Search

With the ongoing significance of overheating calculations in the residential building sector, building codes such as the European Energy Performance of Building Directive (EPBD) are essential for harmonizing the indicators and performance thresholds. This paper investigates Europe's overheating calculation methods, indicators, and thresholds and evaluates their ability to address climate change and heat events. e study aims to identify the suitability of existing overheating calculation methods and propose recommendations for the EPBD. The study results provide a cross-sectional overview of twenty-six European countries. The most influential overheating calculation criteria are listed the best approaches are ranked. The paper provides a thorough comparative assessment and recommendations to align current calculations with climate-sensitive metrics. The results suggest a framework and key performance indicators that are comfort-based, multi-zonal, and time-integrated to calculate overheating and modify the EU's next building energy efficiency regulations. The results can help policymakers and building professionals to develop the next overheating calculation framework and approach for the future development of climate-proof and resilient residential buildings.

Niedertemperatur-Warme- und Kaltenetze (NT-WK-Netze) sind innovative Ansatze zur Deckung des Warme- und Kaltebedarfs insbesondere in stadtischen Gebieten. Fernwarmesysteme stehen vor einem Ubergang zu sinkenden Netztemperaturen und zeitgleich auch vor einem Ubergang zu einem Anstieg der Nutzung erneuerbarer Energien auf bis zu 100 %. NT-WK-Netze wurden erstmals vor etwa 10 Jahren in der Schweiz installiert. In Osterreich haben sich einige Forschungsprojekte mit der Machbarkeit dieser Netze beschaftigt und in Wien sind zwei kleine NT-WK-Netze in Betrieb. Im Allgemeinen ist das Wissen uber die Hauptkomponenten von NT-WK-Netzen gut entwickelt. Die eigentliche Herausforderung ist nicht die Auslegung der einzelnen Komponenten, sondern das hydraulische und thermische Zusammenspiel aller Komponenten mit seinen hohen Freiheitsgraden. Standardverfahren fur die technische Auslegung von gemeinsamen Fernwarmenetzen und geothermischen Anlagen sind daher nicht geeignet. Aus diesem Grund ist ein volldynamisches Simulationstool mit gekoppelten thermohydraulischen Prozessen fur die Dimensionierung der Komponenten und deren Interaktion mit dem Netz wichtig. Im Oktober 2018 starteten die Autor/innen ein interdisziplinares angewandtes Forschungsprojekt mit dem Ziel, ein NT-WK-Netz fur das ehemalige Militarlager ,,Martinek-Kaserne“ in der Stadt Baden sudlich von Wien zu entwickeln, fur das ein neues urbanes Mischnutzungsquartier geplant ist. Wesentliche Elemente sind die Nutzung von industrieller Niedertemperatur-Abwarme aus Prozessen der benachbarten NOM-Molkerei sowie die Entwicklung von Sanierungs- und Umnutzungskonzepten fur die denkmalgeschutzten Gebaude. Die Projektergebnisse zeigten eindeutig fur den Standort ein hohes Realisierungspotenzial fur ein NT-WK-Netz am Standort mit der Abwarme der NOM sowie geothermischer Speicherung in Erdsondenfeldern. Das Netz kann unabhangig von der zukunftigen Nutzung wirtschaftlich betrieben werden. Die Ergebnisse des Projekts sind ein wichtiger erster Schritt, der zur breiteren Umsetzung von NT-WK-Netzen in Osterreich beitragt. Es wird sowohl das Screening von Standorten als auch die Planung von Netzdesigns ermoglichen. Das Konsortium hat sich zum Ziel gesetzt, potenzielle Entwickler bei der Realisierung des NT-WK-Netzes in der ,,Martinek-Kaserne“ in naher Zukunft zu unterstutzen.

Stressors are especially widespread in urban agglomerations. Common themes of built environment interventions that support health and well-being are blue and green infrastructure, indoor and outdoor air quality, thermal comfort, access to natural lighting, and acoustics. Given the current megatrends of increasing summer temperatures and the high popularity of home offices, we aimed at modeling thermal comfort changes of people working at home in three Austrian cities (Vienna, Innsbruck, and Graz) during the next decades until 2090. We present findings based on (I) an inter-disciplinary literature search and (II) indoor and outdoor climate simulations for actual and future climate scenarios. Based on the results, we discuss the potential impacts for work and human health and well-being, and we suggest a framework for the home office in “post-COVID-19 Austria” that integrates social, ecological, and economic aspects. The results of our study indicate that, in future climate scenarios, overheating of the interior can no longer be prevented without active cooling measures and nature-based solutions. Recommendations on the adjustment of behavior under climate change, including greening, adequate ventilation, and cooling techniques, are thus urgently needed for employees who are working from home in order to maintain physical and mental health and wellbeing.

Pain evoked by visceral inflammation is often ‘referred’ to the somatic level. Transient receptor potential ankyrin 1 (TRPA1) has been reported to contribute to visceral pain-like behavior in dextran sulfate sodium (DSS)-evoked colitis. However, the role of TRPA1 in somatic component of hypersensitivity due to visceral inflammation is unknown. The present study investigated the role of TRPA1 in colitis-evoked mechanical hypersensitivity at the somatic level. Colitis was induced in mice by adding DSS to drinking water for one week. Control and DSS-treated mice were tested for various parameters of colitis as well as mechanical pain sensitivity in abdominal and facial regions. DSS treatment caused mechanical hypersensitivity in the abdominal and facial skin. Pharmacological blockade or genetic deletion of TRPA1 prevented the colitis-associated mechanical hypersensitivity in the abdominal and facial skin areas although the severity of colitis remained unaltered. DSS treatment increased expression of TRPA1 mRNA in cultured dorsal root ganglion (DRG) neurons, but not trigeminal ganglion neurons, and selectively enhanced currents evoked by the TRPA1 agonist, allyl isothiocyanate, in cultured DRG neurons. Our findings indicate that the TRPA1 channel contributes to colitis-associated mechanical hypersensitivity in somatic tissues, an effect associated with upregulation of TRPA1 expression and responsiveness in DRG nociceptors.

Objectives: Imbalanced nutrition and obesity are risk factors for depression, a relationship that in rodents can be modeled by depression-like behavior in response to high-fat diet (HFD). In this w...

ACTB encodes β‐cytoplasmic actin, an essential component of the cytoskeleton. Based on chromosome 7p22.1 deletions that include the ACTB locus and on rare truncating ACTB variants, a phenotype resulting from ACTB haploinsufficiency was recently proposed. We report putative ACTB loss‐of‐function variants in four patients. To the best of our knowledge, we report the first 7p22.1 microdeletion confined to ACTB and the second ACTB frameshifting mutation that predicts mRNA decay. A de‐novo ACTB p.(Gly302Ala) mutation affects β‐cytoplasmic actin distribution. All four patients share a facial gestalt that is distinct from that of individuals with dominant‐negative ACTB variants in Baraitser‐Winter cerebrofrontofacial syndrome. Two of our patients had strikingly thin and sparse scalp hair. One patient had sagittal craniosynostosis and hypospadias. All three affected male children have attention deficits and mild global developmental delay. Mild intellectual disability was present in only one patient. Heterozygous ACTB deletion can allow for normal psychomotor function., ACTB encodes β‐cytoplasmic actin, an essential component of the cytoskeleton. Based on rare chromosome 7p22.1 deletions that include the ACTB locus and on rare truncating ACTB variants, a phenotype resulting from ACTB haploinsufficiency was recently proposed. We report the first 7p22.1 microdeletion confined to ACTB, and the second ACTB frameshifting mutation that predicts mRNA decay. Mild intellectual disability was present in one patient. Attention deficits and mild global developmental delay were present in three patients. Normal psychomotor function was seen in one patient with a heterozygous ACTB deletion. Heterozygous ACTB deletion can allow for normal psychomotor function.

Over the last decades overheating in buildings has become a major concern. The situation is expected to worsen due to the current rate of climate change. Many efforts have been made to evaluate the future thermal performance of buildings and cooling technologies. In this paper, the term “climate change overheating resistivity” of cooling strategies is defined, and the calculation method is provided. A comprehensive simulation-based framework is then introduced, enabling the evaluation of a wide range of active and passive cooling strategies. The framework is based on the Indoor Overheating Degree (IOD), Ambient Warmness Degree (AWD), and Climate Change Overheating Resistivity (CCOR) as principal indicators allowing a multi-zonal approach in the quantification of indoor overheating risk and resistivity to climate change. To test the proposed framework, two air-based cooling strategies including a Variable Refrigerant Flow (VRF) unit coupled with a Dedicated Outdoor Air System (DOAS) (C01) and a Variable Air Volume (VAV) system (C02) are compared in six different locations/climates. The case study is a shoe box model representing a double-zone office building. In general, the C01 shows higher CCOR values between 2.04 and 19.16 than the C02 in different locations. Therefore, the C01 shows superior resistivity to the overheating impact of climate change compared to C02. The maximum CCOR value of 37.46 is resulted for the C01 in Brussels, representing the most resistant case, whereas the minimum CCOR value of 9.24 is achieved for the C02 in Toronto, representing the least resistant case.

Inflammatory bowel disease (IBD) patients frequently suffer from anxiety disorders and depression, indicating that altered gut-brain axis signalling during gastrointestinal inflammation is a risk factor for psychiatric disease. Microglia, immune cells of the brain, is thought to be involved in a number of mental disorders, but their role in IBD is largely unknown. In the current work, we investigated whether colitis induced by dextran sulphate sodium (DSS), a murine model of IBD, alters microglial phenotypes in the brain. We found that colitis caused a reduction of Iba-1 and CD68 immunoreactivity, microglial activation markers, in specific brain regions of the limbic system such as the medial prefrontal cortex (mPFC), while other areas remained unaffected. Flow cytometry showed an increase of monocyte-derived macrophages during colitis and gene expression analysis in the mPFC showed pronounced changes of microglial markers including cluster of differentiation 86 (CD86), tumour necrosis factor-α, nitric oxide synthase 2, CD206 and chitinase-like protein 3 consistent with both M1 and M2 activation. Taken together, these findings suggest that experimental colitis-induced inflammation is propagated to the brain altering microglial function.

The differentiation between mild forms of toe-walking (equinus) in cerebral palsy (CP) and idiopathic toe-walking (ITW) is often clinically challenging. This study aims to define kinematic and kinetic parameters using 3D gait analysis to facilitate and secure the diagnosis of “idiopathic toe-walking”. We conducted a retrospective controlled stratified cohort study. 12 toe-walking subjects per group diagnosed as ITW or CP were included and stratified according to age, gender and maximal dorsiflexion in stance. We collected kinematic and kinetic data using a three-dimensional optical motion analysis system with integrated floor force plates. Pairwise comparison between ITW and CP gait data was performed, and discriminant factor analysis was conducted. Both groups were compared with typically developing peers (TD). We found kinematic and kinetic parameters having a high discriminatory power and sensitivity to distinguish between ITW and CP groups (e.g., knee angle at initial contact (91% sensitivity, 73% specificity) and foot progression angle at midstance (82% sensitivity, 73% specificity)). The strength of this study is a high discriminatory power between ITW and CP toe-walking groups. Described kinematic parameters are easy to examine even without high-tech equipment; therefore, it is directly transferable to everyday praxis.

The development of small-molecule calcitonin gene-related peptide (CGRP) receptor antagonists (gepants) and of monoclonal antibodies targeting the CGRP system has been a major advance in the management of migraine. In the randomized controlled trials before regulatory approval, the safety of these anti-CGRP migraine therapeutics was considered favorable and to stay within the expected profile. Post-approval real-world surveys reveal, however, constipation to be a major adverse event which may affect more than 50% of patients treated with erenumab (an antibody targeting the CGRP receptor), fremanezumab or galcanezumab (antibodies targeting CGRP). In this review article we address the question whether constipation caused by inhibition of CGRP signaling can be mechanistically deduced from the known pharmacological actions and pathophysiological implications of CGRP in the digestive tract. CGRP in the gut is expressed by two distinct neuronal populations: extrinsic primary afferent nerve fibers and distinct neurons of the intrinsic enteric nervous system. In particular, CGRP is a major messenger of enteric sensory neurons which in response to mucosal stimulation activate both ascending excitatory and descending inhibitory neuronal pathways that enable propulsive (peristaltic) motor activity to take place. In addition, CGRP is able to stimulate ion and water secretion into the intestinal lumen. The motor-stimulating and prosecretory actions of CGRP combine in accelerating intestinal transit, an activity profile that has been confirmed by the ability of CGRP to induce diarrhea in mice, dogs and humans. We therefore conclude that the constipation elicited by antibodies targeting CGRP or its receptor results from interference with the physiological function of CGRP in the small and large intestine in which it contributes to the maintenance of peristaltic motor activity, ion and water secretion and intestinal transit.

Since the beginning of the 1980s the categories of text linguistics have played an increasingly important role in both theoretical and applied translation studies. They have attracted more and more attention in the course of attempts to establish a translation-oriented text theory and text analysis for teaching purposes. In this context translation studies have been able to make a useful contribution to the linguistic debate on text cohesion and coherence and have in turn greatly benefited from that debate. At the same time, through contact with other disciplines, inclu¬ding the social sciences and cultural sciences, translation studies have helped to generate new aspects in text linguistics and to extend its hori¬zons. Today text linguistics and translation studies exist in a form of symbiosis that has attractive potential for the future.

The concept of climate resilience has gained extensive international attention during the last few years and is now seen as the future target for building cooling design. However, before being fully implemented in building design, the concept requires a clear and consistent definition and a commonly agreed framework of key concepts. The most critical issues that should be given special attention before developing a new definition for resilient cooling of buildings are (1) the disruptions or the associated climatic shocks to protect against, (2) the scale of the built domain, (3) the timeline of resilience, (4) the events of disruption, (5) the stages of resilience, (6) the indoor climate limits and critical comfort conditions, and (7) the influencing factors of resilient cooling of buildings. This paper focuses on a scoping review of the most of the existing resilience definitions and the various approaches, found in 90 documents, towards possible resilient buildings. In conclusion, the paper suggests a definition and a set of criteria —vulnerability, resistance, robustness, and recoverability— that can help to develop intrinsic performance-driven indicators and functions of passive and active cooling solutions in buildings against two disruptors of indoor thermal environmental quality—heat waves and power outages.

Neuropeptide Y (NPY) has been demonstrated to exert stress buffering effects and promote resilience. Non-invasive intranasal (IN) application of NPY to rodents is able to mitigate traumatic stress-induced behavioral changes as well as dysfunction of the hypothalamic-pituitary-adrenal (HPA) axis. However, it is unknown whether IN NPY could prevent the behavioral, pro-inflammatory and neurochemical responses to peripheral immune activation by the Toll-like receptor 4 (TLR4) stimulant lipopolysaccharide (LPS). Therefore, we analyzed the effects of IN NPY (100 μg) on the behavioral sickness response (reduced locomotion and exploration) and the underlying molecular mechanisms, 3 h and 21 h after intraperitoneal injections of LPS (0.03 mg/kg) in male C57BL/6N mice. The acute behavioral sickness response was significantly dampened by pretreatment with IN NPY 3 h after LPS injection. This effect was accompanied by diminished weight loss and lowered plasma corticosterone (CORT) levels 21 h after LPS injection. In contrast, acute circulating cytokine levels and hypothalamic cytokine mRNA expression remained unaltered by IN NPY, which indicates that the peripheral and cerebral immune response to LPS was left undisturbed. Our findings are in agreement with the reported activity of NPY to dampen the response of the HPA axis to stress. We propose that IN NPY ablates sickness behavior at a site beyond the peripheral and cerebral cytokine response, an action that is associated with reduced activity of the HPA axis as determined by decreased plasma CORT. These results indicate that IN NPY administration may be relevant to the management of neuropsychiatric disorders arising from immune-induced neuroendocrine dysfunction. Electronic supplementary material The online version of this article (10.1007/s13311-019-00758-9) contains supplementary material, which is available to authorized users.

Fibromyalgia-syndrome (FMS) is a complex disease characterized by chronic widespread pain and additional symptoms including depression, cognitive dysfunction (“fibro-fog”) and maldigestion. We examined whether FMS-related pain parameters assessed by quantitative sensory testing (QST) are related to changes of microbial diversity.We recruited 25 patients with FMS and 26 age- and sex-matched healthy controls. Medical background, food habits, psychopathology and quality of life were assessed with questionnaires. Stool samples were analyzed by 16S rRNA gene amplification and sequencing. QST was performed according to the protocol of the German Network for Neuropathic Pain.QST showed that both lemniscal and spinothalamic afferent pathways are altered in FMS patients relative to healthy controls and that peripheral as well as central pain sensitization processes are manifest. Psychometric assessment revealed enhanced scores of depression, anxiety and stress. In contrast, neither the composition nor the alpha- and beta-diversity of the fecal microbiome was changed in FMS patients.FMS patients segregate from healthy controls in various parameters of QST and psychopathology, but not in terms of composition and diversity of the fecal microbiome. Despite consideration of several confounding factors we conclude that the impact of the gut microbiome on the pathophysiology of FMS is limited.

Peptide YY (PYY), produced by endocrine L cells in the gut, is known for its critical role in regulating gastrointestinal functions as well as satiety. However, how these processes are integrated with maintaining a healthy gut microbiome composition is unknown. Here, we show that lack of PYY in mice leads to distinct changes in gut microbiome composition that are diet‐dependent. While under chow diet only slight differences in gut microbiome composition could be observed, high‐fat diet (HFD) aggravated these differences. Specifically an increased abundance of the Bacteroidetes phylum with a corresponding decrease of the Firmicutes/Bacteroidetes ratio could be detected in Pyy‐knockout (KO) mice in response to HFD. Detailed analysis of the Bacteroidetes phylum further revealed that the Alistipes genus belonging to the Rikenellaceae family, the Parabacteroides belonging to the Tannerellaceae family, as well as Muribaculum were increased in Pyy‐KO mice. In order to investigate whether these changes are associated with changed markers of gut barrier and immunity, we analyzed the colonic expression of various pro‐inflammatory cytokines, as well as tight junction proteins and mucin 2, and identified increased mRNA expression of the tight junction proteins Cldn2 and Ocel1 in Pyy‐KO mice, while pro‐inflammatory cytokine expression was not significantly altered. Together these results highlight a critical gene‐environment interaction between diet and the gut microbiome and its impact on homeostasis of the intestinal epithelium under conditions of reduced PYY signaling which is commonly seen under obese conditions.

The gut microbiota interacts with the brain through multiple communication lines in which gut peptide hormones and neuropeptides play important messenger roles. These peptides are secondary chemical signals whose operation is controlled by the gut microbiota via a myriad of microbial metabolites, secondary bile acids, and structural components. We first outline a number of gut hormones (e.g., peptide YY, glucagon-like peptide, ghrelin, cholecystokinin) which communicate with the brain either via the circulation or via vagal afferent neurons. Several neuropeptides in the brain are likewise under the influence of gut microbes and mediate their impact on various aspects of brain function and behavior. These neuropeptides include neuropeptide Y, corticotropin-releasing factor, brain-derived neurotrophic factor, and several other peptides which act as neurotransmitters or trophic factors. Food intake, energy homeostasis, emotional-affective behavior, cognitive performance, stress resilience, and neurogenesis are among the processes which the gut microbiota regulates via the action of gut hormones and neuropeptides.

Purpose Increased gut permeability causes the trespass of antigens into the blood stream which leads to inflammation. Gut permeability reflected by serum zonulin and diversity of the gut microbiome were investigated in this cross-sectional study involving female study participants with different activity and BMI levels. Methods 102 women were included (BMI range 13.24–46.89 kg m−2): Anorexia nervosa patients (n = 17), athletes (n = 20), normal weight (n = 25), overweight (n = 21) and obese women (n = 19). DNA was extracted from stool samples and subjected to 16S rRNA gene analysis (V1–V2). Quantitative Insights Into Microbial Ecology (QIIME) was used to analyze data. Zonulin was measured with ELISA. Nutrient intake was assessed by repeated 24-h dietary recalls. We used the median of serum zonulin concentration to divide our participants into a “high-zonulin” (> 53.64 ng/ml) and “low-zonulin” (

Objectives There is evidence that the gut microbiota plays a major role in the pathogenesis of diseases of the central nervous system through the gut–brain axis. The aim of the present study was to analyze gut microbiota composition in bipolar disorder (BD) and its relation to inflammation, serum lipids, oxidative stress, tryptophan (TRP)/kynurenine (KYN) levels, anthropometric measurements and parameters of metabolic syndrome. Further, microbial community differences of individuals with BD compared with healthy controls (HC) were explored. Methods In this cross‐sectional study, we performed 16S rRNA gene sequencing of stool samples from 32 BD individuals and 10 HC. Laboratory parameters included inflammatory markers, serum lipids, KYN, oxidative stress and anthropometric measures. Microbial community analysis and correlation to clinical parameters was performed with QIIME, differential abundance analysis of taxa encompassed linear discriminant analysis effect size (LEfSe). Results We found a negative correlation between microbial alpha‐diversity and illness duration in BD (R = −0.408, P = 0.021). Furthermore, we identified bacterial clades associated with inflammatory status, serum lipids, TRP, depressive symptoms, oxidative stress, anthropometrics and metabolic syndrome in individuals with BD. LEfSe identified the phylum Actinobacteria (LDA= 4.82, P = 0.007) and the class Coriobacteria (LDA= 4.75, P = 0.010) as significantly more abundant in BD when compared with HC, and Ruminococcaceae (LDA= 4.59, P = 0.018) and Faecalibacterium (LDA= 4.09, P = 0.039) as more abundant in HC when compared with BD. Conclusions The present findings suggest that causes and/or consequences of BD may also lie outside the brain. Exploratory research of the gut microbiota in affective disorders like BD may identify previously unknown underlying causes, and offer new research and therapeutic approaches to mood disorders.

Purpose Experimental investigations in rodents have contributed significantly to our current understanding of the potential importance of the gut microbiome and brain interactions for neurotransmitter expression, neurodevelopment, and behaviour. However, clinical evidence to support such interactions is still scarce. The present study used a double-blind, randomized, pre- and post-intervention assessment design to investigate the effects of a 4-week multi-strain probiotic administration on whole-brain functional and structural connectivity in healthy volunteers. Methods Forty-five healthy volunteers were recruited for this study and were divided equally into three groups (PRP: probiotic, PLP: placebo, and CON: control). All the participants underwent resting-state functional MRI and diffusion MRI brain scans twice during the course of study, at the beginning (time point 1) and after 4 weeks (time point 2). MRI data were acquired using a 3T whole-body MR system (Magnetom Skyra, Siemens, Germany). Results Functional connectivity (FC) changes were observed in the default mode network (DMN), salience network (SN), and middle and superior frontal gyrus network (MFGN) in the PRP group as compared to the PLP and CON groups. PRP group showed a significant decrease in FC in MFGN (in frontal pole and frontal medial cortex) and in DMN (in frontal lobe) as compared to CON and PLP groups, respectively. Further, significant increase in FC in SN (in cingulate gyrus and precuneus cortex) was also observed in PRP group as compared to CON group. The significance threshold was set to p

Opioids are the mainstay of management for patients with cancer-related pain. Although the analgesic efficacy of opioid therapy is well documented, the recent European Pain in Cancer survey demonstrated that the management of moderate-to-severe pain in patients with cancer is far from optimal. Bowel dysfunction, and importantly constipation, is a common side effect and has a significant impact on the patient’s morbidity and quality of life. Nonpharmacological strategies and laxatives are often not effective in the management of opioid-induced constipation (OIC), making it necessary to search for new strategies for the treatment of opioid-induced bowel dysfunction. One promising strategy is the prevention of OIC with peripherally acting opioid antagonists that specifically target the underlying cause of this condition, without affecting centrally mediated analgesia. In recent studies, the novel combination of prolonged-release oral oxycodone and prolonged-release oral naloxone provided effective analgesia with improved bowel function in patients suffering from severe cancer-related and noncancer-related pain. The combination has the potential to improve the quality of pain management significantly in these patients.

The microbial ecosystem that inhabits the gastrointestinal tract of all mammals—the gut microbiota—has been in a symbiotic relationship with its hosts over many millennia. Thanks to modern technology, the myriad of functions that are controlled or modulated by the gut microbiota are beginning to unfold. One of the systems that is emerging to closely interact with the gut microbiota is the body’s major neuroendocrine system that controls various body processes in response to stress, the hypothalamic–pituitary–adrenal (HPA) axis. This interaction is of pivotal importance; as various disorders of the microbiota–gut–brain axis are associated with dysregulation of the HPA axis. The present contribution describes the bidirectional communication between the gut microbiota and the HPA axis and delineates the potential underlying mechanisms. In this regard, it is important to note that the communication between the gut microbiota and the HPA axis is closely interrelated with other systems, such as the immune system, the intestinal barrier and blood–brain barrier, microbial metabolites, and gut hormones, as well as the sensory and autonomic nervous systems. These communication pathways will be exemplified through preclinical models of early life stress, beneficial roles of probiotics and prebiotics, evidence from germ-free mice, and antibiotic-induced modulation of the gut microbiota. Electronic supplementary material The online version of this article (10.1007/s13311-017-0600-5) contains supplementary material, which is available to authorized users.

Objectives Anorexia nervosa (AN) is a heterogeneous eating disorder associated with alterations of body structure and the gut microbiome. We aimed to investigate the gut microbiota composition of a large female cohort including different BMI groups and activity levels along with body composition parameters. Method 106 female participants were included in this cross-sectional study: AN patients (n = 18), athletes (n = 20), normal weight (n = 26), overweight (n = 22), and obese women (n = 20). DNA was extracted from stool samples and subjected to 16S rRNA gene analysis. The software Quantitative Insights Into Microbial Ecology (QIIME) was used to analyze data. Additionally, we performed anthropometric assessments, ultrasound measurements of subcutaneous adipose tissue thickness, bioimpedance analysis, administered depression inventories, and ascertained laboratory parameters and dietary intakes. Results Alpha diversity was particularly lower in AN patients and obese participants compared to other groups, while athletes showed highest alpha diversity. Several categories significantly associated with community structure were identified: body fat parameters, serum lipids, CRP, depression scales and smoking. Comparative analysis revealed Coriobacteriaceae as the only enriched phylotype in AN compared to other entities (LDA score >3.5). Discussion This study provides further evidence of intestinal dysbiosis in AN and sheds light on characteristics of the gut microbiome in different BMI and physical activity groups. These insights point to new modulation possibilities of the gut microbiota which could improve the standard therapy of AN.

Aberrant insulin signaling constitutes an early change in Alzheimer's disease (AD). Insulin receptors (IR) and low-density lipoprotein receptor-related protein-1 (LRP-1) are expressed in brain capillary endothelial cells (BCEC) forming the blood-brain barrier (BBB). There, insulin may regulate the function of LRP-1 in Aβ clearance from the brain. Changes in IR-β and LRP-1 and insulin signaling at the BBB in AD are not well understood. Herein, we identified a reduction in cerebral and cerebrovascular IR-β levels in 9-month-old male and female 3XTg-AD (PS1M146V, APPSwe, and tauP301L) as compared to NTg mice, which is important in insulin mediated signaling responses. Reduced cerebral IR-β levels corresponded to impaired insulin signaling and LRP-1 levels in brain. Reduced cerebral and cerebrovascular IR-β and LRP-1 levels in 3XTg-AD mice correlated with elevated levels of autophagy marker LC3B. In both genotypes, high-fat diet (HFD) feeding decreased cerebral and hepatic LRP-1 expression and elevated cerebral Aβ burden without affecting cerebrovascular LRP-1 and IR-β levels. In vitro studies using primary porcine (p)BCEC revealed that Aβ peptides 1–40 or 1–42 (240 nM) reduced cellular levels and interaction of LRP-1 and IR-β thereby perturbing insulin-mediated signaling. Further mechanistic investigation revealed that Aβ treatment accelerated the autophagy-lysosomal degradation of IR-β and LRP-1 in pBCEC. LRP-1 silencing in pBCEC decreased IR-β levels through post-translational pathways further deteriorating insulin-mediated responses at the BBB. Our findings indicate that LRP-1 proves important for insulin signaling at the BBB. Cerebral Aβ burden in AD may accelerate LRP-1 and IR-β degradation in BCEC thereby contributing to impaired cerebral and cerebromicrovascular insulin effects.

Investigations of the ultrastructural features of neurons and their synapses are only possible with electron microscopy. Especially for comparative studies of the changes in densities and distributions of such features, an unbiased sampling protocol is vital for reliable results. Here, we present a workflow for the image acquisition of brain samples. The workflow allows systematic uniform random sampling within a defined brain region, and the images can be analyzed using a disector. This technique is much faster than extensive examination of serial sections but still presents a feasible approach to estimate the densities and distributions of ultrastructure features. Before embedding, stained vibratome sections were used as a reference to identify the brain region under investigation, which helped speed up the overall specimen preparation process. This approach was used for comparative studies investigating the effect of an enriched-housing environment on several ultrastructural parameters in the mouse brain. Based on the successful use of the workflow, we adapted it for the purpose of elemental analysis of brain samples. We optimized the protocol in terms of the time of user-interaction. Automating all the time-consuming steps by compiling a script for the open source software SerialEM helps the user to focus on the main work of acquiring the elemental maps. As in the original workflow, we paid attention to the unbiased sampling approach to guarantee reliable results.

Purpose Pro- and synbiotics have been reported to ameliorate the adverse (dysbiotic) effects of antibiotics on the gut microbial architecture, but little is known how synbiotics and antibiotics interact with each other in shaping the gut microbiota. To explore this mutual interaction we examined, first, the effect of a multi-strain synbiotic on antibiotic-induced dysbiosis and, second, the dysbiotic effect of antibiotics followed by prolonged synbiotic exposure. Methods The synbiotic containing nine bacterial strains was administered to male mice via the drinking water, while the antibiotic mix containing bacitracin, meropenem, neomycin, and vancomycin was administered via oral gavage. Two experimental protocols were used. In protocol 1, mice were administered placebo or synbiotic for 3 weeks prior to and during an 11-day vehicle or antibiotic treatment. In protocol 2 the synbiotic was administered for a prolonged period of time, starting 3 weeks prior and continuing for 12 weeks after an 11-day vehicle or antibiotic treatment. Subsequently, the fecal microbiome was analyzed by 16S rRNA sequencing using oligonucleotide primers 16s_515_S3_fwd: GATTGCCAGCAGCCGCGGTAA and 16s_806_S2_rev: GGACTACCAGGGTATCTAAT followed by sequencing using the Ion Torrent One. The final sequence files were analyzed by QIIME 1.8 workflow scripts. Results Antibiotic treatment markedly decreased the bacterial richness and diversity of the fecal microbiota. Synbiotic administration for 3 weeks prior to and during an 11-day antibiotic treatment preserved the Lactobacillales and expanded the Verrucomicrobiales and Bifidobacteriales order, but did not prevent the depletion of Bacteroidales and the short-term proliferation of Enterobacteriales. When the synbiotic administration was continued for 12 weeks after the end of antibiotic treatment, the rise of Verrucomicrobiales was maintained, whereas the preservation of Lactobacillales and boost of Bifidobacteriales was lost. The abundance of Clostridiales was enhanced by long-term synbiotic treatment after short-term exposure to antibiotics, while the antibiotic-depleted Bacteroidales underwent a delayed recovery. Conclusions There are complex synergistic and antagonistic interactions of synbiotics and antibiotics in influencing distinct bacterial orders of the fecal microbiota. The impact of a short-term antibiotic exposure is profoundly different when analyzed after synbiotic pretreatment or following prolonged synbiotic administration in the post-antibiotic period.