Search

In this study, the association between PAPPA2 coding variants and gastrointestinal (GI) nematode fecal egg count (FEC) score in adult Turkish sheep was investigated. For this purpose, the FEC score was determined in adult sheep from six breeds. Sheep were classified as shedders or non-shedders within breeds and flocks. The first group was the fecal egg shedders (> 50 per gram of feces), and the second group was the no fecal egg shedders (≤ 50 per gram of feces). The exon 1, exon 2, exon 5, exon 7, and a part of 5’UTR of the ovine PAPPA2 gene were genotyped by Sanger sequencing of these two groups). Fourteen synonymous and three non-synonymous single nucleotide polymorphisms (SNPs) were found. The non-synonymous SNPs; D109N, D391H, and L409R variants, are reported for the first time. Two haplotype blocks were constructed on exon 2 and exon 7. The specific haplotype, C391G424G449T473C515A542 on the exon 2 that carries the 391H variant, was tested against four other common haplotypes. Our results indicate that C391G424G449T473C515A542 haplotype was significantly associated with fecal egg shedding status in adult Turkish sheep (p-value, 0.044).

Texte sind nicht nur in der Lage, unsere Gefühle, Informationen oder Behauptungen zu vermitteln, sie beinhalten ebenfalls kulturelle, gesellschaftliche und situative Eigenschaften, die in einer sprachlichen Vermittlung als unentbehrlich erachtet werden. Deshalb ist es maßgeblich zu konstatieren, dass Texte im Grunde genommen vielmehr als eine bloße schriftliche Einheit ausmachen, zumal es sich in der ersten Linie um eine konkrete sprachliche Äußerung handelt. In der vorliegenden Arbeit werden in Anbetracht von textlinguistischen Methoden und Grundannahmen die wesentlichen Beiträge der Textlinguistik zum DaF Unterricht explizit veranschaulicht, indem der Unterrichtstext ,,Montagmorgen, 06.38 Uhr‘‘ aus dem Kursbuch ,,Menschen A 1.2‘‘ aus unterschiedlichen Gesichtspunkten eingehend analysiert und evaluiert wird. Sowohl in der Vergangenheit als auch in der Gegenwart fungieren Texte kognitiv und emotiv als grundsätzliche Bestandteile für den menschlichen Informationserwerb. Nach der sog., „Pragmatischen Wende‘‘ in den 60er Jahren vertraten eine bemerkenswerte Anzahl von Sprachwissenschaftlern die Auffassung, dass Texte neben sprachlich immanenten Eigenschaften zusätzlich aus durchaus komplexen, Situation basierenden Funktionen zusammengesetzt sind, die für die Kommunikation eine grundlegende Rolle spielen. Im Rahmen des gemeinsamen europäischen Referenzrahmens kann erwähnt werden, dass die Fragen im Text, die für die Sprachstufe A1 erwähnten Kriterien erfüllen, da der Sprecher in dieser Stufe in der Lage ist, sich unkompliziert vorzustellen. Der Text „Montagmorgen, 06.38 Uhr“ hat eine komplexe inhaltliche Struktur aber erfüllt die Kriterien für Sprachstufe A1.

In recent years, the importance and use of wet-white tanning technology have increased due to the increase in environmental and health concerns. On the other hand, this technology still has problems related with fixation of dyestuff and fatliquoring agents during wet-end processes. In this study, the effect of the use of different commercial amphoteric retanning agents in different ratios on dyestuff consumption was investigated. For this purpose, amphoteric polymers were used at the beginning of dyeing process of syntan tanned leathers and the concentrations of remaining dyestuff after the process have been measured using UV-Vis Spectrophotometer for each trial. From the results it was concluded that the use of amphoteric polymers in retanning of wet-white tanned leathers significantly decreased the remaining dyestuff in the floats. Also, the physical and mechanical properties of the final leather were not adversely affected up to the use of 6 wt% the amphoteric polymer.

To determine the von Mises stress values of extramaxillary implants anchored in zygomatic bone, known as zygomatic implants, abutments, superstructures, and principal stress values of bone under occlusal forces and to compare them with tilted implants and sinus elevation concepts. The hypothesis of the study was that there would be higher stress on zygomatic implants under occlusal forces compared with tilted implants and the sinus elevation technique due to the more angled placement of the zygomatic implants.Finite element analysis (FEA) was used to apply a force of 600 N (75 N premolars and 150 N first molar) vertically and at an angle of 20 degrees to the hybrid prosthesis with three different concepts-zygomatic implants, tilted implants, and sinus elevation-in D2 bones in six separate models. The posterior implants were tilted in zygomatic implant models (45 degrees) and tilted implant models (30 degrees). The von Mises and principal stress values formed in the models were compared by FEA. These values were also compared with the physiologic stress limit of the bone.In the zygomatic implant models, the von Mises stress values on both anterior and posterior implants were less than other models under both loading conditions. In addition, the lowest principal stress values were seen in these models. The highest von Mises stress among all models was found to be posterior implants in tilted implant models under oblique loading. In addition, the highest principal stress values were seen at posterior implants in the sinus elevation model under oblique loading. Vertical loading was found to induce less stress than loading at a 30-degree angle.Although zygomatic implants have a more angled placement, the stress values on the bone and implants are lower.

Reniform nematodes (Rotylenchulus spp.) have been reported to be associated with a large number of important products all over the world, ranging from important cereals, vegetables and ornamental plants. In this study, morphologic and molecular characters were used to idetify Rotylenchulus population obtained from a soybean field in Adana province of Turkey. Nematodes were extracted from the soil using a modified baermann funnel method. The morphological characters and morphometrics of male and immature females were examined and compared with previous studies. For molecular characterisation, DNA was extracted from immature females and the D2-D3 expansion region of the 28S rRNA gene was amplified using primer pair D2A (5’ACA AGTACCGTGAGGGAAAGTTG 3’) and D3B (5’ TCGGAAGGAACCAGCTACTA 3’). PCR product (780 bp) was sequenced and then compared with sequences of Rotylenchulus species available in the GenBank database. The result obtained from morphologic and molecular studies showed that the reniform nematode population was Rotylenchulus borealis.

PURPOSE Discectomy is 1 of the preferred TMJ surgical procedure for the treatment of internal derangements when conservative and minimally invasive treatments have failed. The purpose of the current study is to investigate whether a TMJ discectomy operation influences auditory function and clinical variables. MATERIALS AND METHODS This prospective study was composed of patients who underwent a TMJ discectomy operation between 2016 and 2020. Auditory function was evaluated with pure tone audiometry, tympanometry, and acoustic reflex tests at preoperatively (T0), postoperative first week (T1), first month (T2), and third month (T3). Clinical parameters including maximum mouth opening (MMO) and TMJ pain were also evaluated at T0, T1, T2, T3, and sixth month (T4). RESULTS The study consisted of 17 patients (5 males, 12 females) with a mean age of 42.65. A significant reduction in VAS pain scores and MMO values compared to baseline values was achieved in all follow up periods (PT0-T1= .001; PT0-T2/T3/T4 < .001). In pure tone audiometry, a significant increase in T1-T0 comparisons at 1000 Hz, 2000 Hz, 6000 Hz, 8000 Hz frequencies, and pure tone average (P = .008; P = .005; P = .012; P = .002; P = .001) was observed. In T3-T0 comparisons, a statistically significant decrease was observed in pure tone thresholds at 125 Hz and 8000 Hz frequencies (P = .008; P = .01). There was no statistically significant difference in middle ear pressure and compliance values at T1, T2, and T3 compared to T0 (P ˃ .05). Type C tympanogram was seen in 3 patients at T1 and in 1 patient at T2. Acoustic reflex tests were positive in all patients. CONCLUSIONS Although mild changes occurred in auditory tests in the early postoperative period, TMJ discectomy procedure has no permanent effect on auditory function.

Osmanlı İmparatorluğu dönemi boyunca İzmir ve çevresinde yaşayan Yahudiler, İzmir'in Yunan işgalinden kurtulmasıyla Rumların ve Ermenilerin şehri terk etmesinden dolayı İzmir’in tek azınlık topluğu hâline gelmişlerdir. İzmir’in dinî, kültürel ve sosyoekonomik hayatında önemli bir yere sahip olan İzmir Yahudileri, İkinci Dünya Savaşı’nın getirdiği olumsuzluklardan etkilenmişlerdir. İkinci Dünya Savaşı yıllarında yürürlüğe konan bazı uygulamalar İzmir Yahudilerinde tedirginliğe yol açmıştır. Bu uygulamalardan biri olan Varlık Vergisi, İzmir Yahudilerini çeşitli yönlerden etkilemiştir. Bu araştırma, İkinci Dünya Savaşı yıllarında yürürlüğe konan Varlık Vergisi uygulamasının İzmir Yahudilerini nasıl etkilediğini incelemektedir. Bu inceleme ‘‘Varlık Vergisi İzmir’de nasıl uygulandı? Varlık Vergisi’nin İzmir Yahudilerine etkileri nelerdir? Varlık Vergisi uygulaması, o günleri yaşayan İzmirli Yahudilerinin belleklerinde nasıl bir yere sahiptir?’’ sorularına cevap aramaktadır. Bu araştırmanın veri kaynaklarını dönemin İzmir basınından derlenen haberler, ilanlar ve veriler teşkil etmektedir. Araştırmada dönemin İzmir basının önde gelen iki gazetesi olan Yeni Asır ve Anadolu gazeteleri incelenmiştir. Ayrıca bu araştırmanın veri kaynaklarını, İzmir Musevi Cemaati Vakfı Arşivi, İzmir Ticaret Odası Arşivi, araştırma çalışmalarından derlenen bilgiler, İkinci Dünya Savaşı yıllarını yaşamış İzmirli Yahudiler ve İzmir Musevi Cemaati Vakfı yetkilileriyle yapılan görüşmeler oluşturmaktadır. Araştırmalardan elde edilen veriler analiz edilip okunabilir hale getirilerek İzmir Yahudilerinin Varlık Vergisi uygulamasından nasıl etkilendiği değerlendirilmeye çalışılmıştır. Bu araştırma, İkinci Dünya Savaşı yıllarında yürürlüğe konan Varlık Vergisi İzmir uygulamasının İzmir Yahudilerini sosyal ve ekonomik yönlerden nasıl etkilediğini ele almayı amaçlamaktadır. Bu amaçla araştırmada Varlık Vergisi uygulamasının her aşamasında gerçekleşen hadiseler istatistiklerle ifade edilmiştir. Bu İnceleme Varlık Vergisi uygulamasının İzmir’de nasıl tatbik edildiğini çeşitli açılardan ele almaya çalışmaktadır.

This study was conducted to determine temperament and maternal care classes, CYP17 gene polymorphisms, and cortisol status of a group of Norduz ewes. Additionally, the relationships between these factors, their effects on lambs survival and growth characteristics were investigated. A total of 72 ewes were subjected to arena and isolation box tests to determine their temperament classes. The distance the ewe retreated from the lamb during tagging was utilized to assess ewe maternal care classes. Ewes were genotyped for CYP17 628 SNP. Blood samples were collected between lambing and weaning to measure cortisol concentrations of ewes. The survival and growth data for the lambs of these ewes were recorded until weaning. Two temperament (low reactive and high reactive) and 2 maternal care classes (strong and moderate) were present. Two CYP 17 SNP 628 alleles (A and G) and 3 genotypes (AA, AG, and GG) were identified. For the distribution of CYP17 genotype frequencies within the population, the temperament or maternal care classes were not different (P > 0.05). The temperament of ewes did not affect maternal care in our flock. Positive partial correlations between cortisol and total cross, distance to stimulus, and sniffing were determined (P 0.05). Although there was no significant relationship among CYP17 genotype, maternal care, and lamb survival and growth, the effect of CYP17 genotype on some behavioral traits and cortisol release was found to be significant. Further studies with larger animal populations are required to elucidate the possible use of CYP17 SNP 628 genotypes as genetic markers for temperament classification.

Background: Distal osteotomy of the first metatarsal is a widely used method for the correction of mild-to-moderate hallux valgus deformities. The objective of this study was to compare the stability of headless compression screws, kirschner wires and absorbable pins in terms of stiffness and maximum load in distal oblique metatarsal osteotomy. Methods: A total of 30 4th generation first metatarsal synthetic bone models were divided into three groups according to the fixation techniques. The stiffness of the first metatarsal was calculated as the slope of the linear curve that fit with the first linear part of the force displacement curve. The failure strength was recorded as the maximum load. The stiffness and maximum load values in the axillary and transverse configurations were compared between the three fixation groups. Results: The stiffness was statistically higher in Group K and Group C compared to Group B in both axial and transverse loading. Similarly, the maximum load was significantly higher in both Group K and Group C compared to Group B in both loading conditions. No significant difference was found between Group K and Group C in stability. The higher failure strength was obtained with headless compression screws (113.34±35.88 N) in the axial loading. The lowest failure strength was found in the absorbable pins technique (16.17±7.72 N) in the transverse loading. Conclusion: No significant difference was found between the Kirschner wires and headless compression screws techniques, although the highest strength was obtained with headless compression screws that are increasingly used in orthopedic practice.

Nowadays educational environments are shaped as individual-centered and it is desired to spread the concept of teaching with different method and techniques to a process. In line with the scientific and technological advances that have gained speed in recent years, the learning-teaching processes are also gaining a different identity. An individual-centered, active and dynamic process is emphasized, especially in today's educational environments. As a result of this basic emphasis, the role of the teacher and the effectiveness of the tools, equipment and materials in education processes are also discussed. When it comes to the most basic tools in learning environments, undoubtedly, textbooks that are compatible with the curriculum reflecting the general education policy and philosophy of the country are among the first things that come to mind. In today's understanding of education, where innovation, development and quality in education are emphasized, new elements have emerged that will enable individuals to be active in all lessons and support the development of individuals, especially the social studies course, which has an interdisciplinary approach structurally. Thus, the concepts of "value" and "values education" have gained importance in this respect. In this study, it is aimed to examine the textbook in terms of values education by focusing on the texts in the Social Studies 6th grade textbook. For this purpose, the 6th grade social studies textbook was examined and it was seen that the values included in the textbook were frequently emphasized 181 times. Among the values, responsibility, peace and family unity are emphasized; It is understood that the least saving value is found.

Johne’s disease is a chronic, contagious, zoonotic disease that affects numerous species including livestock and sometimes humans. The disease is globally distributed in sheep populations and cause...

Klippel-Trenaunay syndrome is a rare vascular disorder which includes leg swelling, or lower extremity deep venous reflux/thrombosis as a presenting symptom. May-Thurner syndrome is also a rare pathology involving compression of the left common iliac vein, usually by the right common iliac artery. The incidence of concomitant occurrence of these entities is unknown and not well reported. This case series describes 3 patients who underwent evaluation of symptomatic left lower extremity venous disease. All 3 suffered symptomatic Klippel-Trenaunay initially, and were subsequently diagnosed with concomitant May-Thurner Syndrome. They were successfully treated with left common iliac vein stents with symptomatic improvement.

Farklı kültürlerin bir arada eğitim gördüğü bir ülke olan Almanya’da iki dilli eserler orada yaşayan farklı kültürden gelen çocuk ve gençlerin eğitiminde önemlidir. Çocuk ve Gençlik Edebiyatı`nın didaktik bir işlevi vardır. Toplumlar yeniden inşa edilirken birey eğitiminin de değişmesi kaçınılmaz olmuştur. Çocuk ve gençlik kitapları bu kişilerin eğitimi için başlangıç eserleri olmuştur. Çocuklar meraklıdır ve çevrelerini keşfetmek isterler. Bir çocuk kendi çevresi ve kitapları aracılığıyla değerleri öğrenir. Her yaş için, gelişimin her aşaması için, her durum için karşılık gelen edebiyatlar vardır. Yaşanılan hayat ile ilgili fikirler, değerler, farklı deneyimler yaşandıkça değişir veya kalıcı hale gelir. Bu çalışmada Türkçe ve Almanca olarak iki dilli olarak kaleme alınmış Heinrich Hoffmann’ın “Savruk Peter - Der Struwwelpeter” ve Jessica Störmer’in “Nur Mut, Kurt! - Cesur ol Korkut” eserleri incelenmiştir. Eser karşılaştırmasında eserlerin ilkokul çocuklarına uygunluğu, kitabın görsel tasarımı, içerisindeki kültürel ögeler ve imgeler dikkate alınmıştır. Çocuklara verilen değerler eğitiminin yöntemi olarak korku ve merak gibi farklı duyguların kullanıldığı ve dönem içerisinde nasıl değişiklik gösterdiği vurgulanmıştır. Ayrıca eserlerin iki dilli olması Alman toplumu içerisinde yaşayan Türk kökenli çocukların hedef kitle olması bakımından da önemlidir. Çalışmada, çocukların değerleri kavramaları için nelerin yapılması gerektiği eserler üzerinden incelenmiştir. Eserlerde örnek davranışlar ve sonuçlar yer almaktadır. Sonuç olarak çalışmada çocukların gelişim döneminde dış dünyayı tanımalarının ve algılamalarının edebi eserler aracılığı ile nasıl şekillendirilebildiği ve çocuklar ile gençlerin bu sürece ne şekilde ihtiyaç duyduğu ortaya konulmuştur. Didaktik bir bakış açısından, her iki eser de değerler eğitimi açısından öğreticidir. Störmer'in eseri çocuklara “cesaret” kavramını, Hoffmann'ın eseri ise “iyi” kavramını aktarmaktadır., In Germany, a country where different cultures study together, bilingual literary works are important for the education of children and young adults from different cultures living there. Children’s and Young Adult literature has a didactic function. While societies are being rebuilt, change in education has become inevitable. Children and young adult books have been used as beginner works for the education of individuals. Children are curious and they want to explore their environment. A child learns the values through his/her environment and books. There are literary works for every age, every developmental period and every case. Ideas, values and different experiences about the life spent change or become permanent as it is spent. In this study, Heinrich Hoffmann’s “Savruk Peter-Der Struwwelpeter” and Jessica Störmer’s “Nur Mut, Kurt! - Cesur ol Korkut” works written bilingually in Turkish and German were analysed. While comparing the works, the suitability of the works for primary school children, the visual design of the book, cultural elements and images it contains were considered. It was emphasised that different emotions such as fear and curiosity were used as a method of values education given to children and how it changes within the term. Besides, bilingualism of the works is important in that Turkish children living in German society are the target audience. In the study, what must be done so that children can comprehend the values was viewed through the works. Model behaviours and consequences are involved in the works. As a result, how recognising and sensing the outer world during the developmental period is formed via literary works and how children and young adults need this process was revealed in the study. From a didactic point of view, both works are didactic in terms of values education. While Störmer’s work conveys the “courage” Notion, Hoffmann’s work conveys the “good” notion to children.

Mekân ve zaman birlikteliğinin bir zorunluluk olmaktan çıkmasıyla gözetim de yeni bir biçim kazanmış̧, kâğıda dayalı gözetim kavramı siber uzayda yeniden anlamlanmıştır. Gözetim altında tutulan bireyin erk tarafından kontrol edilmesi ve yönlendirilmesi günümüzün en sık tartışılan konularından birisidir. Günümüzde birey, siber uzayda sürekli izlendiği, kontrol altına alındığı, izlendiğini bilerek oto sansürü gönüllü bir şekilde oluşturduğu bir yaşam sürmektedir. Kafka bu denetim mekanizmasını daha 20. yüzyılın başlarında görmüş̧ ve eserlerine yansıtmıştır. Kafka yüzyıl öncesinden eserinde, görünmeyen erk karşısında her şeyi kabul eden, suçlanan, bunu doğal karşılayan ve hatta gündelik hayatına olduğu gibi devam eden bir bireyi tasvir ederek günümüze aktarmıştır. Eserindeki, insanları izleyen sembolik gözler artık ete kemiğe bürünmüş ve caddelerde, alışveriş̧ merkezlerinde, okullarda, evlerin girişlerinde bizi izleyen kameralara dönüşmüştür. Çalışmanın amacı edebi eserlere yansıyan siber gözetim, siber uzay gibi kavramların ve sembollerin Dava eseri üzerinden incelenerek çözümlemesinin yapılmasıdır. Bireyin değişen toplumsal olaylar karşısında kendisini koruma ve var etme çabası ele alınmıştır. Sonuç̧ olarak salgın, terör ve siber saldırılar gibi insanların çaresiz kaldığı ve korku faktörünün en üst seviyede olduğu bir donemde, kişiler bilgiye siber uzay içinde var olan sanal platformlardan ulaşabilmekte ve dolaylı olarak bu gözetleme mekanizmasına da rıza göstermektedirler. Kafka’nın anlatımı üzerinden günümüz insanının içinde bulunduğu durum eser incelemesi yapılarak irdelenmiş̧ ve insanların sürekli gözetim altında tutulmak konusunda, teknolojinin getirdiği yeni olanaklardan faydalanmak adına tepkisiz kaldığı ortaya konulmuştur., With the fact that togetherness of space and time is no longer a necessity, surveillance has also gained a new form, and the concept of paper-based surveillance has been re-enacted in cyberspace. Controlling and directing the individual under surveillance by the government is one of the most discussed issues of our time. Today, the individual is constantly monitored, controlled and monitored in cyberspace, and the auto censorship voluntarily creates a life. Kafka saw this control mechanism in the early 20th century and reflected it on his works. Kafka has passed it on to the present day centuries ago in his work, depicting an individual who accepts everything in the face of unseen men, who is accused, who welcomes it naturally and even continues his daily life as it is. The symbolic eyes in his work, which followed people, turned now into cameras that follow us in the streets, shopping malls, schools, entrances of houses. The aim of the study is to examine and analyze concepts such as cyber surveillance and cyberspace, reflected in literary works through The Trial. The individual's efforts to protect and exist in the face of changing social events have been discussed. As a result, at a time when people such as epidemics, terrorism and cyber attacks are helpless and the fear factor is at the highest level, people can access information from virtual platforms that exist within cyberspace, and indirectly consent to this surveillance mechanism. Kafka's narration was examined by the work review of today's people and it was revealed that people remain unresponsive in order to take advantage of the new possibilities brought by technology in order to keep them under constant supervision.

To evaluate the effects of systemic medical ozone (O3) application and hyperbaric oxygen (HBO) therapy on surgically induced knee osteoarthritis (OA) in a rat model. We performed anterior cruciate ligament transection (ACLT) in order to create experimental OA in the right knees of 27 male rats. The left knee joints of all rats were sham-operated without ACLT as the negative control group. The rats were randomly assigned into three groups: (1) control group, which received no treatment; (2) O3 group, which received intraperitoneal 30 μg medical O3; (3) HBO group, which received HBO therapy for 60 minutes twice a day. We sacrificed the rats on the tenth week after the operation. We evaluated the degree of OA using Mankin scores. As a result of histopathological examination, the mean Mankin scores in the right knees with ACLT were 8.17 ± 2.12 in the control group, 6.22 ± 1.56 in the HBO group, and 4.72 ± 1.30 in the O3 group. The differences between the O3 group and the HBO group and the O3 group and the control group were found to be statistically significant (p 0.001, p 0.039, respectively). There was no difference between the HBO group and the control group (p 0.086). The results of the present study show that systemic medical O3 application was more effective than HBO therapy and may reduce development of cartilage damage and prevent OA formation.

Essential tremor (ET) is one of the most common movement disorders. Aside from tremor, patients may exhibit other motor features as well as non-motor features, including neuropsychiatric symptoms. The cerebellum and cerebellar connections are thought to play a key role in the pathophysiology of ET. Cognitive and affective disturbances can occur in the context of cerebellar disease. Our aim was to study the prevalence and clinical correlates of alexithymia and its relationship to depression and anxiety in ET patients and control subjects (CS).We enrolled 100 ET patients and 100 age- and gender-matched CS. The Toronto Alexithymia Scale-20 (TAS-20), the Beck depression inventory-II and the Beck anxiety inventory were administered.Alexithymia levels were significantly higher in ET patients than CS (respective mean TAS-20 scores = 50.63 ± 9.79 vs. 44.05 ± 12.51, p 0.001). There were robust associations between alexithymia, depressive symptoms, and anxiety but, after excluding the ET patients and the CS who had moderate or severe depression or who had moderate or severe anxiety, the total alexithymia score remained significantly higher in the ET than the CS group (46.78 ± 9.19 vs. 41.18 ± 11.79, p ≤ 0.01).This study suggests that prevalence of alexithymia is significantly higher in ET patients. Alexithymia might be another non-motor neuropsychiatric symptom of the disease. Further studies are needed to confirm and expand upon our findings.

This study was carried out in order to identify the body measurements of two different Dromedary camel breeds raised in Algeria. The animal material of the study consisted of a total of 115 animals belong to Steppe (n = 55) and Sahraoui (n = 60) camel breeds. Eye and coat colors along with body measurements such as head length, neck length, neck girth, tail length, distance between eyes, distance between ears, body length, withers height, chest girth, and live weight were determined. Least squares means for head length, neck length, neck girth, tail length, distance between eyes, distance between ears, body length, withers height, chest girth, and live weight are found 48.2, 116.9, 65.7, 55.6, 24.1, 22.5, 152.2, 184.5, 141.2 cm, and 217.2 kg for Steppe and 48.1, 101.2, 56.2, 51.2, 23.4, 18.3, 135.6, 167.3, 176.8 cm, and 298.9 kg for Sahraoui camel breeds, respectively. The distribution of brown and black eye colors for the Steppe camel breed is as 58.2% and 41.8%, respectively, while all of the Sahraoui camels studied had a brown eye color. The proportional distribution in terms of body color included are coffee, dark coffee, and red colors for 1.8%, 83.6%, and 14.6% in the Steppe camel and 98.3%, 1.7%, and 0.0% for the Sahraoui camel, respectively. As a result, this study concluded that the withers height and chest girth could estimate the body weight in the two breeds of camels with different ages.