Search

Objective: Linked color imaging (LCI) is a recently developed technique that emphasizes differences in mucosal color. In this study we aimed to develop a LCI classification based on the Narrow‐band Imaging International Colorectal Endoscopic Classification for predicting colorectal polyp histology and evaluate the validity and performance of the endoscopists in differentiating hyperplastic polyps from adenomas using the LCI classification. Methods: A workshop involving six international experts from China and Japan with substantial experience with LCI developed the classification. Three experienced and seven less‐experienced endoscopists used the LCI images to predict the histology of polyps independently, recording their degrees of confidence in these predictions before and after completing the training test for the LCI classification. Results: Of the 50 polyps included, 30 (60.0%) were adenomas. Overall diagnostic accuracy before training was 75.4% (95% confidence interval [CI] 71.4%–79.1%), which increased to 85.2% (95% CI 81.8%–88.2%) after training. After training, the experienced and less‐experienced endoscopists achieved an overall accuracy of 87.3% and 84.3% for the prediction of polyp histology. Polyp prediction using the color criterion alone had the highest specificity and positive predictive value, whereas the vessel criterion achieved the highest accuracy and negative predictive value among all three individual LCI criteria. After training, both the experienced and less‐experienced endoscopists had high degrees of interobserver agreement. Conclusions: We developed and validated the first LCI classification for endoscopic differentiation of adenomas and hyperplastic polyps. The LCI classification significantly improved the diagnostic accuracy of colorectal polyps. [ABSTRACT FROM AUTHOR]

Background: Predictors besides symptoms of obstruction indicating small bowel stenosis are little known.Aims: To detect predictors of small bowel stenosis in balloon-assisted enteroscopy.Methods: Over a 6-year period, 461 patients had enteroscopy for suspected small intestinal disease. Details of clinical manifestations, medical history, demographic characteristics, findings of examinations, information on enteroscopy, and treatment were retrospectively collected based on medical records. Small bowel stenosis was defined as stricture that over-tube cannot go through in enteroscopy. Univariate and multivariate analyses were performed to identify predictors for small bowel stenosis.Results: A total of 314 patients had definite diagnosis after enteroscopy, imaging modalities, and/or even surgical exploration. They were included in this study for analyses. Mean age for them was 48.2 years old (range 15-81 years). Small bowel stenosis was present in 59 patients (18.8%). Analyses showed that CT/MRI indicating stenosis was significantly associated with severe stenosis (p = 0.014) but insignificant related to general stenosis (p = 0.097). Predictive factors that accompanied stenosis were age ≥ 60 years (OR = 2.1, 95% CI 1.1-4.0), underweight (BMI ≤ 18.5) (OR = 3.4, 95% CI 1.4-8.4), symptoms of obstruction (OR = 3.6, 95% CI 1.8-7.4), and overt small bowel bleeding (OR = 0.5, 95% CI 0.2-0.9).Conclusions: Small bowel stenosis more tended to occur to patients with symptoms of obstruction, no overt small bowel bleeding, age ≥ 60 years, or underweight. [ABSTRACT FROM AUTHOR]

For Peutz-Jeghers syndrome (PJS) patients, small bowel polyps develop and result in symptoms at an early age. Balloon-assisted enteroscopy (BAE) is verified as a safe and efficient choice to evaluate and remove small intestinal polyps in adult PJS. But the safety of BAE, especially BAE-facilitated polypectomy for young pediatrics, is little known. This prospective study focused on the effectiveness and safety of BAE-facilitated polypectomy in small bowel for young pediatric PJS. PJS patients (aged 0-14 years old) with BAE (including both single-balloon and double-balloon enteroscopies) were included from 1 September 2012 to 30 April 2018. The demographic data, medical history, and details of BAE were recorded. BAE-related complications and symptom relief after BAE were evaluated and compared between the PJS patients aged 5-10 years old (the younger pediatric group) and those aged 11-14 years old (the older pediatric group). A total of 41 pediatric PJS patients (5-14 years old) subjected to 82 BAEs were included. BAE-facilitated polypectomy was performed for 33 children (80.5%), and 242 polyps in small bowel were removed. For 10 (24.4%) patients, one or more giant polyps (maximum diameter larger than 5 cm) were removed. For eight patients, no polypectomy was done as no polyps were observed (six subjects) or not suitable for BAE-facilitated polypectomy (two subjects) because of high risk of perforation. The complication rates of BAE and BAE-facilitated polypectomy were 1.2% (1/82) and 1.8% (1/55), and the symptom relief rate was 70.8% (17/24). Compared with the older pediatric group, the younger pediatric group showed no increased BAE complication rate (0.0% vs. 5.0%, p = 0.488) and a comparable rate of symptom relief after BAE therapy (80.8% vs. 55.6%, p = 0.356).Conclusion: BAE-facilitated polypectomy in young pediatric PJS is safe and effective.What is known:• Small bowel evaluation and prophetic polypectomy are important for pediatric PJS patients to avoid polyp-related intussusception, obstruction, and bleeding.• BAE polypectomy was a recommended intervention for removing small bowel polyps in adult PJS patients.What is new:• BAE-facilitated small bowel polypectomy is safe and effective for young pediatric PJS, even for those aged less than 10 years old. [ABSTRACT FROM AUTHOR]

Highlights • We validated that the combined usage of direct sequencing and MLPA can achieve a high detection rate in Chinese Han PJS patients. • We found significantly more splice mutations in Chinese Han PJS patients. • We suggest that wide usage of enteroscopy would be helpful in PJS surveillance. Abstract Background The combination of direct sequencing and multiple ligation-dependent probe amplification (MLPA) has resulted in an 80% detection rate of serine/threonine kinase 11 (STK11) gene mutations in Peutz-Jeghers syndrome (PJS); however, this rate varies in different ethnicities. Aims To test the efficacy of the combination in Chinese patients with PJS. Methods PJS probands visiting our center during one year were enrolled. Sanger sequencing and MLPA were used to detect STK11 mutations. Associations between the occurrence of severe complications and risk factors were analyzed statistically. Results We identified 47 PJS probands. Among them, 34 received an STK11 mutation test, revealing 23 point mutations and 2 exonic deletions. Nine of the mutations were splicing errors, reflecting a significantly higher proportion (p < 0.05). Laparotomy history existed for 33 of the probands, and seven families had a history of cancer. Statistical analysis revealed no associations between the occurrence of severe complications or cancers and risk factors. Conclusion The strategy achieved a high detection rate in Chinese people, validating its effectiveness. This cohort comprised a significantly higher proportion of splicing errors, reflecting the unique genetic characteristics Chinese people. No specific genotype-phenotype relationship was noted, while the wide usage of enteroscopy would benefit PJS surveillance. [ABSTRACT FROM AUTHOR]

Background and Aims: Peutz-Jeghers syndrome (PJS) is an autosomal-dominant genetic disease caused by mutations in the tumor suppressor gene, STK11, which is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing both gastrointestinal and extraintestinal malignancies.Methods and Results: We treated a PJS patient without a positive family history, who possessed typical clinical manifestations including polyp canceration. In order to explore the genotype of this patient, blood samples were collected from all the available family members. The whole coding region and the flanking regions of the STK11 gene were amplified by polymerase chain reaction and analyzed by Sanger sequencing. Molecular analysis of the STK11 gene here revealed a 23-nucleotide deletion (c.426-448delCGTGCCGGAGAAGCGTTTCCCAG) in exon 3, resulting in a change of 13 codons and a truncating protein (p.S142SfsX13). This mutation was not found in normal individuals in this family including her parents or in 100 control individuals. Protein structure prediction indicated a dramatic loss of the kinase domain and complete loss of the C-terminal regulatory domain.Conclusions: The results presented here enlarge the spectrum of STK11 mutation both disease-causing and malignancy-causing. [ABSTRACT FROM AUTHOR]

Background: To investigate the therapeutic effect of intercellular adhesion molecule (ICAM)-1-modified mesenchymal stem cells (MSCs) in a mouse model of inflammatory bowel disease (IBD) induced by dextran sulfate sodium. Methods: Primary MSCs and ICAM-1-overexpressing MSCs (C3 cells) were generated in vitro. The IBD mouse model was induced with drinking water containing dextran sulfate sodium for 7 days. For stem cell therapy, mice were randomly assigned to six experimental groups: the control group, IBD group, primary MSC group, C3 group, C3-vector group, and C3-ICAM-1 group. Mice were given a single injection of 1 × 106 primary MSCs or gene-modified MSCs via the tail vein on day 3 of DDS administration. The general conditions of the mice in each group were observed. Additionally, the pathological changes in the colon were observed and scored. Primary MSCs and gene-modified MSCs were stained with the fluorescent dye CM-DIL before injection into the tail vein of mice. The distribution of infused cells in IBD mice was observed in frozen sections. Mechanistically, the polarization of Th1, Th2, Th17, and regulatory T cells (Tregs) in the spleen was determined by flow cytometry. Moreover, the mRNA expression levels of IBD-related immune factors in splenocytes were measured by quantitative PCR. Results: A single injection of MSCs promoted general recovery and reduced pathological damage in IBD mice. Additionally, ICAM-1-overexpressing MSCs had stronger therapeutic effects than ICAM-1low MSCs. Furthermore, the in vivo distribution analysis results indicated that a higher number of ICAM-1-overexpressing MSCs homed to the colon and spleen of IBD mice. Moreover, the delivery of ICAM-1 overexpressing MSCs decreased the numbers of Th1 and Th17 cells but increased the number of Tregs in the spleen of IBD mice. The quantitative PCR analysis results revealed that an infusion of ICAM-1-overexpressing MSCs influenced the expression of spleen-derived immune factors by remarkably reducing the mRNA levels of IFN-γ and IL-17A and increasing the mRNA level of Foxp3. Conclusions: Our results demonstrate that ICAM-1-modified mesenchymal stem cells (MSCs) remarkably alleviate inflammatory damage in IBD mice by promoting MSC homing to the target and immune organs. The findings suggest that ICAM-1 is required to maintain the therapeutic effects of MSCs in IBD treatment and identified a novel role of ICAM-1 in inflammatory diseases. [ABSTRACT FROM AUTHOR]

Background: Peutz-Jeghers syndrome (PJS) is a Mendelian disease, whose causative gene is STK11, mainly characterized by gastrointestinal polyposis and increased cancer risk. Clinical observation reveals intussusception in childhood are more frequent and severe than in adults, and it is difficult to prevent this knotty complication.Case Presentation: A boy without a positive family history grew oral MP after birth and developed abdominal pain and bloody stood at 7 years old. Endoscopy revealed multiple polyps within the colon and the ileum, and endoscopic polypectomy and regular surveillance protected him from severe complications and open surgeries. A heterozygous deletion in STK11, c.243delG, was detected in the proband but not in his parents. This mutation has not been documented in databases.Conclusions: We suspect a child of PJS may need a more thorough endoscopic examination including enteroscopy or capsule endoscopy to take care of small bowel when PJS related symptoms comes up. [ABSTRACT FROM AUTHOR]

Background: Peutz-Jeghers syndrome (PJS) is caused by mutations in serine/threonine kinase 11 (STK11) gene. The increased cancer risk has been connected to P53 pathway. Methods: PJS probands with STK11 mutation were included in the function analysis. P53 activity elevated by STK11 mutants was investigated using dual-luciferase reporter assay in vitro after constructing expression vectors of STK11 wild type and mutants generated by site-directed substitution. The association between the P53 activity and clinicopathological factors was analysis, especially the cancer history. Results: Thirteen probands with STK11 mutations were involved, and within the mutations, c.G924A was novel. P53 activity elevation caused by 6 truncating mutations were significantly lower than that of STK11 wild type (P < 0.05). Family history of cancer was observed in 5 families. Within them, P53 activity was reduced and cancer occurred before 40 in 2 families, while it was not significantly changed and cancers happened after 45 in the other 3 families. Conclusions: The affected P53 activity caused by STK11 mutations in PJS patients is significantly associated with protein truncation, while cancer risk in PJS can be elevated through pathways rather than P53 pathway. P53 activity test is probably a useful supporting method to predict cancer risk in PJS, which could be helpful in clinical practice. [ABSTRACT FROM AUTHOR]