Search

Signaling through the Ras-MAPK pathway can exhibit switch-like activation, which has been attributed to the underlying positive feedback and bimodality in the activation of RasGDP to RasGTP by SOS. SOS contains both catalytic and allosteric Ras binding sites, and a common assumption is that allosteric activation selectively by RasGTP provides the mechanism of positive feedback. However, recent single-molecule studies have revealed that SOS catalytic rates are independent of the nucleotide state of Ras in the allosteric binding site, raising doubt about this as a positive feedback mechanism. Here, we perform detailed kinetic analyses of receptor-mediated recruitment of full-length SOS to the membrane while simultaneously monitoring its catalytic activation of Ras. These results, along with kinetic modeling, expose the autoinhibition release step in SOS, rather than either recruitment or allosteric activation, as the underlying mechanism giving rise to positive feedback in Ras activation.

Prolyl oligopeptidases from psychrophilic, mesophilic, and thermophilic organisms found in a range of natural environments are studied using a combination of protein structure prediction, atomistic molecular dynamics, and trajectory analysis to determine how the S9 protease family adapts to extreme thermal conditions. We compare our results with hypotheses from the literature regarding structural adaptations that allow proteins to maintain structure and function at extreme temperatures, and we find that, in the case of prolyl oligopeptidases, only a subset of proposed adaptations are employed for maintaining stability. The catalytic and propeller domains are highly structured, limiting the range of mutations that can be made to enhance hydrophobicity or form disulfide bonds without disrupting the formation of necessary secondary structure. Rather, we observe a pattern in which overall prevalence of bound interactions (salt bridges and hydrogen bonds) is conserved by using increasing numbers of increasingly short-lived interactions as temperature increases. This suggests a role for an entropic rather than energetic strategy for thermal adaptation in this protein family.

Thermophily is a trait scattered across the fungal tree of life, with its highest prevalence within three fungal families (Chaetomiaceae, Thermoascaceae, and Trichocomaceae), as well as some members of the phylum Mucoromycota. We examined 37 thermophilic and thermotolerant species and 42 mesophilic species for this study and identified thermophily as the ancestral state of all three prominent families of thermophilic fungi. Thermophilic fungal genomes were found to encode various thermostable enzymes, including carbohydrate-active enzymes such as endoxylanases, which are useful for many industrial applications. At the same time, the overall gene counts, especially in gene families responsible for microbial defense such as secondary metabolism, are reduced in thermophiles compared to mesophiles. We also found a reduction in the core genome size of thermophiles in both the Chaetomiaceae family and the Eurotiomycetes class. The Gene Ontology terms lost in thermophilic fungi include primary metabolism, transporters, UV response, and O-methyltransferases. Comparative genomics analysis also revealed higher GC content in the third base of codons (GC3) and a lower effective number of codons in fungal thermophiles than in both thermotolerant and mesophilic fungi. Furthermore, using the Support Vector Machine classifier, we identified several Pfam domains capable of discriminating between genomes of thermophiles and mesophiles with 94% accuracy. Using AlphaFold2 to predict protein structures of endoxylanases (GH10), we built a similarity network based on the structures. We found that the number of disulfide bonds appears important for protein structure, and the network clusters based on protein structures correlate with the optimal activity temperature. Thus, comparative genomics offers new insights into the biology, adaptation, and evolutionary history of thermophilic fungi while providing a parts list for bioengineering applications.

Epistasis is caused by genetic interactions among mutations that affect fitness. To characterize properties and potential mechanisms of epistasis, we engineered eight double mutants that combined mutations from the rho and rpoB genes of Escherichia coli. The two genes encode essential functions for transcription, and the mutations in each gene were chosen because they were beneficial for adaptation to thermal stress (42.2 °C). The double mutants exhibited patterns of fitness epistasis that included diminishing returns epistasis at 42.2 °C, stronger diminishing returns between mutations with larger beneficial effects and both negative and positive (sign) epistasis across environments (20.0 °C and 37.0 °C). By assessing gene expression between single and double mutants, we detected hundreds of genes with gene expression epistasis. Previous work postulated that highly connected hub genes in coexpression networks have low epistasis, but we found the opposite: hub genes had high epistasis values in both coexpression and protein-protein interaction networks. We hypothesized that elevated epistasis in hub genes reflected that they were enriched for targets of Rho termination but that was not the case. Altogether, gene expression and coexpression analyses revealed that thermal adaptation occurred in modules, through modulation of ribonucleotide biosynthetic processes and ribosome assembly, the attenuation of expression in genes related to heat shock and stress responses, and with an overall trend toward restoring gene expression toward the unstressed state.

3' → 5' exoribonucleases play a critical role in many aspects of RNA metabolism. RNase R, PNPase, and RNase II are the major contributors to RNA processing, maturation, and quality control in bacteria. Bacteria don't seem to have dedicated RNA degradation machineries to process different classes of RNAs. Under different environmental and physiological conditions, their roles can be redundant and sometimes overlapping. Here, I discuss why PNPase and RNase R may have switched their physiological roles in some bacterial species to adapt to environmental conditions, despite being biochemically distinct exoribonucleases.

Papua New Guinea (PNG) hosts distinct environments mainly represented by the ecoregions of the Highlands and Lowlands that display increased altitude and a predominance of pathogens, respectively. Since its initial peopling approximately 50,000 years ago, inhabitants of these ecoregions might have differentially adapted to the environmental pressures exerted by each of them. However, the genetic basis of adaptation in populations from these areas remains understudied. Here, we investigated signals of positive selection in 62 highlanders and 43 lowlanders across 14 locations in the main island of PNG using whole-genome genotype data from the Oceanian Genome Variation Project (OGVP) and searched for signals of positive selection through population differentiation and haplotype-based selection scans. Additionally, we performed archaic ancestry estimation to detect selection signals in highlanders within introgressed regions of the genome. Among highland populations we identified candidate genes representing known biomarkers for mountain sickness (SAA4, SAA1, PRDX1, LDHA) as well as candidate genes of the Notch signaling pathway (PSEN1, NUMB, RBPJ, MAML3), a novel proposed pathway for high altitude adaptation in multiple organisms. We also identified candidate genes involved in oxidative stress, inflammation, and angiogenesis, processes inducible by hypoxia, as well as in components of the eye lens and the immune response. In contrast, candidate genes in the lowlands are mainly related to the immune response (HLA-DQB1, HLA-DQA2, TAAR6, TAAR9, TAAR8, RNASE4, RNASE6, ANG). Moreover, we find two candidate regions to be also enriched with archaic introgressed segments, suggesting that archaic admixture has played a role in the local adaptation of PNG populations.

Phosphorus is essential in all cells structural, metabolic and regulatory functions. For fungal cells that import inorganic phosphate (Pi) up a steep concentration gradient, surface Pi transporters are critical capacitators of growth. Fungi must deploy Pi transporters that enable optimal Pi uptake in pH and Pi concentration ranges prevalent in their environments. Single, triple and quadruple mutants were used to characterize the four Pi transporters we identified for the human fungal pathogen Candida albicans, which must adapt to alkaline conditions during invasion of the host bloodstream and deep organs. A high-affinity Pi transporter, Pho84, was most efficient across the widest pH range while another, Pho89, showed high-affinity characteristics only within one pH unit of neutral. Two low-affinity Pi transporters, Pho87 and Fgr2, were active only in acidic conditions. Only Pho84 among the Pi transporters was clearly required in previously identified Pi-related functions including Target of Rapamycin Complex 1 signaling, oxidative stress resistance and hyphal growth. We used in vitro evolution and whole genome sequencing as an unbiased forward genetic approach to probe adaptation to prolonged Pi scarcity of two quadruple mutant lineages lacking all 4 Pi transporters. Lineage-specific genomic changes corresponded to divergent success of the two lineages in fitness recovery during Pi limitation. Initial, large-scale genomic alterations like aneuploidies and loss of heterozygosity eventually resolved, as populations gained small-scale mutations. Severity of some phenotypes linked to Pi starvation, like cell wall stress hypersensitivity, decreased in parallel to evolving populations fitness recovery in Pi scarcity, while severity of others like membrane stress responses diverged from Pi scarcity fitness. Among preliminary candidate genes for contributors to fitness recovery, those with links to TORC1 were overrepresented. Since Pi homeostasis differs substantially between fungi and humans, adaptive processes to Pi deprivation may harbor small-molecule targets that impact fungal growth, stress resistance and virulence.

IGHMBP2 is a nonessential, superfamily 1 DNA/RNA helicase that is mutated in patients with rare neuromuscular diseases SMARD1 and CMT2S. IGHMBP2 is implicated in translational and transcriptional regulation via biochemical association with ribosomal proteins, pre-rRNA processing factors, and tRNA-related species. To uncover the cellular consequences of perturbing IGHMBP2, we generated full and partial IGHMBP2 deletion K562 cell lines. Using polysome profiling and a nascent protein synthesis assay, we found that IGHMBP2 deletion modestly reduces global translation. We performed Ribo-seq and RNA-seq and identified diverse gene expression changes due to IGHMBP2 deletion, including ATF4 up-regulation. With recent studies showing the integrated stress response (ISR) can contribute to tRNA metabolism-linked neuropathies, we asked whether perturbing IGHMBP2 promotes ISR activation. We generated ATF4 reporter cell lines and found IGHMBP2 knockout cells demonstrate basal, chronic ISR activation. Our work expands upon the impact of IGHMBP2 in translation and elucidates molecular mechanisms that may link mutant IGHMBP2 to severe clinical phenotypes.

Fast growth phenotypes are achieved through optimal transcriptomic allocation, in which cells must balance tradeoffs in resource allocation between diverse functions. One such balance between stress readiness and unbridled growth in E. coli has been termed the fear versus greed (f/g) tradeoff. Two specific RNA polymerase (RNAP) mutations observed in adaptation to fast growth have been previously shown to affect the f/g tradeoff, suggesting that genetic adaptations may be primed to control f/g resource allocation. Here, we conduct a greatly expanded study of the genetic control of the f/g tradeoff across diverse conditions. We introduced 12 RNA polymerase (RNAP) mutations commonly acquired during adaptive laboratory evolution (ALE) and obtained expression profiles of each. We found that these single RNAP mutation strains resulted in large shifts in the f/g tradeoff primarily in the RpoS regulon and ribosomal genes, likely through modifying RNAP-DNA interactions. Two of these mutations additionally caused condition-specific transcriptional adaptations. While this tradeoff was previously characterized by the RpoS regulon and ribosomal expression, we find that the GAD regulon plays an important role in stress readiness and ppGpp in translation activity, expanding the scope of the tradeoff. A phylogenetic analysis found the greed-related genes of the tradeoff present in numerous bacterial species. The results suggest that the f/g tradeoff represents a general principle of transcriptome allocation in bacteria where small genetic changes can result in large phenotypic adaptations to growth conditions.IMPORTANCETo increase growth, E. coli must raise ribosomal content at the expense of non-growth functions. Previous studies have linked RNAP mutations to this transcriptional shift and increased growth but were focused on only two mutations found in the proteins central region. RNAP mutations, however, commonly occur over a large structural range. To explore RNAP mutations impact, we have introduced 12 RNAP mutations found in laboratory evolution experiments and obtained expression profiles of each. The mutations nearly universally increased growth rates by adjusting said tradeoff away from non-growth functions. In addition to this shift, a few caused condition-specific adaptations. We explored the prevalence of this tradeoff across phylogeny and found it to be a widespread and conserved trend among bacteria.

Amyloid β (Aβ) peptides accumulating in the brain are proposed to trigger Alzheimers disease (AD). However, molecular cascades underlying their toxicity are poorly defined. Here, we explored a novel hypothesis for Aβ42 toxicity that arises from its proven affinity for γ-secretases. We hypothesized that the reported increases in Aβ42, particularly in the endolysosomal compartment, promote the establishment of a product feedback inhibitory mechanism on γ-secretases, and thereby impair downstream signaling events. We conducted kinetic analyses of γ-secretase activity in cell-free systems in the presence of Aβ, as well as cell-based and ex vivo assays in neuronal cell lines, neurons, and brain synaptosomes to assess the impact of Aβ on γ-secretases. We show that human Aβ42 peptides, but neither murine Aβ42 nor human Aβ17-42 (p3), inhibit γ-secretases and trigger accumulation of unprocessed substrates in neurons, including C-terminal fragments (CTFs) of APP, p75, and pan-cadherin. Moreover, Aβ42 treatment dysregulated cellular homeostasis, as shown by the induction of p75-dependent neuronal death in two distinct cellular systems. Our findings raise the possibility that pathological elevations in Aβ42 contribute to cellular toxicity via the γ-secretase inhibition, and provide a novel conceptual framework to address Aβ toxicity in the context of γ-secretase-dependent homeostatic signaling.

Genetic dissection of a QTL from wild emmer wheat, QGpc.huj.uh-5B.2, introgressed into bread wheat, identified candidate genes associated with tolerance to nitrogen deficiency, and potentially useful for improving nitrogen-use efficiency. Nitrogen (N) is an important macronutrient critical to wheat growth and development; its deficiency is one of the main factors causing reductions in grain yield and quality. N availability is significantly affected by drought or flooding, that are dependent on additional factors including soil type or duration and severity of stress. In a previous study, we identified a high grain protein content QTL (QGpc.huj.uh-5B.2) derived from the 5B chromosome of wild emmer wheat, that showed a higher proportion of explained variation under water-stress conditions. We hypothesized that this QTL is associated with tolerance to N deficiency as a possible mechanism underlying the higher effect under stress. To validate this hypothesis, we introgressed the QTL into the elite bread wheat var. Ruta, and showed that under N-deficient field conditions the introgression IL99 had a 33% increase in GPC (p

Maintenance of water homeostasis is a fundamental cellular process required by all living organisms. Here, we use the single-celled green alga Chlamydomonas reinhardtii to establish a foundational understanding of osmotic-stress signaling pathways through transcriptomics, phosphoproteomics, and functional genomics approaches. Comparison of pathways identified through these analyses with yeast and Arabidopsis allows us to infer their evolutionary conservation and divergence across these lineages. 76 genes, acting across diverse cellular compartments, were found to be important for osmotic-stress tolerance in Chlamydomonas through their functions in cytoskeletal organization, potassium transport, vesicle trafficking, mitogen-activated protein kinase and chloroplast signaling. We show that homologs for five of these genes have conserved functions in stress tolerance in Arabidopsis and reveal a novel PROFILIN-dependent stage of acclimation affecting the actin cytoskeleton that ensures tissue integrity upon osmotic stress. This study highlights the conservation of the stress response in algae and land plants, and establishes Chlamydomonas as a unicellular plant model system to dissect the osmotic stress signaling pathway.

While regular physical activity is a cornerstone of health, wellness, and vitality, the impact of endurance exercise training on molecular signaling within and across tissues remains to be delineated. The Molecular Transducers of Physical Activity Consortium (MoTrPAC) was established to characterize molecular networks underlying the adaptive response to exercise. Here, we describe the endurance exercise training studies undertaken by the Preclinical Animal Sites Studies component of MoTrPAC, in which we sought to develop and implement a standardized endurance exercise protocol in a large cohort of rats. To this end, Adult (6-mo) and Aged (18-mo) female (n = 151) and male (n = 143) Fischer 344 rats were subjected to progressive treadmill training (5 d/wk, ∼70%-75% VO2max) for 1, 2, 4, or 8 wk; sedentary rats were studied as the control group. A total of 18 solid tissues, as well as blood, plasma, and feces, were collected to establish a publicly accessible biorepository and for extensive omics-based analyses by MoTrPAC. Treadmill training was highly effective, with robust improvements in skeletal muscle citrate synthase activity in as little as 1-2 wk and improvements in maximum run speed and maximal oxygen uptake by 4-8 wk. For body mass and composition, notable age- and sex-dependent responses were observed. This work in mature, treadmill-trained rats represents the most comprehensive and publicly accessible tissue biorepository, to date, and provides an unprecedented resource for studying temporal-, sex-, and age-specific responses to endurance exercise training in a preclinical rat model.

Background and aimsMany agricultural areas are expected to face hotter, drier conditions from climate change. Understanding the mechanisms that crops use to mitigate these stresses can guide breeding for more tolerant plant material. We tested relationships between traits, physiological function in hot conditions and historical climate associations to evaluate these mechanisms for winegrapes. We expected a more negative leaf osmotic potential at full hydration (πo), which reduces leaf turgor loss during drought, and either a metabolically cheaper or more osmoprotectant leaf chemical composition, to allow cultivars associated with hot, dry regions to maintain greater gas exchange in hot growing conditions.MethodsWe measured πo, gas exchange and leaf chemistry for seven commercially important winegrape cultivars that vary widely in historical climate associations. Vines were grown in common-garden field conditions in a hot wine-growing region (Davis, CA, USA) and measured over the hottest period of the growing season (July-September).Key resultsThe value of πo varied significantly between cultivars, and all cultivars significantly reduced πo (osmotically adjusted) over the study period, although osmotic adjustment did not vary across cultivars. The value of πo was correlated with gas exchange and climate associations, but in the direction opposite to expected. Photosynthesis and πo were higher in the cultivars associated with hotter, less humid regions. Leaf chemical composition varied between cultivars but was not related to climate associations.ConclusionsThese findings suggest that maintenance of leaf turgor is not a primary limitation on grapevine adaptation to hot or atmospherically dry growing conditions. Thus, selecting for a more negative πo or greater osmotic adjustment is not a promising strategy to develop more climate-resilient grape varieties, contrary to findings for other crops. Future work is needed to identify the mechanisms increasing photosynthesis in the cultivars associated with hot, dry regions.

Adaptation is a universal aspect of neural systems that changes circuit computations to match prevailing inputs. These changes facilitate efficient encoding of sensory inputs while avoiding saturation. Conventional artificial neural networks (ANNs) have limited adaptive capabilities, hindering their ability to reliably predict neural output under dynamic input conditions. Can embedding neural adaptive mechanisms in ANNs improve their performance? To answer this question, we develop a new deep learning model of the retina that incorporates the biophysics of photoreceptor adaptation at the front-end of conventional convolutional neural networks (CNNs). These conventional CNNs build on 'Deep Retina,' a previously developed model of retinal ganglion cell (RGC) activity. CNNs that include this new photoreceptor layer outperform conventional CNN models at predicting male and female primate and rat RGC responses to naturalistic stimuli that include dynamic local intensity changes and large changes in the ambient illumination. These improved predictions result directly from adaptation within the phototransduction cascade. This research underscores the potential of embedding models of neural adaptation in ANNs and using them to determine how neural circuits manage the complexities of encoding natural inputs that are dynamic and span a large range of light levels.

Organisms adapt to unfavorable seasonal conditions to survive. These seasonal adaptations rely on the correct interpretation of environmental cues such as photoperiod, and temperature. Genetic studies in several organisms, including the genetic powerhouse Drosophila melanogaster, indicate that circadian clock components, such as period and timeless, are involved in photoperiodic-dependent seasonal adaptations, but our understanding of this process is far from complete. In particular, the role of temperature as a key factor to complement photoperiodic response is not well understood. The development of new sequencing technologies has proven extremely useful in understanding the plastic changes that the clock and other cellular components undergo in different environmental conditions, including changes in gene expression and alternative splicing. This article discusses the integration of photoperiod and temperature for seasonal biology as well as downstream molecular and cellular pathways involved in the regulation of physiological adaptations that occur with changing seasons. We focus our discussion on the current understanding of the involvement of the molecular clock and the circadian clock neuronal circuits in these adaptations in D. melanogaster.

DNA replication stress (RS) is a widespread phenomenon in carcinogenesis, causing genomic instability and extensive chromatin alterations. DNA damage leads to activation of innate immune signaling, but little is known about transcriptional regulators mediating such signaling upon RS. Using a chemical screen, we identified protein arginine methyltransferase 5 (PRMT5) as a key mediator of RS-dependent induction of interferon-stimulated genes (ISGs). This response is also associated with reactivation of endogenous retroviruses (ERVs). Using quantitative mass spectrometry, we identify proteins with PRMT5-dependent symmetric dimethylarginine (SDMA) modification induced upon RS. Among these, we show that PRMT5 targets and modulates the activity of ZNF326, a zinc finger protein essential for ISG response. Our data demonstrate a role for PRMT5-mediated SDMA in the context of RS-induced transcriptional induction, affecting physiological homeostasis and cancer therapy.

When looking at faces, humans invariably move their eyes to a consistent preferred first fixation location on the face. While most people have the preferred fixation location just below the eyes, a minority have it between the nose-tip and mouth. Not much is known about whether these long-term differences in the preferred fixation location are associated with distinct neural representations of faces. To study this, we used a gaze-contingent face adaptation aftereffect paradigm to test in two groups of observers, one with their mean preferred fixation location closer to the eyes (upper lookers) and the other closer to the mouth (lower lookers). In this task, participants were required to maintain their gaze at either their own groups mean preferred fixation location or that of the other group during adaptation and testing. The two possible fixation locations were 3.6° apart on the face. We measured the face adaptation aftereffects when the adaptation and testing happened while participants maintained fixation at either the same or different locations on the face. Both groups showed equally strong adaptation effects when the adaptation and testing happened at the same fixation location. Crucially, only the upper lookers showed a partial transfer of the FAE across the two fixation locations, when adaptation occurred at the eyes. Lower lookers showed no spatial transfer of the FAE irrespective of the adaptation position. Given the classic finding that neural tuning is increasingly position invariant as one moves higher in the visual hierarchy, this result suggests that differences in the preferred fixation location are associated with distinct neural representations of faces.

Currently, there is no effective treatment for obesity and alcohol-associated liver diseases, partially due to the lack of translational human models. Here, we present a protocol to generate 3D human liver spheroids that contain all the liver cell types and mimic "livers in a dish." We describe strategies to induce metabolic and alcohol-associated hepatic steatosis, inflammation, and fibrosis. We outline potential applications, including using human liver spheroids for experimental and translational research and drug screening to identify potential anti-fibrotic therapies.

Exercise-induced muscle adaptations vary based on exercise modality and intensity. We constructed a signalling network model from 87 published studies of human or rodent skeletal muscle cell responses to endurance or resistance exercise in vivo or simulated exercise in vitro. The network comprises 259 signalling interactions between 120 nodes, representing eight membrane receptors and eight canonical signalling pathways regulating 14 transcriptional regulators, 28 target genes and 12 exercise-induced phenotypes. Using this network, we formulated a logic-based ordinary differential equation model predicting time-dependent molecular and phenotypic alterations following acute endurance and resistance exercises. Compared with nine independent studies, the model accurately predicted 18/21 (85%) acute responses to resistance exercise and 12/16 (75%) acute responses to endurance exercise. Detailed sensitivity analysis of differential phenotypic responses to resistance and endurance training showed that, in the model, exercise regulates cell growth and protein synthesis primarily by signalling via mechanistic target of rapamycin, which is activated by Akt and inhibited in endurance exercise by AMP-activated protein kinase. Endurance exercise preferentially activates inflammation via reactive oxygen species and nuclear factor κB signalling. Furthermore, the expected preferential activation of mitochondrial biogenesis by endurance exercise was counterbalanced in the model by protein kinase C in response to resistance training. This model provides a new tool for investigating cross-talk between skeletal muscle signalling pathways activated by endurance and resistance exercise, and the mechanisms of interactions such as the interference effects of endurance training on resistance exercise outcomes.

Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5 and 3 regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5: GTTAACTTCA) and Syn3-10b-2 (3: GGGCCTGTGG). These promoters activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5 sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3 sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter.

Selection causes local adaptation across populations within species and simultaneously divergence between species. However, it is unclear if either the force of or the response to selection is similar across these scales. We show that natural selection drives divergence between closely related species in a pattern that is distinct from local adaptation within species. We use reciprocal transplant experiments across three species of Phlox wildflowers to characterize widespread adaptive divergence. Using provenance trials, we also find strong local adaptation between populations within a species. Comparing divergence and selection between these two scales of diversity we discover that one suite of traits predicts fitness differences between species and that an independent suite of traits predicts fitness variation within species. Selection drives divergence between species, contributing to speciation, while simultaneously favoring extensive diversity that is maintained across populations within a species. Our work demonstrates how the selection landscape is complex and multidimensional.

Bottlenose dolphins (Tursiops truncatus) are keystone and sentinel species in the world's oceans. We studied correlations between per- and polyfluoroalkyl substances (PFAS) and their stress axis. We investigated associations between plasma biomarkers of 12 different PFAS variants and three cortisol pools (total, bound, and free) in wild T. truncatus from estuarine waters of Charleston, South Carolina (n = 115) and Indian River Lagoon, Florida (n = 178) from 2003 to 2006, 2010-2013, and 2015. All PFAS and total cortisol levels for these dolphins were previously reported; bound cortisol levels and free cortisol calculations have not been previously reported. We tested null hypotheses that levels of each PFAS were not correlated with those of each cortisol pool. Free cortisol levels were lower when PFOS, PFOA, and PFHxS biomarker levels were higher, but free cortisol levels were higher when PFTriA was higher. Bound cortisol levels were higher when there were higher PFDA, PFDoDA, PFDS, PFTeA, and PFUnDA biomarkers. Total cortisol was higher when PFOA was lower, but total cortisol was higher when PFDA, PFDoDA, PFTeA, and PFTriA were higher. Additional analyses indicated sex and age trends, as well as heterogeneity of effects from the covariates carbon chain length and PFAS class. Although this is a cross-sectional observational study and, therefore, could reflect cortisol impacts on PFAS toxicokinetics, these correlations are suggestive that PFAS impacts the stress axis in T. truncatus. However, if PFAS do impact the stress axis of dolphins, it is specific to the chemical structure, and could affect the individual pools of cortisol differently. It is critical to conduct long-term studies on these dolphins and to compare them to populations that have no or little expose to PFAS.

Adaptive laboratory evolution experiments provide a controlled context in which the dynamics of selection and adaptation can be followed in real-time at the single-nucleotide level. And yet this precision introduces hundreds of degrees-of-freedom as genetic changes accrue in parallel lineages over generations. On short timescales, physiological constraints have been leveraged to provide a coarse-grained view of bacterial gene expression characterized by a small set of phenomenological parameters. Here, we ask whether this same framework, operating at a level between genotype and fitness, informs physiological changes that occur on evolutionary timescales. Using a strain adapted to growth in glucose minimal medium, we find that the proteome is substantially remodeled over 40 000 generations. The most striking change is an apparent increase in enzyme efficiency, particularly in the enzymes of lower-glycolysis. We propose that deletion of metabolic flux-sensing regulation early in the adaptation results in increased enzyme saturation and can account for the observed proteome remodeling.

The F-box domain is a highly conserved structural motif that defines the largest class of ubiquitin ligases, Skp1/Cullin1/F-box protein (SCF) complexes. The only known function of the F-box motif is to form the protein interaction surface with Skp1. Here we show that the F-box domain can function as an environmental sensor. We demonstrate that the F-box domain of Met30 is a cadmium sensor that blocks the activity of the SCFMet30 ubiquitin ligase during cadmium stress. Several highly conserved cysteine residues within the Met30 F-box contribute to binding of cadmium with a KD of 8 µM. Binding induces a conformational change that allows for Met30 autoubiquitylation, which in turn leads to recruitment of the segregase Cdc48/p97/VCP followed by active SCFMet30 disassembly. The resulting inactivation of SCFMet30 protects cells from cadmium stress. Our results show that F-box domains participate in regulation of SCF ligases beyond formation of the Skp1 binding interface.

Adaptation to extreme environments often involves the evolution of dramatic physiological changes. To better understand how organisms evolve these complex phenotypic changes, the repeatability and predictability of evolution, and possible constraints on adapting to an extreme environment, it is important to understand how adaptive variation has evolved. Poeciliid fishes represent a particularly fruitful study system for investigations of adaptation to extreme environments due to their repeated colonization of toxic hydrogen sulfide-rich springs across multiple species within the clade. Previous investigations have highlighted changes in the physiology and gene expression in specific species that are thought to facilitate adaptation to hydrogen sulfide-rich springs. However, the presence of adaptive nucleotide variation in coding and regulatory regions and the degree to which convergent evolution has shaped the genomic regions underpinning sulfide tolerance across taxa are unknown. By sampling across seven independent lineages in which nonsulfidic lineages have colonized and adapted to sulfide springs, we reveal signatures of shared evolutionary rate shifts across the genome. We found evidence of genes, promoters, and putative enhancer regions associated with both increased and decreased convergent evolutionary rate shifts in hydrogen sulfide-adapted lineages. Our analysis highlights convergent evolutionary rate shifts in sulfidic lineages associated with the modulation of endogenous hydrogen sulfide production and hydrogen sulfide detoxification. We also found that regions with shifted evolutionary rates in sulfide spring fishes more often exhibited convergent shifts in either the coding region or the regulatory sequence of a given gene, rather than both.

Horizontal genetic transfer (HGT) is a common phenomenon in eukaryotic genomes. However, the mechanisms by which HGT-derived genes persist and integrate into other pathways remain unclear. This topic is of significant interest because, over time, the stressors that initially favoured the fixation of HGT may diminish or disappear. Despite this, the foreign genes may continue to exist if they become part of a broader stress response or other pathways. The conventional model suggests that the acquisition of HGT equates to adaptation. However, this model may evolve into more complex interactions between gene products, a concept we refer to as the 'Integrated HGT Model' (IHM). To explore this concept further, we studied specialized HGT-derived genes that encode heavy metal detoxification functions. The recruitment of these genes into other pathways could provide clear examples of IHM. In our study, we exposed two anciently diverged species of polyextremophilic red algae from the Galdieria genus to arsenic and mercury stress in laboratory cultures. We then analysed the transcriptome data using differential and coexpression analysis. Our findings revealed that mercury detoxification follows a 'one gene-one function' model, resulting in an indivisible response. In contrast, the arsH gene in the arsenite response pathway demonstrated a complex pattern of duplication, divergence and potential neofunctionalization, consistent with the IHM. Our research sheds light on the fate and integration of ancient HGTs, providing a novel perspective on the ecology of extremophiles.

A regulated stress response is essential for healthy child growth and development trajectories. We conducted a cluster-randomized trial in rural Bangladesh (funded by the Bill & Melinda Gates Foundation, ClinicalTrials.gov NCT01590095) to assess the effects of an integrated nutritional, water, sanitation, and handwashing intervention on child health. We previously reported on the primary outcomes of the trial, linear growth and caregiver-reported diarrhea. Here, we assessed additional prespecified outcomes: physiological stress response, oxidative stress, and DNA methylation (N = 759, ages 1-2 years). Eight neighboring pregnant women were grouped into a study cluster. Eight geographically adjacent clusters were block-randomized into the control or the combined nutrition, water, sanitation, and handwashing (N + WSH) intervention group (receiving nutritional counseling and lipid-based nutrient supplements, chlorinated drinking water, upgraded sanitation, and handwashing with soap). Participants and data collectors were not masked, but analyses were masked. There were 358 children (68 clusters) in the control group and 401 children (63 clusters) in the intervention group. We measured four F2-isoprostanes isomers (iPF(2α)-III; 2,3-dinor-iPF(2α)-III; iPF(2α)-VI; 8,12-iso-iPF(2α)-VI), salivary alpha-amylase and cortisol, and methylation of the glucocorticoid receptor (NR3C1) exon 1F promoter including the NGFI-A binding site. Compared with control, the N + WSH group had lower concentrations of F2-isoprostanes isomers (differences ranging from -0.16 to -0.19 log ng/mg of creatinine, P

Implicit adaptation has been regarded as a rigid process that automatically operates in response to movement errors to keep the sensorimotor system precisely calibrated. This hypothesis has been challenged by recent evidence suggesting flexibility in this learning process. One compelling line of evidence comes from work suggesting that this form of learning is context-dependent, with the rate of learning modulated by error history. Specifically, learning was attenuated in the presence of perturbations exhibiting high variance compared to when the perturbation is fixed. However, these findings are confounded by the fact that the adaptation system corrects for errors of different magnitudes in a non-linear manner, with the adaptive response increasing in a proportional manner to small errors and saturating to large errors. Through simulations, we show that this non-linear motor correction function is sufficient to explain the effect of perturbation variance without referring to an experience-dependent change in error sensitivity. Moreover, by controlling the distribution of errors experienced during training, we provide empirical evidence showing that there is no measurable effect of perturbation variance on implicit adaptation. As such, we argue that the evidence to date remains consistent with the rigidity assumption.

Single-cell and single-nucleus RNA-sequencing technologies capture the expression of plant genes at an unprecedented resolution. Therefore, these technologies are gaining traction in plant molecular and developmental biology for elucidating the transcriptional changes across cell types in a specific tissue or organ, upon treatments, in response to biotic and abiotic stresses, or between genotypes. Despite the rapidly accelerating use of these technologies, collective and standardized experimental and analytical procedures to support the acquisition of high-quality data sets are still missing. In this commentary, we discuss common challenges associated with the use of single-cell transcriptomics in plants and propose general guidelines to improve reproducibility, quality, comparability, and interpretation and to make the data readily available to the community in this fast-developing field of research.

IL-17C is an epithelial cell-derived proinflammatory cytokine whose transcriptional regulation remains unclear. Analysis of the IL17C promoter region identified TCF4 as putative regulator, and siRNA knockdown of TCF4 in human keratinocytes (KCs) increased IL17C. IL-17C stimulation of KCs (along with IL-17A and TNF-α stimulation) decreased TCF4 and increased NFKBIZ and ZC3H12A expression in an IL-17RA/RE-dependent manner, thus creating a feedback loop. ZC3H12A (MCPIP1/Regnase-1), a transcriptional immune-response regulator, also increased following TCF4 siRNA knockdown, and siRNA knockdown of ZC3H12A decreased NFKBIZ, IL1B, IL36G, CCL20, and CXCL1, revealing a proinflammatory role for ZC3H12A. Examination of lesional skin from the KC-Tie2 inflammatory dermatitis mouse model identified decreases in TCF4 protein concomitant with increases in IL-17C and Zc3h12a that reversed following the genetic elimination of Il17c, Il17ra, and Il17re and improvement in the skin phenotype. Conversely, interference with Tcf4 in KC-Tie2 mouse skin increased Il17c and exacerbated the inflammatory skin phenotype. Together, these findings identify a role for TCF4 in the negative regulation of IL-17C, which, alone and with TNF-α and IL-17A, feed back to decrease TCF4 in an IL-17RA/RE-dependent manner. This loop is further amplified by IL-17C-TCF4 autocrine regulation of ZC3H12A and IL-17C regulation of NFKBIZ to promote self-sustaining skin inflammation.

There are known individual differences in both the ability to learn the layout of novel environments and the flexibility of strategies for navigating known environments. However, it is unclear how navigational abilities are impacted by high-stress scenarios. Here we used immersive virtual reality (VR) to develop a novel behavioral paradigm to examine navigation under dynamically changing situations. We recruited 48 participants (24 female; ages 17-32) to navigate a virtual maze (7.5 m × 7.5 m). Participants learned the maze by moving along a fixed path past the mazes landmarks (paintings). Subsequently, participants experienced either a non-stress condition, or a high-stress condition tasking them with navigating the maze. In the high-stress condition, their initial path was blocked, the environment was darkened, threatening music was played, fog obstructed more distal views of the environment, and participants were given a time limit of 20 s with a countdown timer displayed at the top of their screen. On trials where the path was blocked, we found self-reported stress levels and distance traveled increased while trial completion rate decreased (as compared to non-stressed control trials). On unblocked stress trials, participants were less likely to take a shortcut and consequently navigated less efficiently compared to control trials. Participants with more trait spatial anxiety reported more stress and navigated less efficiently. Overall, our results suggest that navigational abilities change considerably under high-stress conditions.

Hypoxia-inducible factor pathway genes are linked to adaptation in both human and nonhuman highland species. EPAS1, a notable target of hypoxia adaptation, is associated with relatively lower hemoglobin concentration in Tibetans. We provide evidence for an association between an adaptive EPAS1 variant (rs570553380) and the same phenotype of relatively low hematocrit in Andean highlanders. This Andean-specific missense variant is present at a modest frequency in Andeans and absent in other human populations and vertebrate species except the coelacanth. CRISPR-base-edited human cells with this variant exhibit shifts in hypoxia-regulated gene expression, while metabolomic analyses reveal both genotype and phenotype associations and validation in a lowland population. Although this genocopy of relatively lower hematocrit in Andean highlanders parallels well-replicated findings in Tibetans, it likely involves distinct pathway responses based on a protein-coding versus noncoding variants, respectively. These findings illuminate how unique variants at EPAS1 contribute to the same phenotype in Tibetans and a subset of Andean highlanders despite distinct evolutionary trajectories.

The two major aims of the present study were: (i) quantify localised cortical bone adaptation at the surface level using contralateral endpoint imaging data and image analysis techniques, and (ii) investigate whether cortical bone adaptation responses are universal or region specific and dependent on the respective peak load. For this purpose, we re-analyse previously published μ CT data of the mouse tibia loading model that investigated bone adaptation in response to sciatic neurectomy and various peak load magnitudes (F = 0, 2, 4, 6, 8, 10, 12 N). A beam theory-based approach was developed to simulate cortical bone adaptation in different sections of the tibia, using longitudinal strains as the adaptive stimuli. We developed four mechanostat models: universal, surface-based, strain directional-based, and combined surface and strain direction-based. Rates of bone adaptation in these mechanostat models were computed using an optimisation procedure (131,606 total simulations), performed on a single load case (F = 10 N). Subsequently, the models were validated against the remaining six peak loads. Our findings indicate that local bone adaptation responses are quasi-linear and bone region specific. The mechanostat model which accounted for differences in endosteal and periosteal regions and strain directions (i.e. tensile versus compressive) produced the lowest root mean squared error between simulated and experimental data for all loads, with a combined prediction accuracy of 76.6, 55.0 and 80.7% for periosteal, endosteal, and cortical thickness measurements (in the midshaft of the tibia). The largest root mean squared errors were observed in the transitional loads, i.e. F = 2 to 6 N, where inter-animal variability was highest. Finally, while endpoint imaging studies provide great insights into organ level bone adaptation responses, the between animal and loaded versus control limb variability make simulations of local surface-based adaptation responses challenging.

Stress response pathways detect and alleviate adverse conditions to safeguard cell and tissue homeostasis, yet their prolonged activation induces apoptosis and disrupts organismal health1-3. How stress responses are turned off at the right time and place remains poorly understood. Here we report a ubiquitin-dependent mechanism that silences the cellular response to mitochondrial protein import stress. Crucial to this process is the silencing factor of the integrated stress response (SIFI), a large E3 ligase complex mutated in ataxia and in early-onset dementia that degrades both unimported mitochondrial precursors and stress response components. By recognizing bifunctional substrate motifs that equally encode protein localization and stability, the SIFI complex turns off a general stress response after a specific stress event has been resolved. Pharmacological stress response silencing sustains cell survival even if stress resolution failed, which underscores the importance of signal termination and provides a roadmap for treating neurodegenerative diseases caused by mitochondrial import defects.

Generalist microbes have adapted to a multitude of environmental stresses through their integrated stress response system. Individual stress responses have been quantified by E. coli metabolism and expression (ME) models under thermal, oxidative and acid stress, respectively. However, the systematic quantification of cross-stress & cross-talk among these stress responses remains lacking. Here, we present StressME: the unified stress response model of E. coli combining thermal (FoldME), oxidative (OxidizeME) and acid (AcidifyME) stress responses. StressME is the most up to date ME model for E. coli and it reproduces all published single-stress ME models. Additionally, it includes refined rate constants to improve prediction accuracy for wild-type and stress-evolved strains. StressME revealed certain optimal proteome allocation strategies associated with cross-stress and cross-talk responses. These stress-optimal proteomes were shaped by trade-offs between protective vs. metabolic enzymes; cytoplasmic vs. periplasmic chaperones; and expression of stress-specific proteins. As StressME is tuned to compute metabolic and gene expression responses under mild acid, oxidative, and thermal stresses, it is useful for engineering and health applications. The modular design of our open-source package also facilitates model expansion (e.g., to new stress mechanisms) by the computational biology community.

Biofilms aid bacterial adhesion to surfaces via direct and indirect mechanisms, and formation of biofilms is considered as an important strategy for adaptation and survival in suboptimal environmental conditions. However, the molecular underpinnings of biofilm formation in subsurface sediment/groundwater ecosystems where microorganisms often experience fluctuations in nutrient input, pH, and nitrate or metal concentrations are underexplored. We examined biofilm formation under different nutrient, pH, metal, and nitrate regimens of 16 Rhodanobacter strains isolated from subsurface groundwater wells spanning diverse levels of pH (3.5 to 5) and nitrates (13.7 to 146 mM). Eight Rhodanobacter strains demonstrated significant biofilm growth under low pH, suggesting adaptations for survival and growth at low pH. Biofilms were intensified under aluminum stress, particularly in strains possessing fewer genetic traits associated with biofilm formation, findings warranting further investigation. Through random barcode transposon-site sequencing (RB-TnSeq), proteomics, use of specific mutants, and transmission electron microscopy analysis, we discovered flagellar loss under aluminum stress, indicating a potential relationship between motility, metal tolerance, and biofilm growth. Comparative genomic analyses revealed the absence of flagella and chemotaxis genes and the presence of a putative type VI secretion system in the highly biofilm-forming strain FW021-MT20. In this study we identified genetic determinants associated with biofilm growth under metal stress in a predominant environmental genus, Rhodanobacter, and identified traits aiding survival and adaptation to contaminated subsurface environments.

Wildfires affect soils in multiple ways, leading to numerous challenges for colonizing microorganisms. Although it is thought that fire-adapted microorganisms lie at the forefront of postfire ecosystem recovery, the specific strategies that these organisms use to thrive in burned soils remain largely unknown. Through bioactivity screening of bacterial isolates from burned soils, we discovered that several Paraburkholderia spp. isolates produced a set of unusual rhamnolipid surfactants with a natural methyl ester modification. These rhamnolipid methyl esters (RLMEs) exhibited enhanced antimicrobial activity against other postfire microbial isolates, including pyrophilous Pyronema fungi and Amycolatopsis bacteria, compared to the typical rhamnolipids made by organisms such as Pseudomonas spp. RLMEs also showed enhanced surfactant properties and facilitated bacterial motility on agar surfaces. In vitro assays further demonstrated that RLMEs improved aqueous solubilization of polycyclic aromatic hydrocarbons, which are potential carbon sources found in char. Identification of the rhamnolipid biosynthesis genes in the postfire isolate, Paraburkholderia kirstenboschensis str. F3, led to the discovery of rhlM, whose gene product is responsible for the unique methylation of rhamnolipid substrates. RhlM is the first characterized bacterial representative of a large class of integral membrane methyltransferases that are widespread in bacteria. These results indicate multiple roles for RLMEs in the postfire lifestyle of Paraburkholderia isolates, including enhanced dispersal, solubilization of potential nutrients, and inhibition of competitors. Our findings shed new light on the chemical adaptations that bacteria employ to navigate, grow, and outcompete other soil community members in postfire environments.

BackgroundColletotrichum fungi infect a wide diversity of monocot and dicot hosts, causing diseases on almost all economically important plants worldwide. Colletotrichum is also a suitable model for studying gene family evolution on a fine scale to uncover events in the genome associated with biological changes.ResultsHere we present the genome sequences of 30 Colletotrichum species covering the diversity within the genus. Evolutionary analyses revealed that the Colletotrichum ancestor diverged in the late Cretaceous in parallel with the diversification of flowering plants. We provide evidence of independent host jumps from dicots to monocots during the evolution of Colletotrichum, coinciding with a progressive shrinking of the plant cell wall degradative arsenal and expansions in lineage-specific gene families. Comparative transcriptomics of 4 species adapted to different hosts revealed similarity in gene content but high diversity in the modulation of their transcription profiles on different plant substrates. Combining genomics and transcriptomics, we identified a set of core genes such as specific transcription factors, putatively involved in plant cell wall degradation.ConclusionsThese results indicate that the ancestral Colletotrichum were associated with dicot plants and certain branches progressively adapted to different monocot hosts, reshaping the gene content and its regulation.

Understanding microbial adaptation is crucial for predicting how soil carbon dynamics and global biogeochemical cycles will respond to climate change. This study employs the DEMENT model of microbial decomposition, along with empirical mutation and dispersal rates, to explore the roles of mutation and dispersal in the adaptation of soil microbial populations to shifts in litter chemistry, changes that are anticipated with climate-driven vegetation dynamics. Following a change in litter chemistry, mutation generally allows for a higher rate of litter decomposition than dispersal, especially when dispersal predominantly introduces genotypes already present in the population. These findings challenge the common idea that mutation rates are too low to affect ecosystem processes on ecological timescales. These results demonstrate that evolutionary processes, such as mutation, can help maintain ecosystem functioning as the climate changes.

Marine microbes that have for eons been adapted to stable salinity regimes are confronted with sudden decreases in salinity in the Arctic Ocean. The episodic freshening is increasing due to climate change with melting multi-year sea-ice and glaciers, greater inflows from rivers, and increased precipitation. To investigate algal responses to lowered salinity, we analyzed the responses and acclimatation over 24 h in a non-model Arctic marine alga (pelagophyte CCMP2097) following transfer to realistic lower salinities. Using RNA-seq transcriptomics, here we show rapid differentially expressed genes related to stress oxidative responses, proteins involved in the photosystem and circadian clock, and those affecting lipids and inorganic ions. After 24 h the pelagophyte adjusted to the lower salinity seen in the overexpression of genes associated with freezing resistance, cold adaptation, and salt tolerance. Overall, a suite of ancient widespread pathways is recruited enabling the species to adjust to the stress of rapid salinity change.

A mechanistic understanding of host-microbe interactions in the gut microbiome is hindered by poorly annotated bacterial genomes. While functional genomics can generate large gene-to-phenotype datasets to accelerate functional discovery, their applications to study gut anaerobes have been limited. For instance, most gain-of-function screens of gut-derived genes have been performed in Escherichia coli and assayed in a small number of conditions. To address these challenges, we develop Barcoded Overexpression BActerial shotgun library sequencing (Boba-seq). We demonstrate the power of this approach by assaying genes from diverse gut Bacteroidales overexpressed in Bacteroides thetaiotaomicron. From hundreds of experiments, we identify new functions and phenotypes for 29 genes important for carbohydrate metabolism or tolerance to antibiotics or bile salts. Highlights include the discovery of a D-glucosamine kinase, a raffinose transporter, and several routes that increase tolerance to ceftriaxone and bile salts through lipid biosynthesis. This approach can be readily applied to develop screens in other strains and additional phenotypic assays.

Ontocetus is one of the most notable extinct odobenines owing to its global distribution in the Northern Hemisphere. Originating in the Late Miocene of the western North Pacific, this lineage quickly spread to the Atlantic Ocean during the Pliocene, with notable occurrences in England, Belgium, The Netherlands, Morocco and the eastern seaboard of the United States. Reassessment of a pair of mandibles from the Lower Pleistocene of Norwich (United Kingdom) and a mandible from the Upper Pliocene of Antwerp (Belgium) that were referred to as Ontocetus emmonsi reveals existences of features of both Ontocetus and Odobenus. The presence of four post-canine teeth, a lower canine larger than the cheek-teeth and a lower incisor confirms the assignment to Ontocetus; simultaneously, characteristics such as a fused and short mandibular symphysis, a well-curved mandibular arch and thin septa between teeth align with traits usually found in Odobenus. Based on a combination of these characters, we describe Ontocetus posti, sp. nov. Its mandibular anatomy suggests, a better adaptation to suction-feeding than what was previously described in the genus suggesting that Ontocetus posti sp. nov. likely occupied a similar ecological niche to the extant walrus Odobenus rosmarus. Originating from the North Pacific Ocean, Ontocetus most likely dispersed via the Central American Seaway. Although initially discovered in the Lower Pliocene deposits of the western North Atlantic, Ontocetus also left its imprint in the North Sea basin and Moroccan Plio-Pleistocene deposits. The closure of the Isthmus of Panama during the Mio-Pliocene boundary significantly impacted the contemporary climate, inducing global cooling. This event constrained Ontocetus posti in the North Sea basin leaving the taxon unable to endure the abrupt climate changes of the Early Pleistocene, ultimately going extinct before the arrival of the extant counterpart, Odobenus rosmarus.

Local adaptation of populations results from an interplay between their environment and genetics. If functional trait variation influences plant performance, populations can adapt to their local environment. However, populations may also respond plastically to environmental challenges, altering phenotype without shifting allele frequencies. The level of local adaptation in crop landraces and their capacity for plasticity in response to environmental change may predict their continued utility to farmers facing climate change. Yet we understand little about how physiological traits potentially underlying local adaptation of cultivars influence fitness. Farmers in Mexico-the crop center of origin for maize-manage and rely upon a high diversity of landraces. We studied maize grown in Chiapas, Mexico, where strong elevational gradients cover a relatively small geographic area. We reciprocally transplanted 12 populations sourced from three elevational zones (600, 1550 and 2150 m) back into those elevations for two years using a modified split-split plot design to model effects of environment, genetics, and their interaction. We studied physiological and growth traits, including photosynthetic rate, stomatal conductance, stomatal density, relative growth rate (RGR), and seed production. Maize fitness showed indications of local adaptation with highland and midland types performing poorly at warmer lowland locations, though patterns depended on the year. Several physiological traits, including stomatal conductance, were affected by G x E interactions, some of which indicated non-adaptive plastic responses with potential fitness implications. We discerned a significant positive relationship between fitness and relative growth rate. Growth rates in highland landraces were outperformed by midland and lowland landraces grown in high temperature, lowland garden. Lowland landrace stomatal conductance was diminished compared to that of highland landraces in the cooler highland garden. Thus, both adaptive and non-adaptive physiological responses of maize landraces in southern Mexico may have implications for fitness, as well as responses to climate change.

Polycystic ovarian syndrome is the most common endocrine disorder that affects women. The focus on inflammatory PCOS will be the basis of understanding how hormonal imbalances are due to inflammatory diets, stress, and environmental factors that impact symptom severity. The objective of this paper was to provide a systematic review that would determine if symptom severity was associated with psychological stress on polycystic ovarian syndrome (PCOS). It is important to note that PCOS does not have a cure but symptom severity may only be treated, this is due to the cause being unknown and PCOS being used as an umbrella term for issues related to the ovaries and reproductive cycle. As a result, the most commonly suggested findings were to improve diet, improve exercise habits, and seek psychological help if feeling distressed by the symptoms of PCOS.

Background: The choroid, a highly vascular structure within the eye, is significantly influenced by various systemic conditions. The advent of enhanced depth optical coherence tomography has improved our ability to evaluate choroidal pathophysiology. The choroidal vascularity index (CVI), a noninvasive and reliable tool, serves as an effective means of assessing the choroidal vascular structure. Recent studies have increasingly focused on exploring CVI alterations under different systemic conditions. This study aims to provide a comprehensive summary of the latest research findings in this area. Methods: A systematic literature review was conducted on October 1, 2023, using two databases, MEDLINE (via PubMed) and Scopus. Search terms were tailored specifically for each database to ensure a thorough exploration of relevant literature. The studies identified were qualitatively assessed, with particular emphasis on outcomes related to CVI and choroidal thickness. Results: A total of 48 studies were included in the review, encompassing a diverse range of systemic conditions such as diabetes, central nervous system disorders, cardiovascular diseases, autoimmune disorders, and infectious diseases. Notable reductions in CVI were observed in diabetic retinopathy, autoimmune diseases, and neurodegenerative disorders. Additionally, the review highlighted variations in CVI values related to the severity of systemic diseases, indicating its potential use as a biomarker for disease progression. Conclusion: This review highlights the significant correlation between variations in the choroidal vascularity index and diverse systemic conditions affecting hemodynamics. An enhanced understanding of CVI provides deeper insights into the pathophysiological mechanisms underlying these disorders and positions CVI as a promising biomarker for early detection and monitoring. Nevertheless, its clinical utility warrants careful assessment. Future research should address the potential limitations of CVI to fully capitalize on its diagnostic and prognostic potential. [ABSTRACT FROM AUTHOR]

The study assessed the adaptive ability of two Indian goat breeds, Barbari (n = 10) and Sirohi (n = 10), to different seasons in their natural habitat. Hematological, physiological, biochemical and electrolyte variations were compared across winter and summer. Physiological responses such as respiration rate, pulse rate, rectal temperature, and skin temperature increased significantly (p < 0.01), while hematological responses decreased significantly (p < 0.01) during the summer . Blood urea nitrogen levels were higher , while blood glucose concentrations were lower during the summer. Among the estimated blood electrolytes, decreased sodium (Na+) and chloride (Cl−) ions were observed during the winter, while lower concentrations of potassium (K+) ions were noted in the summer. The Sirohi breed showed reduced levels of variation in the responses observed during the experiment. The study concluded that the Sirohi breed’s superior resilience in semi-arid climates, with smaller response variations compared to the Barbari breed is due to their adaptive ability across different seasons. [ABSTRACT FROM AUTHOR]

In today's rapidly evolving technological landscape, this study investigates the impact of new technology on organizational work dynamics. By integrating the Job Demands-Resources theory and the Episodic Process Model, we examine the cognitive mechanisms that influence task performance during decision-making episodes. Our research focuses on episodic job demands and resources, emphasizing the mediating role of task absorption in the relationship between these factors and task performance. Our findings reveal that episodic job resources positively affect task absorption and performance, while job demands moderate the relationship between job resources and task absorption. Employing the Beer Distribution Game alongside neuroscience-based eye-tracking techniques, we analyze visual attention dynamics during decision-making episodes, providing novel insights into the interplay between task absorption and task performance. Theoretically, our study highlights the significance of task absorption in understanding how episodic job resources impact decision-making performance. Practically, our results advocate for the implementation of decision-making-focused skills development through physiological measures such as neurofeedback training programs. This research underscores the importance of individual time management in enhancing task performance, contributing to a nuanced understanding of job resources, job demands, and task absorption in the context of technological transformation. [ABSTRACT FROM AUTHOR]

Introduction: Alfalfa (Medicago sativa L.) is a globally important legume crop with high nutritional and ecological value. Drought poses a serious threat to alfalfa acreage and yields. Spermine (Spm) has been shown to protect plants from drought damage. The aim of this study was to clarify the mechanism of exogenous Spm to improve drought resistance of alfalfa. Methods: In this study, we root applied 0.1, 0.5, and 1mM Spm to Gannong No. 3 (G3) alfalfa under drought stress, and then determined their physiological and metabolic changes. Results: The results showed that exogenous Spm increased chlorophyll content, chlorophyll fluorescence parameters and gas exchange parameters, enhanced antioxidant enzymes activity, improved ascorbic acid-glutathione (AsA-GSH) cycle, increased osmoregulatory substances content, reduced hydrogen peroxide and superoxide anion levels, and inhibited malondialdehyde accumulation in alfalfa under drought stress, thereby increasing plant height and leaf relative water content and enhancing drought tolerance of alfalfa. The redundancy analysis of the above physiological indicators showed that the addition of the optimal Spm to improve drought tolerance of alfalfa under drought stress was mainly achieved by increasing catalase activity and improving the ASA-GSH cycle. In addition, metabolomics analysis revealed that exogenous Spm increased the content of oxobutanedioic acid, citric acid, fumaric acid and malic acid to enhance the tricarboxylic acid cycle. Meanwhile, exogenous Spm increased endogenous Spm and proline (Pro) content to resist drought stress by enhancing Spm and Pro metabolism. Moreover, exogenous Spm increased the accumulation of the signaling substance abscisic acid. Discussion: In conclusion, exogenous Spm enhanced drought resistance of alfalfa leaves under drought stress. [ABSTRACT FROM AUTHOR]

The pathogenesis of epilepsy is related to the microbiota-gut-brain axis, but the mechanism has not been clarified. The microbiota-gut-brain axis is divided into the microbiota-gut-brain axis (upward pathways) and the brain-gut-microbiota axis (downward pathways) according to the direction of conduction. Gut microorganisms are involved in pathological and physiological processes in the human body and participate in epileptogenesis through neurological, immunological, endocrine, and metabolic pathways, as well as through the gut barrier and blood brain barrier mediated upward pathways. After epilepsy, the downward pathway mediated by the HPA axis and autonomic nerves triggers "leaky brain "and "leaky gut," resulting in the formation of microbial structures and enterobacterial metabolites associated with epileptogenicity, re-initiating seizures via the upward pathway. Characteristic changes in microbial and metabolic pathways in the gut of epileptic patients provide new targets for clinical prevention and treatment of epilepsy through the upward pathway. Based on these changes, this review further redescribes the pathogenesis of epilepsy and provides a new direction for its prevention and treatment. [ABSTRACT FROM AUTHOR]