Search

Your search keyword '"Pepper, Alan"' showing total 181 results
Start Over Author "Pepper, Alan"
181 results on '"Pepper, Alan"'

10. Evolution of Genome Size in Brassicaceae

Author

JOHNSTON, J. SPENCER, PEPPER, ALAN E., HALL, ANNE E., CHEN, Z. JEFFREY, HODNETT, GEORGE, DRABEK, JANICE, LOPEZ, REBECCA, and PRICE, H. JAMES

Published
2005

13. Comparative Analysis of Temporal Transcriptome Reveals the Relationship Between Pectin Degradation and Pathogenicity of Defoliating Verticillium Dahliae to Upland Cotton (Gossypium Hirsutum)

Author

Zhang, Fan, primary, Zhang, Jiayi, additional, Chen, Wanqing, additional, Liu, Xinran, additional, Li, Cheng, additional, Cao, Yuefen, additional, Zhao, Tianlun, additional, Lu, Donglin, additional, Hui, Yixuan, additional, Zhang, Yi, additional, Chen, Jinhong, additional, Zhang, Jingze, additional, Pepper, Alan E., additional, Yu, John Z., additional, and Zhu, Shuijin, additional

Published
2020
Full Text
View/download PDF

16. Extragenic suppressors of the Arabidopsis det1 mutant identify elements of flowering-time and light-response regulatory pathways

Author

Pepper, Alan E. and Chory, Joanne

Subjects
Arabidopsis thaliana -- Genetic aspects, Suppression, Genetic -- Research, Photoreceptors -- Research, Plant cellular control mechanisms -- Research, Plant morphogenesis -- Genetic aspects, Phototropism -- Genetic aspects, Biological sciences
Abstract

Light regulation of seedling morphogenesis is mediated by photoreceptors that perceive red, far-red, blue and UV light. Photomorphogenetic mutants of Arabidopsis have identified several of the primary photoreceptors, as well as a set of negative regulators of seedling photomorphogenesis, including DET1, that appear to act downstream of the photoreceptors. To study the regulatory context in which DET1 acts to repress photomorphogenesis, we used a simple morphological screen to isolate extragenic mutations in six loci, designated ted (for reversal of the det phenotype), that partially or fully suppress the seedling morphological phenotype of det1-1. Genetic analyses indicate that mutations in the ted4 and ted5 loci identify new alleles of the previously described photomorphogenetic loci hy1 and hy5, respectively. Molecular analyses indicate that the ted mutations partially suppress the dark-grown gene expression phenotype of det1-1, and that the mechanism of suppression does not involve direct remediation of the splicing defect caused by the det1-1 mutation. The ted mutations also partially suppress the light-grown morphological phenotype of mature det1-1 plants, and ted1 and ted2 suppress a daylength insensitivity phenotype of det1. TED1, TED2 and TED3 are newly described genes, whose function appears closely associated with that of DET1. In addition, alleles of ted1 are associated with a moderate late-flowering phenotype, suggesting that TED1 plays a role in the pathways that regulate both seedling morphogenesis and the initiation of flowering.

Published
1997

17. DET1, a negative regulator of light-mediated development and gene expression in Arabidopsis, encodes a novel nuclear-localized protein

Author

Pepper, Alan, Delaney, Terrence, Washburn, Tracy, Poole, Daniel, and Chory, Joanne

Subjects
Arabidopsis -- Genetic aspects, Gene expression -- Research, Photoreceptors -- Analysis, Biological sciences
Abstract

DET1 is a nuclear localized protein that negatively regulates steady state levels of mRNAs that do not vary between light and dark-grown wild-type plants and influences morphogenesis and gene expression following post-transcriptional modification. DET1 facilitates the DNA binding activity called CA-1 with its cis-acting site forming transient part of CA-1 complex. Spatial and temporal development signals are coordinated with light signals through modification of DET1 activity.

Published
1994

20. Genes regulating gland development in the cotton plant

Author

Janga, Madhusudhana R., primary, Pandeya, Devendra, additional, Campbell, LeAnne M., additional, Konganti, Kranti, additional, Villafuerte, Stephany Toinga, additional, Puckhaber, Lorraine, additional, Pepper, Alan, additional, Stipanovic, Robert D., additional, Scheffler, Jodi A., additional, and Rathore, Keerti S., additional

Published
2018
Full Text
View/download PDF

21. Duplication, divergence and persistence in the Phytochrome photoreceptor gene family of cottons (Gossypium spp.)

Author

Abdukarimov Abdusattor, Logan-Young Carla, Buriev Zabardast T, Abdurakhmonov Ibrokhim Y, and Pepper Alan E

Subjects
Botany, QK1-989
Abstract

Abstract Background Phytochromes are a family of red/far-red photoreceptors that regulate a number of important developmental traits in cotton (Gossypium spp.), including plant architecture, fiber development, and photoperiodic flowering. Little is known about the composition and evolution of the phytochrome gene family in diploid (G. herbaceum, G. raimondii) or allotetraploid (G. hirsutum, G. barbadense) cotton species. The objective of this study was to obtain a preliminary inventory and molecular-evolutionary characterization of the phytochrome gene family in cotton. Results We used comparative sequence resources to design low-degeneracy PCR primers that amplify genomic sequence tags (GSTs) for members of the PHYA, PHYB/D, PHYC and PHYE gene sub-families from A- and D-genome diploid and AD-genome allotetraploid Gossypium species. We identified two paralogous PHYA genes (designated PHYA1 and PHYA2) in diploid cottons, the result of a Malvaceae-specific PHYA gene duplication that occurred approximately 14 million years ago (MYA), before the divergence of the A- and D-genome ancestors. We identified a single gene copy of PHYB, PHYC, and PHYE in diploid cottons. The allotetraploid genomes have largely retained the complete gene complements inherited from both of the diploid genome ancestors, with at least four PHYA genes and two genes encoding PHYB, PHYC and PHYE in the AD-genomes. We did not identify a PHYD gene in any cotton genomes examined. Conclusions Detailed sequence analysis suggests that phytochrome genes retained after duplication by segmental duplication and allopolyploidy appear to be evolving independently under a birth-and-death-process with strong purifying selection. Our study provides a preliminary phytochrome gene inventory that is necessary and sufficient for further characterization of the biological functions of each of the cotton phytochrome genes, and for the development of 'candidate gene' markers that are potentially useful for cotton improvement via modern marker-assisted selection strategies.

Published
2010
Full Text
View/download PDF

23. CMD: a Cotton Microsatellite Database resource for Gossypium genomics

Author

Liu Shaolin, Burr Ben, Saha Sukumar, Ulloa Mauricio, Eshelman Robert, Staton Margaret, Ficklin Stephen, Yellambalase Preetham, Muthukumar Sriram, Jung Sook, Jesudurai Christopher, Yu John Z, Lacape Jean-Marc, Scheffler Brian, Palmer Michael, Scheffler Jodi, Blenda Anna, Zhang Tianzhen, Fang Deqiu, Pepper Alan, Kumpatla Siva, Jacobs John, Tomkins Jeff, Cantrell Roy, and Main Dorrie

Subjects
Biotechnology, TP248.13-248.65, Genetics, QH426-470
Abstract

Abstract Background The Cotton Microsatellite Database (CMD) http://www.cottonssr.org is a curated and integrated web-based relational database providing centralized access to publicly available cotton microsatellites, an invaluable resource for basic and applied research in cotton breeding. Description At present CMD contains publication, sequence, primer, mapping and homology data for nine major cotton microsatellite projects, collectively representing 5,484 microsatellites. In addition, CMD displays data for three of the microsatellite projects that have been screened against a panel of core germplasm. The standardized panel consists of 12 diverse genotypes including genetic standards, mapping parents, BAC donors, subgenome representatives, unique breeding lines, exotic introgression sources, and contemporary Upland cottons with significant acreage. A suite of online microsatellite data mining tools are accessible at CMD. These include an SSR server which identifies microsatellites, primers, open reading frames, and GC-content of uploaded sequences; BLAST and FASTA servers providing sequence similarity searches against the existing cotton SSR sequences and primers, a CAP3 server to assemble EST sequences into longer transcripts prior to mining for SSRs, and CMap, a viewer for comparing cotton SSR maps. Conclusion The collection of publicly available cotton SSR markers in a centralized, readily accessible and curated web-enabled database provides a more efficient utilization of microsatellite resources and will help accelerate basic and applied research in molecular breeding and genetic mapping in Gossypium spp.

Published
2006
Full Text
View/download PDF

24. Additional file 1: of Diversity analysis of cotton (Gossypium hirsutum L.) germplasm using the CottonSNP63K Array

Author

Hinze, Lori, Hulse-Kemp, Amanda, Wilson, Iain, Qian-Hao Zhu, Llewellyn, Danny, Taylor, Jen, Spriggs, Andrew, Fang, David, Ulloa, Mauricio, Burke, John, Giband, Marc, Jean-Marc Lacape, Deynze, Allen Van, Udall, Joshua, Scheffler, Jodi, Hague, Steve, Wendel, Jonathan, Pepper, Alan, Frelichowski, James, Lawley, Cindy, Jones, Don, Percy, Richard, and Stelly, David

Subjects
food and beverages
Abstract

Results and discussion in relation to the removal of admixed/misclassified samples. Five samples were removed from overall SNP diversity analysis, and three samples were removed from the comparison of SNP and SSR data. This file presents the original results and discusses why the samples were subsequently removed. For the original diversity analysis, this file includes the MDS figures, Venn diagrams of unique and shared SNPs, and distribution of pairwise IBS values when these samples are included. Likewise, for the comparison of SNP and SSR data, the original principal coordinate analyses and the plots comparing SNP- and SSR-based genetic similarity are shown. (DOCX 325Â kb)

Published
2017
Full Text
View/download PDF

26. QTL mapping for flowering-time and photoperiod insensitivity of cotton Gossypium darwinii Watt

Author

Kushanov, Fakhriddin N., primary, Buriev, Zabardast T., additional, Shermatov, Shukhrat E., additional, Turaev, Ozod S., additional, Norov, Tokhir M., additional, Pepper, Alan E., additional, Saha, Sukumar, additional, Ulloa, Mauricio, additional, Yu, John Z., additional, Jenkins, Johnie N., additional, Abdukarimov, Abdusattor, additional, and Abdurakhmonov, Ibrokhim Y., additional

Published
2017
Full Text
View/download PDF

27. Additional file 1: Figure S1a. of Development, genetic mapping and QTL association of cotton PHYA, PHYB, and HY5-specific CAPS and dCAPS markers

Author

Fakhriddin Kushanov, Pepper, Alan, Yu, John, Zabardast Buriev, Shermatov, Shukhrat, Sukumar Saha, Ulloa, Mauricio, Jenkins, Johnie, Abdusattor Abdukarimov, and Ibrokhim Abdurakhmonov

Abstract

The examples of PHYBdCAPs-2 markers segregating among TM-1 × 3–79 RIL lines. (M) – Molecular-weight size marker of 25-bp ladder, ‘TM-1’ and ‘Pima 3–79’ – parents, F1 – first-generation hybrid, 13–51 – RIL individuals. Note: the 144-bp band is more intensive in G. hirsutum and the 180-bp band is more intensive in G. barbadense genotypes, while 36-bp band is not visible to detect. Heterozygots show two intensive bands of 180- and 144-bp, respectively. Primer information for PHYBdCAPs-2: F-5’GAAGATCATAAAAAGGCTATATACGTGGTGGTTA3’; R-5’CAAAGGATTGGGACTATGAACAATGG3’; Figure S1b. Genetic linkage maps with integration of PHYBdCAPs and PHYBdCAPs-2 corresponding to chromosome 10 of the A-sub-genome [48, 49]. QTL designations on the map are follows as Ns - nep size; Nn - number of neps; UQL - upper quartile of fiber length by weight; SFC - short fiber content by weight g; ALFw - average length of all fiber by weight; 5.0 L - fiber span length; 2.5 L - fiber span length; VFM – visible foreign matter in percentage; FTX - fiber fineness; IFC - immature fiber content by weight g; MR - maturity ratio; MT - mean tenacity; and ME - mean elongation. (DOCX 820 kb)

Published
2016
Full Text
View/download PDF

29. Diversity analysis of cotton (Gossypium hirsutum L.) germplasm using the CottonSNP63K Array

Author

Hinze, Lori L., primary, Hulse-Kemp, Amanda M., additional, Wilson, Iain W., additional, Zhu, Qian-Hao, additional, Llewellyn, Danny J., additional, Taylor, Jen M., additional, Spriggs, Andrew, additional, Fang, David D., additional, Ulloa, Mauricio, additional, Burke, John J., additional, Giband, Marc, additional, Lacape, Jean-Marc, additional, Van Deynze, Allen, additional, Udall, Joshua A., additional, Scheffler, Jodi A., additional, Hague, Steve, additional, Wendel, Jonathan F., additional, Pepper, Alan E., additional, Frelichowski, James, additional, Lawley, Cindy T., additional, Jones, Don C., additional, Percy, Richard G., additional, and Stelly, David M., additional

Published
2017
Full Text
View/download PDF

32. SNP discovery in complex allotetraploid genomes (Gossypium spp., Malvaceae) using genotyping by sequencing1

Author

Logan-Young, Carla Jo, Yu, John Z., Verma, Surender K., Percy, Richard G., and Pepper, Alan E.

Subjects
Gossypium, interspecific, intraspecific, Genomic Resources Note, single-nucleotide polymorphisms, genotyping by sequencing, polyploid, next-generation sequencing
Abstract

Premise of the study: Single-nucleotide polymorphism (SNP) marker discovery in plants with complex allotetraploid genomes is often confounded by the presence of homeologous loci (along with paralogous and orthologous loci). Here we present a strategy to filter for SNPs representing orthologous loci. Methods and Results: Using Illumina next-generation sequencing, 54 million reads were collected from restriction enzyme–digested DNA libraries of a diversity of Gossypium taxa. Loci with one to three SNPs were discovered using the Stacks software package, yielding 25,529 new cotton SNP combinations, including those that are polymorphic at both interspecific and intraspecific levels. Frequencies of predicted dual-homozygous (aa/bb) marker polymorphisms ranged from 6.7–11.6% of total shared fragments in intraspecific comparisons and from 15.0–16.4% in interspecific comparisons. Conclusions: This resource provides dual-homozygous (aa/bb) marker polymorphisms. Both in silico and experimental validation efforts demonstrated that these markers are enriched for single orthologous loci that are homozygous for alternative alleles.

Published
2015

33. Genes regulating gland development in the cotton plant.

Author

Janga, Madhusudhana R., Pandeya, Devendra, Campbell, LeAnne M., Konganti, Kranti, Villafuerte, Stephany Toinga, Puckhaber, Lorraine, Pepper, Alan, Stipanovic, Robert D., Scheffler, Jodi A., and Rathore, Keerti S.

Subjects
PLANT development, GLANDS, COTTON, GENES, GENE silencing, COTTON growing
Abstract

Summary: In seeds and other parts of cultivated, tetraploid cotton (Gossypium hirsutum L.), multicellular groups of cells lysigenously form dark glands containing toxic terpenoids such as gossypol that defend the plant against pests and pathogens. Using RNA‐seq analysis of embryos from near‐isogenic glanded (Gl2Gl2Gl3Gl3) versus glandless (gl2gl2gl3gl3) plants, we identified 33 genes that expressed exclusively or at higher levels in embryos just prior to gland formation in glanded plants. Virus‐induced gene silencing against three gene pairs led to significant reductions in the number of glands in the leaves, and significantly lower levels of gossypol and related terpenoids. These genes encode transcription factors and have been designated the 'Cotton Gland Formation' (CGF) genes. No sequence differences were found between glanded and glandless cotton for CGF1 and CGF2 gene pairs. The glandless cotton has a transposon insertion within the coding sequence of the GoPGF (synonym CGF3) gene of the A subgenome and extensive mutations in the promoter of D subgenome homeolog. Overexpression of GoPGF (synonym CGF3) led to a dramatic increase in gossypol and related terpenoids in cultured cells, whereas CRISPR/Cas9 knockout of GoPGF (synonym CGF3) genes resulted in glandless phenotype. Taken collectively, the results show that the GoPGF (synonym CGF3) gene plays a critical role in the formation of glands in the cotton plant. Seed‐specific silencing of CGF genes, either individually or in combination, could eliminate glands, thus gossypol, from the cottonseed to render it safe as food or feed for monogastrics. [ABSTRACT FROM AUTHOR]

Published
2019
Full Text
View/download PDF

34. RNA Interference for Functional Genomics and Improvement of Cotton (Gossypium sp.)

Author

Abdurakhmonov, Ibrokhim Y., primary, Ayubov, Mirzakamol S., additional, Ubaydullaeva, Khurshida A., additional, Buriev, Zabardast T., additional, Shermatov, Shukhrat E., additional, Ruziboev, Haydarali S., additional, Shapulatov, Umid M., additional, Saha, Sukumar, additional, Ulloa, Mauricio, additional, Yu, John Z., additional, Percy, Richard G., additional, Devor, Eric J., additional, Sharma, Govind C., additional, Sripathi, Venkateswara R., additional, Kumpatla, Siva P., additional, van der Krol, Alexander, additional, Kater, Hake D., additional, Khamidov, Khakimdjan, additional, Salikhov, Shavkat I., additional, Jenkins, Johnie N., additional, Abdukarimov, Abdusattor, additional, and Pepper, Alan E., additional

Published
2016
Full Text
View/download PDF

35. Development of a 63K SNP Array for Cotton and High-Density Mapping of Intraspecific and Interspecific Populations of Gossypium spp.

Author

Hulse-Kemp, Amanda M, primary, Lemm, Jana, additional, Plieske, Joerg, additional, Ashrafi, Hamid, additional, Buyyarapu, Ramesh, additional, Fang, David D, additional, Frelichowski, James, additional, Giband, Marc, additional, Hague, Steve, additional, Hinze, Lori L, additional, Kochan, Kelli J, additional, Riggs, Penny K, additional, Scheffler, Jodi A, additional, Udall, Joshua A, additional, Ulloa, Mauricio, additional, Wang, Shirley S, additional, Zhu, Qian-Hao, additional, Bag, Sumit K, additional, Bhardwaj, Archana, additional, Burke, John J, additional, Byers, Robert L, additional, Claverie, Michel, additional, Gore, Michael A, additional, Harker, David B, additional, Islam, Md S, additional, Jenkins, Johnie N, additional, Jones, Don C, additional, Lacape, Jean-Marc, additional, Llewellyn, Danny J, additional, Percy, Richard G, additional, Pepper, Alan E, additional, Poland, Jesse A, additional, Mohan Rai, Krishan, additional, Sawant, Samir V, additional, Singh, Sunil Kumar, additional, Spriggs, Andrew, additional, Taylor, Jen M, additional, Wang, Fei, additional, Yourstone, Scott M, additional, Zheng, Xiuting, additional, Lawley, Cindy T, additional, Ganal, Martin W, additional, Van Deynze, Allen, additional, Wilson, Iain W, additional, and Stelly, David M, additional

Published
2015
Full Text
View/download PDF

38. Establishment and Spread of a Single Parthenogenic Genotype of the Mediterranean Arundo Wasp,Tetramesa romana1, in the Variable Climate of Texas

Author

Goolsby, John A., primary, Gaskin, John F., additional, Tarin, Daniel V., additional, Pepper, Alan E., additional, Henne, Don C., additional, Auclair, Allan, additional, Racelis, Alexis E., additional, Summy, Kenneth R., additional, Moran, Patrick J., additional, Thomas, Donald B., additional, Yang, Chenghai, additional, Jiménez, Maricela Martínez, additional, Ciomperlik, Matthew J., additional, León, Adalberto A. Pérez de, additional, and Kirk, Alan A., additional

Published
2014
Full Text
View/download PDF

44. A High-Density Simple Sequence Repeat and Single Nucleotide Polymorphism Genetic Map of the Tetraploid Cotton Genome

Author

Yu, John Z, primary, Kohel, Russell J, additional, Fang, David D, additional, Cho, Jaemin, additional, Van Deynze, Allen, additional, Ulloa, Mauricio, additional, Hoffman, Steven M, additional, Pepper, Alan E, additional, Stelly, David M, additional, Jenkins, Johnie N, additional, Saha, Sukumar, additional, Kumpatla, Siva P, additional, Shah, Manali R, additional, Hugie, William V, additional, and Percy, Richard G, additional

Published
2012
Full Text
View/download PDF

Catalog

Books, media, physical & digital resources
See catalog results