNA duplex structures add strong phylogenetic support for a generalized duplex model. The alignment and search approach using 5' UTR signatures may be a model to help define other genes and their start sites when annotated genes are available in well-defined reference organisms.

Spinacia oleracia cholorplast 5S ribosomal RNA was end-labeled with [32P] and the complete nucleotide sequence was determined. The sequence is: pUAUUCUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAU ACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUGOH. This sequence can be fitted to the secondary structural model proposed for prokaryotic 5S ribosomal RNAs by Fox and Woese (1). However, the lengths of several single- and double-stranded regions differ from those common to prokaryotes. The spinach chloroplast 5S ribosomal RNA is homologous to the 5S ribosomal RNA of Lemna chloroplasts with the exception that the spinach RNA is longer by one nucleotide at the 3' end and has a purine base substitution at position 119. The sequence of spinach chloroplast 5S RNA is identical to the chloroplast 5S ribosomal RNA gene of tobacco. Thus the structures of the chloroplast 5S ribosomal RNAs from some of the higher plants appear to be almost totally conserved. This does not appear to be the case for the higher plant cytoplasmic 5S ribosomal RNAs.

The complete nucleotide sequence of the 5 S ribosomal RNA from the thermophilic cyanobacterium Synechococcus lividus III was determined. The sequence is: 5′U-C- C-U-G-G-U-G-G-U-G-A-U-G-G-C-G-A-U-G-U-G-G-A-C-C-C-A-C-A-C-U-C-A-U-C- C-A-U-C-C-C-G-A-A-C-U-G-A-G-U-G-G-U-G-A-A-A-C-G-C-A-U-U-U-G-C-G-G-C- G-A-C-G-A-U-A-G-U-U-G-G-A-G-G-G-U-A-G-C-C-U-C-C-U-G-U-C-A-A-A-A-U-A- G-C-U-A-A-C-C-G-C-C-A-G-G-G-UOH3′ This 5 S RNA has regional structural characteristics that are found in the green plant chloroplast 5 S RNAs and not in other known sequences of 5 S ribosomal RNAs. These homologies suggest a close phylogenetic relationship between S. lividus and the green plant chloroplasts.

Correspondence analysis (a form of multivariate statistics) applied to 74 5S ribosomal RNA sequences indicates that the sequences are interrelated in a systematic, nonrandom fashion. Aligned sequences are represented as vectors in a 5N-dimensional space, where N is the number of base positions in the 5S RNA molecule. Mutually orthogonal directions (called factor axes) along which intersequence variance is greatest are defined in this hyperspace. Projection of the sequences onto planes defined by these factorial directions reveals clustering of species that is suggestive of phylogenetic relationships. For each factorial direction, correspondence analysis points to regions of "importance," i.e., those base positions at which the systematic changes occur that define that particular direction. In effect, the technique provides a rapid determination of group-specific signatures. In several instances, similarities between sequences are indicated that have only recently been inferred from visual base-to-base comparisons. These results suggest that correspondence analysis may provide a valuable starting point from which to uncover the patterns of change underlying the evolution of a macromolecule, such as 5S RNA.

The structure of Xenopus laevis oocyte (Xlo) 5S ribosomal RNA has been probed with single-strand-specific ribonucleases T1, T2, and A with double-strand-specific ribonuclease V1 from cobra venom. The digestion of 5'- or 3'-labeled renatured 5S RNA samples followed by gel purification of the digested samples allowed the determination of primary cleavage sites. Results of these ribonuclease digestions provide support for the generalized 5S RNA secondary structural model derived from comparative sequence analysis. However, three putative single-stranded regions of the molecule exhibited unexpected V1 cuts, found at C36, U73, U76, and U102. These V1 cuts reflect additional secondary structural features of the RNA including A.G base pairs and support the extended base pairing in the stem containing helices IV and V which was proposed by Stahl et al. [Stahl, D. A., Luehrsen, K. R., Woese, C. R., & Pace, N. R. (1981) Nucleic Acids Res. 9, 6129-6137]. A conserved structure for helix V having a common unpaired uracil residue at Xlo position 84 is proposed for all eukaryotic 5S RNAs. Our results are compared with nuclease probes of other 5S RNAs.

The sequences of 5S ribosomal RNAs from a wide-range of organisms have been compared. All sequences fit a generalized 5S RNA secondary structural model. Twenty-three nucleotide positions are found universally, i.e., in 5S RNAs of eukaryotes, prokaryotes, archaebacteria, chloroplasts and mitochondria. One major distinguishing feature between the prokaryotic and eukaryotic 5S RNAs is the number of nucleotide positions between certain universal positions, e.g., prokaryotic 5S RNAs have three positions between the universal positions PuU40 and G44 (using the E. coli numbering system) and eukaryotic 5S RNAs have two. The archaebacterial 5S RNAs appear to resemble the eukaryotic 5S RNAs to varying degrees depending on the species of archaebacteria although all the RNAs conform with the prokaryotic "rule" of chain length between PuU40 and G44. The green plant chloroplast and wheat mitochondrial 5S RNAs appear prokaryotic-like when comparing the number of positions between universal nucleotides. Nucleotide positions common to eukaryotic 5S RNAs have been mapped; in addition, nucleotide sequences, helix lengths and looped-out residues specific to phyla are proposed. Several of the common nucleotides found in the 5S RNAs of metazoan somatic tissue differ in the 5S RNAs of oocytes. These changes may indicate an important functional role of the 5S RNA during oocyte maturation.

A new species of micF RNA, which contains 93 nucleotides (a 4.5S size), was isolated from Escherichia coli. The sequence of the 4.5S micF RNA corresponds to positions G82 through U174 of the micF gene. The 5' terminal end of this smaller micF RNA is triphosphorylated signifying that it is a primary transcript. Its promoter region, which is situated within the greater micF structural gene, has been identified and characterized by lacZ fusion analysis. A 6S micF RNA species, which has a base composition predicted for a transcript from the full length gene has also been detected; however, the 4.5S micF RNA is the predominant species. The work clearly shows by biochemical identification the presence of chromosomally encoded micF RNA.

The role of chromosomally derived micF RNA as a repressor of outer membrane protein OmpF of Escherichia coli was examined for various growth conditions. Levels of micF RNA as determined by Northern analyses are found to increase in response to cell growth at high temperature, in high osmolarity or in the presence of ethanol. After a switch to higher growth temperature, the levels of ompF mRNA and of newly synthesized OmpF decrease with time in E. coli strain, MC4100 but these decreases are not observed in isogenic micF deletion strain, SM3001. In addition, while levels of ompF mRNA are substantially reduced in both strains in response to high osmolarity or ethanol at 24 degrees C, the reduced levels in the parental strain are still 4-5-fold lower compared with the micF deletion strain. These findings indicate that chromosomally derived micF RNA plays a major role in the thermal regulation of OmpF and represses OmpF synthesis in response to several environmental signals by decreasing the levels of ompF mRNA. Analyses of the effect of a multicopy micF plasmid on the levels of OmpF and ompF mRNA after an increase in temperature indicated that multicopies of micF RNA markedly inhibited OmpF synthesis but did not accentuate ompF mRNA decrease. These data suggest that multicopy micF inhibits OmpF synthesis primarily through translational inactivation of ompF mRNA and that a limiting factor in addition to micF RNA is necessary to destabilize ompF mRNA.

The nucleotide sequence of the major 5 S ribosomal RNA from the lower fungus Phycomyces blakesleeanus has been determined. The sequence is 5' AAUCUACGGCCAUACAGAUAGUAACACACCGGAUCCCGUCUGAUCUCCGCAGUUAAGUCUCUCCUGGUAGCGUCAGUAC UAUGGUGGGGGACCACAUGGGAAUACGCUAUGUCGUAGGUU3'OH. The Phycomyces 5 S RNA sequence has invariant nucleotide positions characteristic of other eukaryotic 5 S RNAs and fits currently proposed secondary structural models. The Phycomyces of 5 S RNA shows relatively low overall sequence homology to the higher fungal (Ascomycetes) 5 S RNAs (56-60%) but shows higher sequence homology to those 5 S RNAs from Tetrahymena thermophila (68%), human KB cells (67%), and Spinacia oleracea (62%). A comparison of individual segments of the RNA also shows that the structure of Phycomyces 5 S RNA has several major differences from structures common to the higher fungi. Positions 2-14 are homologous with those of metazoan and some protozoan 5 S RNAs. At positions 30-45, the RNA sequence is closer to metazoan 5 S RNAs than to the Neurospora of Aspergillus 5 S RNAs. The Phycomyces 5 S RNA shares similar sequences with both Aspergillus and Tetrahymena 5 S RNAs at positions 79-99. Several other important homologies in primary and proposed secondary structures also have been observed in comparing Phycomyces 5 S RNA with animal and plant 5 S RNAs. We conclude that Phycomyces may not be as closely related phylogenetically to the Ascomycetes as previously thought.