Search

The genetic control of many plant traits can be highly complex. Both allelic variation (sequence change) and dosage variation (copy number change) contribute to a plants phenotype. While numerous studies have investigated the effect of allelic or dosage variation, very few have documented both within the same system, leaving their relative contribution to phenotypic effects unclear. The Populus genome is highly polymorphic, and poplars are fairly tolerant of gene dosage variation. Here, using a previously established Populus hybrid F1 population, we assessed and compared the effect of natural allelic variation and induced dosage variation on biomass, phenology, and leaf morphology traits. We identified QTLs for many of these traits, but our results indicate limited overlap between the QTLs associated with natural allelic variation and induced dosage variation. Additionally, the integration of data from both allelic and dosage variation identifies a larger set of QTLs that together explain a larger percentage of the phenotypic variance. Finally, our results suggest that the effect of the large indels might mask that of allelic QTLs. Our study helps clarify the relationship between allelic and dosage variation and their effects on quantitative traits.

Increasing heatwaves are threatening forest ecosystems globally. Leaf thermal regulation and tolerance are important for plant survival during heatwaves, though the interaction between these processes and water availability is unclear. Genotypes of the widely distributed foundation tree species Populus fremontii were studied in a controlled common garden during a record summer heatwave-where air temperature exceeded 48 °C. When water was not limiting, all genotypes cooled leaves 2 to 5 °C below air temperatures. Homeothermic cooling was disrupted for weeks following a 72-h reduction in soil water, resulting in leaf temperatures rising 3 °C above air temperature and 1.3 °C above leaf thresholds for physiological damage, despite the water stress having little effect on leaf water potentials. Tradeoffs between leaf thermal safety and hydraulic safety emerged but, regardless of water use strategy, all genotypes experienced significant leaf mortality following water stress. Genotypes from warmer climates showed greater leaf cooling and less leaf mortality after water stress in comparison with genotypes from cooler climates. These results illustrate how brief soil water limitation disrupts leaf thermal regulation and potentially compromises plant survival during extreme heatwaves, thus providing insight into future scenarios in which ecosystems will be challenged with extreme heat and unreliable soil water access.

Improving photosynthesis, the fundamental process by which plants convert light energy into chemical energy, is a key area of research with great potential for enhancing sustainable agricultural productivity and addressing global food security challenges. This perspective delves into the latest advancements and approaches aimed at optimizing photosynthetic efficiency. Our discussion encompasses the entire process, beginning with light harvesting and its regulation and progressing through the bottleneck of electron transfer. We then delve into the carbon reactions of photosynthesis, focusing on strategies targeting the enzymes of the Calvin-Benson-Bassham (CBB) cycle. Additionally, we explore methods to increase carbon dioxide (CO2) concentration near the Rubisco, the enzyme responsible for the first step of CBB cycle, drawing inspiration from various photosynthetic organisms, and conclude this section by examining ways to enhance CO2 delivery into leaves. Moving beyond individual processes, we discuss two approaches to identifying key targets for photosynthesis improvement: systems modeling and the study of natural variation. Finally, we revisit some of the strategies mentioned above to provide a holistic view of the improvements, analyzing their impact on nitrogen use efficiency and on canopy photosynthesis.

Zymoseptoria tritici is the most economically significant fungal pathogen of wheat in Europe. However, despite the importance of this pathogen, the molecular interactions between pathogen and host during infection are not well understood. Herein, we describe the use of two libraries of cloned Z. tritici effectors that were screened to identify effector candidates with putative pathogen-associated molecular pattern (PAMP)-triggered immunity (PTI)-suppressing activity. The effectors from each library were transiently expressed in Nicotiana benthamiana, and expressing leaves were treated with bacterial or fungal PAMPs to assess the effectors ability to suppress reactive oxygen species (ROS) production. From these screens, numerous effectors were identified with PTI-suppressing activity. In addition, some effectors were able to suppress cell death responses induced by other Z. tritici secreted proteins. We used structural prediction tools to predict the putative structures of all of the Z. tritici effectors and used these predictions to examine whether there was enrichment of specific structural signatures among the PTI-suppressing effectors. From among the libraries, multiple members of the killer protein-like 4 (KP4) and killer protein-like 6 (KP6) effector families were identified as PTI suppressors. This observation is intriguing, as these protein families were previously associated with antimicrobial activity rather than virulence or host manipulation. This data provides mechanistic insight into immune suppression by Z. tritici during infection and suggests that, similar to biotrophic pathogens, this fungus relies on a battery of secreted effectors to suppress host immunity during early phases of colonization.

Forecasting plant responses under global change is a critical but challenging endeavour. Despite seemingly idiosyncratic responses of species to global change, greater generalisation of 'winners' and 'losers' may emerge from considering how species functional traits influence responses and how these responses scale to the community level. Here, we synthesised six long-term global change experiments combined with locally measured functional traits. We quantified the change in abundance and probability of establishment through time for 70 alpine plant species and then assessed if leaf and stature traits were predictive of species and community responses across nitrogen addition, snow addition and warming treatments. Overall, we found that plants with more resource-acquisitive trait strategies increased in abundance but each global change factor was related to different functional strategies. Nitrogen addition favoured species with lower leaf nitrogen, snow addition favoured species with cheaply constructed leaves and warming showed few consistent trends. Community-weighted mean changes in trait values in response to nitrogen addition, snow addition and warming were often different from species-specific trait effects on abundance and establishment, reflecting in part the responses and traits of dominant species. Together, these results highlight that the effects of traits can differ by scale and response of interest.

Plants are colonized by distinct pathogenic and commensal microbiomes across different regions of the globe, but the factors driving their geographic variation are largely unknown. Here, using 16S ribosomal DNA and shotgun sequencing, we characterized the associations of the Arabidopsis thaliana leaf microbiome with host genetics and climate variables from 267 populations in the species native range across Europe. Comparing the distribution of the 575 major bacterial amplicon variants (phylotypes), we discovered that microbiome composition in A. thaliana segregates along a latitudinal gradient. The latitudinal clines in microbiome composition are predicted by metrics of drought, but also by the spatial genetics of the host. To validate the relative effects of drought and host genotype we conducted a common garden field study, finding 10% of the core bacteria to be affected directly by drought and 20% to be affected by host genetic associations with drought. These data provide a valuable resource for the plant microbiome field, with the identified associations suggesting that drought can directly and indirectly shape genetic variation in A. thaliana via the leaf microbiome.

With the anticipated foliar application of nanoparticles (NPs) as a potential strategy to improve crop production and ameliorate heavy metal toxicity, it is crucial to evaluate the role of NPs in improving the nutrient content of plants under Lead (Pb) stress for achieving higher agriculture productivity to ensure food security. Herein, Brassica napus L. grown under Pb contaminated soil (300 mg/kg) was sprayed with different rates (0, 25, 50, and 100 mg/L) of TiO2 and ZnO-NPs. The plants were evaluated for growth attributes, photosynthetic pigments, leaf exchange attributes, oxidant and antioxidant enzyme activities. The results revealed that 100 mg/L NPs foliar application significantly augmented plant growth, photosynthetic pigments, and leaf gas exchange attributes. Furthermore, 100 mg/L TiO2 and ZnO-NPs application showed a maximum increase in SPAD values (79.1%, 68.9%). NPs foliar application (100 mg/L TiO2 and ZnO-NPs) also substantially reduced malondialdehyde (44.3%, 38.3%), hydrogen peroxide (59.9%, 53.1%), electrolyte leakage (74.8%, 68.3%), and increased peroxidase (93.8%, 89.1%), catalase (91.3%, 84.1%), superoxide dismutase (81.8%, 73.5%) and ascorbate peroxidase (78.5%, 73.7%) thereby reducing Pb accumulation. NPs foliar application (100 mg/L) significantly reduced root Pb (45.7%, 42.3%) and shoot Pb (84.1%, 76.7%) concentration in TiO2 and ZnO-NPs respectively, as compared to control. Importantly, macro and micronutrient analysis showed that foliar application 100 mg/L TiO2 and ZnO-NPs increased shoot zinc (58.4%, 78.7%) iron (79.3%, 89.9%), manganese (62.8%, 68.6%), magnesium (72.1%, 93.7%), calcium (58.2%, 69.9%) and potassium (81.5%, 68.6%) when compared to control without NPs. The same trend was observed for root nutrient concentration. In conclusion, we found that the TiO2 and ZnO-NPs have the greatest efficiency at 100 mg/L concentration to alleviate Pb induced toxicity on growth, photosynthesis, and nutrient content of Brassica napus L. NPs foliar application is a promising strategy to ensure sustainable agriculture and food safety under metal contamination.

Huanglongbing (HLB) is a fatal citrus disease that is currently threatening citrus varieties worldwide. One putative causative agent, Candidatus Liberibacter asiaticus (CLas), is vectored by Diaphorina citri, known as the Asian citrus psyllid (ACP). Understanding the details of CLas infection in HLB disease has been hindered by its Candidatus nature and the inability to confidently detect it in diseased trees during the asymptomatic stage. To identify early changes in citrus metabolism in response to inoculation of CLas using its natural psyllid vector, leaves from Madam Vinous sweet orange (Citrus sinensis (L.) Osbeck) trees were exposed to CLas-positive ACP or CLas-negative ACP and longitudinally analyzed using transcriptomics (RNA sequencing), proteomics (liquid chromatography-tandem mass spectrometry; data available in Dryad: 10.25338/B83H1Z), and metabolomics (proton nuclear magnetic resonance). At 4 weeks postexposure (wpe) to psyllids, the initial HLB plant response was primarily to the ACP and, to a lesser extent, the presence or absence of CLas. Additionally, analysis of 4, 8, 12, and 16 wpe identified 17 genes and one protein as consistently differentially expressed between leaves exposed to CLas-positive ACP versus CLas-negative ACP. This study informs identification of early detection molecular targets and contributes to a broader understanding of vector-transmitted plant pathogen interactions.

Leaf litter microbes collectively degrade plant polysaccharides, influencing land-atmosphere carbon exchange. An open question is how substrate complexity-defined as the structure of the saccharide and the amount of external processing by extracellular enzymes-influences species interactions. We tested the hypothesis that monosaccharides (i.e. xylose) promote negative interactions through resource competition, and polysaccharides (i.e. xylan) promote neutral or positive interactions through resource partitioning or synergism among extracellular enzymes. We assembled a three-species community of leaf litter-degrading bacteria isolated from a grassland site in Southern California. In the polysaccharide xylan, pairs of species stably coexisted and grew equally in coculture and in monoculture. Conversely, in the monosaccharide xylose, competitive exclusion and negative interactions prevailed. These pairwise dynamics remained consistent in a three-species community: all three species coexisted in xylan, while only two species coexisted in xylose, with one species capable of using peptone. A mathematical model showed that in xylose these dynamics could be explained by resource competition. Instead, the model could not predict the coexistence patterns in xylan, suggesting other interactions exist during biopolymer degradation. Overall, our study shows that substrate complexity influences species interactions and patterns of coexistence in a synthetic microbial community of leaf litter degraders.

Background and aimsMany agricultural areas are expected to face hotter, drier conditions from climate change. Understanding the mechanisms that crops use to mitigate these stresses can guide breeding for more tolerant plant material. We tested relationships between traits, physiological function in hot conditions and historical climate associations to evaluate these mechanisms for winegrapes. We expected a more negative leaf osmotic potential at full hydration (πo), which reduces leaf turgor loss during drought, and either a metabolically cheaper or more osmoprotectant leaf chemical composition, to allow cultivars associated with hot, dry regions to maintain greater gas exchange in hot growing conditions.MethodsWe measured πo, gas exchange and leaf chemistry for seven commercially important winegrape cultivars that vary widely in historical climate associations. Vines were grown in common-garden field conditions in a hot wine-growing region (Davis, CA, USA) and measured over the hottest period of the growing season (July-September).Key resultsThe value of πo varied significantly between cultivars, and all cultivars significantly reduced πo (osmotically adjusted) over the study period, although osmotic adjustment did not vary across cultivars. The value of πo was correlated with gas exchange and climate associations, but in the direction opposite to expected. Photosynthesis and πo were higher in the cultivars associated with hotter, less humid regions. Leaf chemical composition varied between cultivars but was not related to climate associations.ConclusionsThese findings suggest that maintenance of leaf turgor is not a primary limitation on grapevine adaptation to hot or atmospherically dry growing conditions. Thus, selecting for a more negative πo or greater osmotic adjustment is not a promising strategy to develop more climate-resilient grape varieties, contrary to findings for other crops. Future work is needed to identify the mechanisms increasing photosynthesis in the cultivars associated with hot, dry regions.

Soil salinity is a major nutritional challenge with poor agriculture production characterized by high sodium (Na+) ions in the soil. Zinc oxide nanoparticles (ZnO NPs) and biochar have received attention as a sustainable strategy to reduce biotic and abiotic stress. However, there is a lack of information regarding the incorporation of ZnO NPs with biochar to ameliorate the salinity stress (0, 50,100 mM). Therefore, the current study aimed to investigate the potentials of ZnO NPs application (priming and foliar) alone and with a combination of biochar on the growth and nutrient availability of spinach plants under salinity stress. Results demonstrated that salinity stress at a higher rate (100 mM) showed maximum growth retardation by inducing oxidative stress, resulted in reduced photosynthetic rate and nutrient availability. ZnO NPs (priming and foliar) alone enhanced growth, chlorophyll contents and gas exchange parameters by improving the antioxidant enzymes activity of spinach under salinity stress. While, a significant and more pronounced effect was observed at combined treatments of ZnO NPs with biochar amendment. More importantly, ZnO NPs foliar application with biochar significantly reduced the Na+ contents in root 57.69%, and leaves 61.27% of spinach as compared to the respective control. Furthermore, higher nutrient contents were also found at the combined treatment of ZnO NPs foliar application with biochar. Overall, ZnO NPs combined application with biochar proved to be an efficient and sustainable strategy to alleviate salinity stress and improve crop nutritional quality under salinity stress. We inferred that ZnO NPs foliar application with a combination of biochar is more effectual in improving crop nutritional status and salinity mitigation than priming treatments with a combination of biochar.

Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5 and 3 regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5: GTTAACTTCA) and Syn3-10b-2 (3: GGGCCTGTGG). These promoters activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5 sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3 sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter.

Many insects have evolved the ability to manipulate plant growth to generate extraordinary structures called galls, in which insect larva can develop while being sheltered and feeding on the plant. In particular, cynipid (Hymenoptera: Cynipidae) wasps have evolved to form morphologically complex galls and generate an astonishing array of gall shapes, colors, and sizes. However, the biochemical basis underlying these remarkable cellular and developmental transformations remains poorly understood. A key determinant in plant cellular development is cell wall deposition that dictates the physical form and physiological function of newly developing cells, tissues, and organs. However, it is unclear to what degree cell walls are restructured to initiate and support the formation of new gall tissue. Here, we characterize the molecular alterations underlying gall development using a combination of metabolomic, histological, and biochemical techniques to elucidate how valley oak (Quercus lobata) leaf cells are reprogrammed to form galls. Strikingly, gall development involves an exceptionally coordinated spatial deposition of lignin and xylan to form de novo gall vasculature. Our results highlight how cynipid wasps can radically change the metabolite profile and restructure the cell wall to enable the formation of galls, providing insights into the mechanism of gall induction and the extent to which plants can be entirely reprogrammed to form unique structures and organs.

Non-structural carbohydrates (NSCs) are building blocks for biomass and fuel metabolic processes. However, it remains unclear how tropical forests mobilize, export, and transport NSCs to cope with extreme droughts. We combined drought manipulation and ecosystem 13CO2 pulse-labeling in an enclosed rainforest at Biosphere 2, assessed changes in NSCs, and traced newly assimilated carbohydrates in plant species with diverse hydraulic traits and canopy positions. We show that drought caused a depletion of leaf starch reserves and slowed export and transport of newly assimilated carbohydrates below ground. Drought effects were more pronounced in conservative canopy trees with limited supply of new photosynthates and relatively constant water status than in those with continual photosynthetic supply and deteriorated water status. We provide experimental evidence that local utilization, export, and transport of newly assimilated carbon are closely coupled with plant water use in canopy trees. We highlight that these processes are critical for understanding and predicting tree resistance and ecosystem fluxes in tropical forest under drought.

Background: Childhood vitamin A deficiency leads to increased morbidity and mortality. Human milk is the only source of vitamin A for exclusively breastfed infants. Dried Moringa oleifera leaf powder (moringa) is a good food source of provitamin A and other carotenoids. Its effect during lactation on human milk vitamin A and carotenoid content is unclear. Objectives: Our objective was to investigate the effect of maternal moringa consumption on human milk retinol and carotenoid concentrations and maternal and infant vitamin A status. Methods: We conducted a 3-month pilot single-blinded cluster-randomized controlled trial in breastfeeding mother-infant pairs (n = 50) in Kenya. Mothers received corn porridge with (20 g/d) or without moringa with complete breast expressions and maternal and infant serum collected at enrollment (infant

Eucalyptus camaldulensis is a multifunctional tree and is globally used for the reclamation of problematic lands. Eucalyptus camaldulensis is prone to attack by a number of pathogens, but the most important threat is the Fusarium wilt (Fusarium oxysporum). Keeping in view the importance of E. camaldulensis and to manage this disease, five plant activators, i.e., salicylic acid (C7H6O3), benzoic acid (C7H6O2), citric acid (C6H8O7), dipotassium phosphate (K2HPO4), monopotassium phosphate (KH2PO4) and nutritional mixture namely Compound (NPK) and nutriotop (Fe, Zn, Cu, B, Mn) were evaluated in the Fusarium infested field under RCBD in the Research Area, Department of Forestry and Range Management, University of Agriculture, Faisalabad (UAF). Among plant activators, salicylic acid and a combination of compound + nutriotop exhibited the lowest disease incidence and enhanced fresh and dry weight of leaves compared to other treatments and control. Results of the environmental study indicated maximum disease incidence between 35-40 °C (max. T), 6-25 °C (mini. T), 70-80% relative humidity and 1.5-2.5 km/h wind speed while pan evaporation expressed weak correlation with disease development. It was concluded that Fusarium wilt of Eucalyptus camaldulensis could be managed through activation of the basal defense system of the host plant with provision of salicylic acid and balanced nutrition by considering environmental factors. Recent exploration is expected to be helpful for future research efforts on epidemiology and ecologically sound intervention of Fusarium wilt of Eucalyptus camaldulensis.

Plant hyperspectral images (HSIs) contain valuable information for agricultural disaster prediction, biomass estimation, and other applications. However, they also include a lot of irrelevant background information, which wastes storage resources. In this paper, we propose a novel recursive sub-tensor hyperspectral compressive sensing method for plant leaves. This method uses recursive sub-tensor compressive sensing to compress and reconstruct each arbitrary-shape leaf region, discarding a large amount of background information to achieve the best possible reconstruction performance of the leaf region and significantly reduce storage space. The proposed method involves several key steps. Firstly, the optimal band is determined using the spatial spectral decorrelation criterion, and its corresponding mask image is used to extract the leaf regions from the background. Secondly, the recursive maximum inscribed rectangle algorithm is applied to obtain rectangular sub-tensors of leaves recursively. Each sub-tensor is then individually compressed and reconstructed. Finally, all sub-tensors can be reconstructed to form complete leaf HSIs without background information. Experimental results demonstrate that the proposed method achieves superior image reconstruction quality at extremely low sampling rates compared to other methods. The proposed method can improve average Peak Signal-to-Noise Ratio (PSNR) values by about 3.04% and 0.74% compared to Tensor Compressive Sensing (TCS) at the sampling rate of 2%. In the spectral domain, the proposed method can achieve significantly smaller Spectral Angle Mapper (SAM) values and relatively lower spectral indices errors for Double Difference, Triangular Vegetation Index, Leaf Chlorophyll Index, and Modified Normalized Difference 680 than those of TCS. Therefore, the proposed method achieves better compression performance for reconstructed plant leaf HSIs than the other methods. [ABSTRACT FROM AUTHOR]

The Polymer Electrolyte Membrane Water Electrolyser (PEMWE) has gained significant interest among various electrolysis methods due to its ability to produce highly purified, compressed hydrogen. The spatial configuration of bipolar plates and their flow channel patterns play a critical role in the efficiency and longevity of the PEM water electrolyser. Optimally designed flow channels ensure uniform pressure and velocity distribution across the stack, enabling high-pressure operation and facilitating high current densities. This study uses flow channel geometry inspired by authentic vine leaf patterns found in biomass, based on various plant leaves, including Soybean, Victoria Amazonica, Water Lily, Nelumbo Nucifera, Kiwi, and Acalypha Hispida leaves, as a novel channel pattern to design a PEM bipolar plate with a circular cross-section area of 13.85 c m 2 . The proposed bipolar design is further analysed with COMSOL Multiphysics to integrate the conservation of mass and momentum, molecular diffusion (Maxwell–Stefan), charge transfer equations, and other fabrication factors into a cohesive single-domain model. The simulation results showed that the novel designs have the most uniform velocity profile, lower pressure drop, superior pressure distribution, and heightened mixture homogeneity compared to the traditional serpentine models. [ABSTRACT FROM AUTHOR]

Hereditary factor VII (FVII) deficiency is an uncommon autosomal recessive disorder associated with mutations in the F7 gene, and laboratory investigations usually reveal isolated prolongation in prothrombin time (PT)/international normalized ratio (INR). Venom-induced consumptive coagulopathy (VICC) is distinguished by the activation of the coagulation pathway, which is triggered by procoagulant toxins in snake venom. Diagnosing snakebites in patients with hereditary FVII deficiency presents a challenge because prolonged time PT/INR is considered the most valuable diagnostic method for VICC. Therefore, it is possible that certain patients may not promptly receive an accurate diagnosis of hereditary FVII deficiency. We present a pedigree featuring hereditary FVII deficiency, which was diagnosed through Sanger sequencing, following a bamboo leaf green snake bite. [ABSTRACT FROM AUTHOR]

BACKGROUND AND AIMS: Drought events have devasting impacts on grape berry production. The aim of this study was to investigate berry growth in the context of leaf stomatal closure under progressive drought stress. METHODS: Potted grapevine plants (varieties Syrah and Cabernet Sauvignon) were evaluated at pre-verasion (30-45 d after anthesis, DAA) and post-veraison (90-107 DAA). Berry diameter, berry absolute growth rate (AGR), leaf stomatal conductance (Gs) at midday, plant water potential at predawn and midday (ΨPD and ΨMD, respectively), and soil relative water content were measured repeatedly. The ΨPD-threshold of 90 % loss in stomatal conductance (Gs10, i.e. complete stomatal closure) was determined. Data were related to plant dehydration phases I, II and III with corresponding boundaries Θ1 and Θ2, using the water potential curve method. KEY RESULTS: At pre-veraison, berry AGR declined together with leaf Gs in response to soil drying in both varieties. Berry AGR transitioned from positive to negative (shrinkage) values when leaf Gs approached zero. The Gs10-threshold was -0.81 MPa in Syrah and -0.74 MPa in Cabernet Sauvignon and was linked to boundary Θ1. At post-veraison, berry AGR was negligible and negative AGR values were not intensified by increasing drought stress in either variety. CONCLUSION: Leaf complete stomatal closure under progressive drought stress coincides with cessation of berry growth followed by shrinkage at pre-veraison (growth stage 1).

The plants are attacked from various micro-organisms, bacterial illnesses, and pests. The signs are normally identified via leaves, stem, or fruit inspection. Illnesses that generally appeared on vegetation are from leaves and causes big harm if not managed in the early ranges. To stop this huge harm and manipulate the unfold of disorder this work implements a software system. This research work customs deep neural network to gain knowledge of probable illnesses on leaves within the early phases so it can be stopped early. Deep neural network (DNN) used for image classification. This work mainly focuses a neural network model of leaves ailment detection. The commonly available plant leaves dataset is undertaken with a dataset having special training of disease detection. In this work VGG16, ResNet50, Inception V3 and Inception ResNetV2 architectural techniques are implemented to generate and compare the results. Results are compared on the factors like precision, accuracy, recall and F1-Score. The results lead to the conclusion, that the convolution neural network (CNN) is more impactful technique to perceive and predict plant diseases. [ABSTRACT FROM AUTHOR]

Nutrient stress can impose significant metabolic strain on plants, resulting in declining agricultural productivity. Nitrogen, phosphorus, and potassium are essential growth-limiting nutrients and are the primary building elements for amino acids, nucleic acids, proteins, and chlorophyll. The absence of these nutrients has observable effects on various plant characteristics, such as leaf size, color, and plant height. However, recent technological advances in imaging have given birth to computer vision-based plant phenomics, which holds great promise for plant research and management. The non-destructive, quick, automated assessments made possible by these imaging techniques are transforming the field of plant nutrient stress research and monitoring. This paper presents a hybrid quantum–classical model (HQCM) for identifying multi-nutrient stress and nutrient stress level quantification (NSLQ) for plant stress level identification by analyzing plant leaf images, utilizing the combined capabilities of classical and quantum computing systems. The HQCM model uses groundnut multi-nutrient stress (private), rice plant nutrient stress (public), and plant village (public) datasets for experimentation. The HQCM model exhibited impressive levels of accuracy, achieving rates of 97.79%, 97.37%, and 98.75% on the groundnut, rice, and plant village datasets, respectively. This performance surpasses conventional models, including Xception, DECM, DWC, and ResNet50V2. The proposed model showed significant advancements in accuracy, reaching the performance of state-of-art algorithms by 3.24%, 4.07%, and 6.73%, thus emphasizing its better performance. [ABSTRACT FROM AUTHOR]

Plant leaves contain multiple cell types which achieve distinct characteristics whilst still coordinating development within the leaf. The bundle sheath possesses larger individual cells and lower chloroplast content than the adjacent mesophyll, but how this morphology is achieved remains unknown. To identify regulatory mechanisms determining bundle sheath cell morphology we tested the effects of perturbing environmental (light) and endogenous signals (hormones) during leaf development of Oryza sativa (rice). Total chloroplast area in bundle sheath cells was found to increase with cell size as in the mesophyll but did not maintain a 'set‐point' relationship, with the longest bundle sheath cells demonstrating the lowest chloroplast content. Application of exogenous cytokinin and gibberellin significantly altered the relationship between cell size and chloroplast biosynthesis in the bundle sheath, increasing chloroplast content of the longest cells. Delayed exposure to light reduced the mean length of bundle sheath cells but increased corresponding leaf length, whereas premature light reduced final leaf length but did not affect bundle sheath cells. This suggests that the plant hormones cytokinin and gibberellin are regulators of the bundle sheath cell‐chloroplast relationship and that final bundle sheath length may potentially be affected by light‐mediated control of exit from the cell cycle. Summary statement: In rice (Oryza sativa) the timing of light exposure during leaf development changes mature bundle sheath morphology, reducing maximum cell length under extended darkness. Bundle sheath chloroplast biogenesis responds to changing cell size, with this relationship influenced by endogenous hormones. [ABSTRACT FROM AUTHOR]

SUMMARY: Next‐generation sequencing (NGS) library construction often involves using restriction enzymes to decrease genome complexity, enabling versatile polymorphism detection in plants. However, plant leaves frequently contain impurities, such as polyphenols, necessitating DNA purification before enzymatic reactions. To overcome this problem, we developed a PCR‐based method for expeditious NGS library preparation, offering flexibility in number of detected polymorphisms. By substituting a segment of the simple sequence repeat sequence in the MIG‐seq primer set (MIG‐seq being a PCR method enabling library construction with low‐quality DNA) with degenerate oligonucleotides, we introduced variability in detectable polymorphisms across various crops. This innovation, named degenerate oligonucleotide primer MIG‐seq (dpMIG‐seq), enabled a streamlined protocol for constructing dpMIG‐seq libraries from unpurified DNA, which was implemented stably in several crop species, including fruit trees. Furthermore, dpMIG‐seq facilitated efficient lineage selection in wheat and enabled linkage map construction and quantitative trait loci analysis in tomato, rice, and soybean without necessitating DNA concentration adjustments. These findings underscore the potential of the dpMIG‐seq protocol for advancing genetic analyses across diverse plant species. Significance Statement: Given that plants contain impurities in their leaves, DNA purification is required to construct NGS libraries with reduced genomic complexity using restriction enzymes, which poses a hinderance to rapid genotyping. We developed degenerate oligonucleotide primer MIG‐seq and its accompanying protocol, a method for constructing NGS libraries with varying degrees of complexity reduction from unpurified plant DNA using PCR, and demonstrated the feasibility of expeditious genetic analysis across various crop species. [ABSTRACT FROM AUTHOR]

Stress experienced during development in organisms with bilateral structures could result in developmental instability, which is expressed as subtle non‐directional deviations from perfect symmetry, known as fluctuating asymmetry (FA). As such, FA has been proposed, and extensively used, as a trait indicating stress for many organisms with bilateral structures and many types of stress. However, while this concept may apply to animals, the evidence for plants' main vegetative structures, that is, leaves, remains equivocal, and a comprehensive synthesis on this topic is still missing.We designed observational field and controlled greenhouse studies, combining different growth and leaf forms across multiple stress gradients, comprising 21 species and 80 populations. We measured FA as the difference between the left and right area of the leaf, an approach that accommodates diverse leaf forms. We used high‐precision, blind, single‐person measurements and tested for other forms of symmetry and the effect of leaf size. We further complemented our study with a systematic literature review of FA in plant leaves, compiling 51 studies comprising 72 species, 23 stress types and 131 unique entries (species × stress type).We consistently found no effect of stress on leaf FA in any of the studied species in both our field and experimental gradients. In the systematic literature review, only 39% of the unique entries showed the expected increase in FA with stress, 53% showed no effect, 9% showed an opposite trend of a decrease in FA with stress and 1% showed a unimodal relationship. Importantly, only 40% of all entries fulfilled the crucial step of controlling for a high‐precision measurement, and of these 49% reported the expected increase in FA with stress.Both the results of our observational and experimental approaches and the systematic literature review failed to support a clear relationship between stress and FA in plant leaves. These results clearly show that FA in plant leaves cannot be used as a reliable trait indicating stress during development. Read the free Plain Language Summary for this article on the Journal blog. [ABSTRACT FROM AUTHOR]

Leaves harbor distinct microbial communities that can have an important impact on plant health and microbial ecosystems worldwide. Nevertheless, the ecological processes that shape the composition of leaf microbial communities remain unclear, with previous studies reporting contradictory results regarding the importance of bacterial dispersal versus host selection. This discrepancy could be driven in part because leaf microbiome studies typically consider the upper and lower leaf surfaces as a single entity despite these habitats possessing considerable anatomical differences. We characterized the composition of bacterial phyllosphere communities from the upper and lower leaf surfaces across 24 plant species. Leaf surface pH and stomatal density were found to shape phyllosphere community composition, and the underside of leaves had lower richness and higher abundances of core community members than upper leaf surfaces. We found fewer endemic bacteria on the upper leaf surfaces, suggesting that dispersal is more important in shaping these communities, with host selection being a more important force in microbiome assembly on lower leaf surfaces. Our study illustrates how changing the scale in which we observe microbial communities can impact our ability to resolve and predict microbial community assembly patterns on leaf surfaces. IMPORTANCE Leaves can harbor hundreds of different bacterial species that form unique communities for every plant species. Bacterial communities on leaves are really important because they can, for example, protect their host against plant diseases. Usually, bacteria from the whole leaf are considered when trying to understand these communities; however, this study shows that the upper and lower sides of a leaf have a very different impact on how these communities are shaped. It seems that the bacteria on the lower leaf side are more closely associated with the plant host, and communities on the upper leaf side are more impacted by immigrating bacteria. This can be really important when we want to treat, for example, crops in the field with beneficial bacteria or when trying to understand host-microbe interactions on the leaves.

Persian walnut is a drought-sensitive species with considerable genetic variation in the photosynthesis and water use efficiency of its populations, which is largely unexplored. Here, we aimed to elucidate changes in the efficiency of photosynthesis and water content using a diverse panel of 60 walnut families which were submitted to a progressive drought for 24 days, followed by two weeks of re-watering. Severe water-withholding reduced leaf relative water content (RWC) by 20%, net photosynthetic rate (Pn) by 50%, stomatal conductance (gs) by 60%, intercellular CO2 concentration (Ci) by 30%, and transpiration rate (Tr) by 50%, but improved water use efficiency (WUE) by 25%. Severe water-withholding also inhibited photosystem II functionality as indicated by reduced quantum yield of intersystem electron transport (φEo) and transfer of electrons per reaction center (ET0/RC), also enhanced accumulation of QA (VJ) resulted in the reduction of the photosynthetic performance (PIABS) and maximal quantum yield of PSII (FV/FM); while elevated quantum yield of energy dissipation (φDo), energy fluxes for absorption (ABS/RC) and dissipated energy flux (DI0/RC) in walnut families. Cluster analysis classified families into three main groups (tolerant, moderately tolerant, and sensitive), with the tolerant group from dry climates exhibiting lesser alterations in assessed parameters than the other groups. Multivariate analysis of phenotypic data demonstrated that RWC and biophysical parameters related to the chlorophyll fluorescence such as FV/FM, φEo, φDo, PIABS, ABS/RC, ET0/RC, and DI0/RC represent fast, robust and non-destructive biomarkers for walnut performance under drought stress. Finally, phenotype-environment association analysis showed significant correlation of some photosynthetic traits with geoclimatic factors, suggesting a key role of climate and geography in the adaptation of walnut to its habitat conditions.

Fundamental axes of variation in plant traits result from trade-offs between costs and benefits of resource-use strategies at the leaf scale. However, it is unclear whether similar trade-offs propagate to the ecosystem level. Here, we test whether trait correlation patterns predicted by three well-known leaf- and plant-level coordination theories - the leaf economics spectrum, the global spectrum of plant form and function, and the least-cost hypothesis - are also observed between community mean traits and ecosystem processes. We combined ecosystem functional properties from FLUXNET sites, vegetation properties, and community mean plant traits into three corresponding principal component analyses. We find that the leaf economics spectrum (90 sites), the global spectrum of plant form and function (89 sites), and the least-cost hypothesis (82 sites) all propagate at the ecosystem level. However, we also find evidence of additional scale-emergent properties. Evaluating the coordination of ecosystem functional properties may aid the development of more realistic global dynamic vegetation models with critical empirical data, reducing the uncertainty of climate change projections.

Plant response to pathogen infection varies within a leaf, yet this heterogeneity is not well resolved. We expose Arabidopsis to Pseudomonas syringae or mock treatment and profile >11,000 individual cells using single-cell RNA sequencing. Integrative analysis of cell populations from both treatments identifies distinct pathogen-responsive cell clusters exhibiting transcriptional responses ranging from immunity to susceptibility. Pseudotime analyses through pathogen infection reveals a continuum of disease progression from an immune to a susceptible state. Confocal imaging of promoter-reporter lines for transcripts enriched in immune cell clusters shows expression surrounding substomatal cavities colonized or in close proximity to bacterial colonies, suggesting that cells within immune clusters represent sites of early pathogen invasion. Susceptibility clusters exhibit more general localization and are highly induced at later stages of infection. Overall, our work shows cellular heterogeneity within an infected leaf and provides insight into plant differential response to infection at a single-cell level.

Ecological theory posits that temporal stability patterns in plant populations are associated with differences in species ecological strategies. However, empirical evidence is lacking about which traits, or trade-offs, underlie species stability, especially across different biomes. We compiled a worldwide collection of long-term permanent vegetation records (greater than 7000 plots from 78 datasets) from a large range of habitats which we combined with existing trait databases. We tested whether the observed inter-annual variability in species abundance (coefficient of variation) was related to multiple individual traits. We found that populations with greater leaf dry matter content and seed mass were more stable over time. Despite the variability explained by these traits being low, their effect was consistent across different datasets. Other traits played a significant, albeit weaker, role in species stability, and the inclusion of multi-variate axes or phylogeny did not substantially modify nor improve predictions. These results provide empirical evidence and highlight the relevance of specific ecological trade-offs, i.e. in different resource-use and dispersal strategies, for plant populations stability across multiple biomes. Further research is, however, necessary to integrate and evaluate the role of other specific traits, often not available in databases, and intraspecific trait variability in modulating species stability.

Life on Earth depends on the conversion of solar energy to chemical energy by plants through photosynthesis. A fundamental challenge in optimizing photosynthesis is to adjust leaf angles to efficiently use the intercepted sunlight under the constraints of heat stress, water loss and competition. Despite the importance of leaf angle, until recently, we have lacked data and frameworks to describe and predict leaf angle dynamics and their impacts on leaves to the globe. We review the role of leaf angle in studies of ecophysiology, ecosystem ecology and earth system science, and highlight the essential yet understudied role of leaf angle as an ecological strategy to regulate plant carbon-water-energy nexus and to bridge leaf, canopy and earth system processes. Using two models, we show that leaf angle variations have significant impacts on not only canopy-scale photosynthesis, energy balance and water use efficiency but also light competition within the forest canopy. New techniques to measure leaf angles are emerging, opening opportunities to understand the rarely-measured intraspecific, interspecific, seasonal and interannual variations of leaf angles and their implications to plant biology and earth system science. We conclude by proposing three directions for future research.

Plant hyperspectral images (HSIs) contain valuable information for agricultural disaster prediction, biomass estimation, and other applications. However, they also include a lot of irrelevant background information, which wastes storage resources. In this paper, we propose a novel recursive sub-tensor hyperspectral compressive sensing method for plant leaves. This method uses recursive sub-tensor compressive sensing to compress and reconstruct each arbitrary-shape leaf region, discarding a large amount of background information to achieve the best possible reconstruction performance of the leaf region and significantly reduce storage space. The proposed method involves several key steps. Firstly, the optimal band is determined using the spatial spectral decorrelation criterion, and its corresponding mask image is used to extract the leaf regions from the background. Secondly, the recursive maximum inscribed rectangle algorithm is applied to obtain rectangular sub-tensors of leaves recursively. Each sub-tensor is then individually compressed and reconstructed. Finally, all sub-tensors can be reconstructed to form complete leaf HSIs without background information. Experimental results demonstrate that the proposed method achieves superior image reconstruction quality at extremely low sampling rates compared to other methods. The proposed method can improve average Peak Signal-to-Noise Ratio (PSNR) values by about 3.04% and 0.74% compared to Tensor Compressive Sensing (TCS) at the sampling rate of 2%. In the spectral domain, the proposed method can achieve significantly smaller Spectral Angle Mapper (SAM) values and relatively lower spectral indices errors for Double Difference, Triangular Vegetation Index, Leaf Chlorophyll Index, and Modified Normalized Difference 680 than those of TCS. Therefore, the proposed method achieves better compression performance for reconstructed plant leaf HSIs than the other methods.

Water disinfection by copper vessels has been prevalent over thousands of years. Unfortunately, people are still suffering from the bacterial pollution in drinking water. Here we show that, only through steeping with tiny amounts of common plant leaves, the room-temperature water in copper pots has unexpectedly high antibacterial ability. Remarkably, copper ions released from copper pots into water are in concentrations lower than the WHO safety threshold for drinking water, and have effective antibacterial ability when water contains specific leave components (polyphenols and/or lignin). Our computations show that the key to enhance antibacterial ability is the great increase in the proportion of Cu+ induced by aromatic rings in these leave components, which has been demonstrated by our experiments. The findings may disclose the mystery of copper vessels for water disinfection, and more importantly, provide effective antibacterial applications in industries and daily lives, by safely using copper ions together with biocompatible natural substances.

In the plant sciences, results of laboratory studies often do not translate well to the field. To help close this lab-field gap, we developed a strategy for studying the wiring of plant traits directly in the field, based on molecular profiling and phenotyping of individual plants. Here, we use this single-plant omics strategy on winter-type Brassica napus (rapeseed). We investigate to what extent early and late phenotypes of field-grown rapeseed plants can be predicted from their autumnal leaf gene expression, and find that autumnal leaf gene expression not only has substantial predictive power for autumnal leaf phenotypes but also for final yield phenotypes in spring. Many of the top predictor genes are linked to developmental processes known to occur in autumn in winter-type B. napus accessions, such as the juvenile-to-adult and vegetative-to-reproductive phase transitions, indicating that the yield potential of winter-type B. napus is influenced by autumnal development. Our results show that single-plant omics can be used to identify genes and processes influencing crop yield in the field.

MicroRNAs (miRNAs) play diverse roles in plant development, but whether and how miRNAs participate in thermomorphogenesis remain ambiguous. Here we show that HYPONASTIC LEAVES 1 (HYL1)-a key component of miRNA biogenesis-acts downstream of the thermal regulator PHYTOCHROME INTERACTING FACTOR 4 in the temperature-dependent plasticity of hypocotyl growth in Arabidopsis. A hyl1-2 suppressor screen identified a dominant dicer-like1 allele that rescues hyl1-2's defects in miRNA biogenesis and thermoresponsive hypocotyl elongation. Genome-wide miRNA and transcriptome analysis revealed microRNA156 (miR156) and its target SQUAMOSA PROMOTER-BINDING-PROTEIN-LIKE 9 (SPL9) to be critical regulators of thermomorphogenesis. Surprisingly, perturbation of the miR156/SPL9 module disengages seedling responsiveness to warm temperatures by impeding auxin sensitivity. Moreover, miR156-dependent auxin sensitivity also operates in the shade avoidance response at lower temperatures. Thus, these results unveil the miR156/SPL9 module as a previously uncharacterized genetic circuit that enables plant growth plasticity in response to environmental temperature and light changes.

Understanding climate change impacts on the Cape Floristic Region requires improved knowledge of plant physiological responses to the environment. Studies examining physiological responses of mountain fynbos have consisted of campaign-based measurements, capturing snapshots of plant water relations and photosynthesis. We examine conclusions drawn from prior studies by tracking in situ physiological responses of three species, representing dominant growth forms (proteoid, ericoid, restioid), over 2 years using miniature continuous sap flow technology, long-term observations of leaf/culm water potential and gas exchange, and xylem vulnerability to embolism. We observed considerable inter-specific variation in the timing and extent of seasonal declines in productivity. Shallow-rooted Erica monsoniana exhibited steep within-season declines in sap flow and water potentials, and pronounced inter-annual variability in total daily sap flux (Js). Protea repens showed steady reductions in Js across both years, despite deeper roots and less negative water potentials. Cannomois congesta-a shallow-rooted restioid-was least negatively impacted. Following rehydrating rain at the end of summer, gas exchange recovery was lower in the drier year compared with the normal year, but did not differ between species. Loss of function in the drier year was partially accounted for by loss of xylem transport capacity in Erica and Cannomois, but not Protea. Hitherto unseen water use patterns, including inter-annual variability of gas exchange associated with contrasting water uptake properties, reveal that species use different mechanisms to cope with summer dry periods. Revealing physiological responses of key growth forms enhances predictions of plant function within mountain fynbos under future conditions.

The spatial dispersion of photoelements within a vegetation canopy, quantified by the clumping index (CI), directly regulates the within-canopy light environment and photosynthesis rate, but is not commonly implemented in terrestrial biosphere models to estimate the ecosystem carbon cycle. A few global CI products have been developed recently with remote sensing measurements, making it possible to examine the global impacts of CI. This study deployed CI in the radiative transfer scheme of the Community Land Model version 5 (CLM5) and used the revised CLM5 to quantitatively evaluate the extent to which CI can affect canopy absorbed radiation and gross primary production (GPP), and for the first time, considering the uncertainty and seasonal variation of CI with multiple remote sensing products. Compared to the results without considering the CI impact, the revised CLM5 estimated that sunlit canopy absorbed up to 9%-15% and 23%-34% less direct and diffuse radiation, respectively, while shaded canopy absorbed 3%-18% more diffuse radiation across different biome types. The CI impacts on canopy light conditions included changes in canopy light absorption, and sunlit-shaded leaf area fraction related to nitrogen distribution and thus the maximum rate of Rubisco carboxylase activity (Vcmax ), which together decreased photosynthesis in sunlit canopy by 5.9-7.2 PgC year-1 while enhanced photosynthesis by 6.9-8.2 PgC year-1 in shaded canopy. With higher light use efficiency of shaded leaves, shaded canopy increased photosynthesis compensated and exceeded the lost photosynthesis in sunlit canopy, resulting in 1.0 ± 0.12 PgC year-1 net increase in GPP. The uncertainty of GPP due to the different input CI datasets was much larger than that caused by CI seasonal variations, and was up to 50% of the magnitude of GPP interannual variations in the tropical regions. This study highlights the necessity of considering the impacts of CI and its uncertainty in terrestrial biosphere models.

Cisplatin is a prominent chemotherapeutic agent that can induce significant damage to normal cells. Therefore, it is important to develop agents that protect normal cells without influencing the chemotherapeutic effect of cisplatin. The present study was conducted to explore the protective effects of Annona muricata leaf polysaccharides (ALPS) against cisplatin‑induced toxicity in macrophages. Apoptosis was assessed in macrophages and lung cancer cells to investigate the cytoprotective effect of ALPS, their effect on the production of cisplatin‑induced reactive oxygen species (ROS) and the loss of the mitochondrial transmembrane potential (MTP). Cisplatin, when used alone or in combination with ALPS, showed significant toxicity against A549 and H460 lung cancer cells. However, cisplatin‑induced cytotoxicity was suppressed by cotreatment of RAW 264.7 macrophages with ALPS. ALPS significantly inhibited the upregulation of Bax, cytosolic cytochrome c and caspases‑3, ‑8 and ‑9. Moreover, ALPS resulted in the cleavage of PARP and downregulation of Bcl‑2 levels in a concentration‑dependent manner, which ultimately led to a reduction in the apoptotic and necrotic populations of cisplatin‑treated RAW 264.7 macrophages. The suppression of the apoptotic signaling pathways was mediated through the reduction of ROS and MTP loss in cisplatin‑treated RAW 264.7 macrophages. In addition, ALPS alleviated cell damage by suppressing the mitochondrial apoptotic pathways in cisplatin‑treated bone marrow‑derived macrophages. Together, these findings suggested that ALPS may alleviate the toxic side effects of chemotherapeutic agents and act as a potential candidate for use as an effective adjuvant therapy.

Although plants and animals both assess their environment and respond to stimuli, this reaction is considered a behavior in animals and a response in plants. Responses in plants are seen within various timescales- from the nanosecond stimuli is presented to a lifelong progression. Within this study, we bridge the gap between animal behavioral studies and plant response. Sensitive plants (Mimosa pudica L.) are an ideal subject for this due to the rapid closure of their primary leaflets when touched. We designed a multimodal, or stress combination, experiment to test two hypotheses with sensitive plants: if they could be distracted and if they would alter their risk assessment when exposed to external stimuli (wind and sound). To evaluate the distraction hypothesis, we measured an individuals latency to close, hypothesizing that if the plants were distracted, they would take longer to close. To evaluate the uncertain risk hypothesis, we quantified the latency to reopen, hypothesizing that if the plants were uncertain, they would take longer to reopen. We also quantified the number of pinnae closed on the selected stem to test for changes in risk assessment across treatments. We expected the unimodal treatments would distract or alter risk assessment, and the multimodal treatment would elicit an enhanced response. Multimodal stimuli had a significant effect on the number of pinnae closed before the tap, but we found no evidence that plants were distracted by any stimulus tested. We found that temperature had a significant effect on the latency to close, and that plants modified their risk assessment when exposed to experimental wind stimuli. By manipulating environmental stimuli, we found that sensitive plants trade-off energy and perceived risk much in the way that is commonly found in animals. Framing the study of plants responses to environmental stimuli as behavioral questions may generate new insights.

Urbanization creates novel ecosystems comprised of species assemblages and environments with no natural analogue. Moreover, irrigation can alter plant function compared to non-irrigated systems. However, the capacity of irrigation to alter functional trait patterns across multiple species is unknown but may be important for the dynamics of urban ecosystems. We evaluated the hypothesis that urban irrigation influences plasticity in functional traits by measuring carbon-gain and water-use traits of 30 tree species planted in Southern California, USA spanning a coastal-to-desert gradient. Tree species respond to irrigation through increasing the carbon-gain trait relationship of leaf nitrogen per specific leaf area compared to their native habitat. Moreover, most species shift to a water-use strategy of greater water loss through stomata when planted in irrigated desert-like environments compared to coastal environments, implying that irrigated species capitalize on increased water availability to cool their leaves in extreme heat and high evaporative demand conditions. Therefore, irrigated urban environments increase the plasticity of trait responses compared to native ecosystems, allowing for novel response to climatic variation. Our results indicate that trees grown in water-resource-rich urban ecosystems can alter their functional traits plasticity beyond those measured in native ecosystems, which can lead to plant trait dynamics with no natural analogue.

Rising temperatures are influencing forests on many scales, with potentially strong variation vertically across forest strata. Using published research and new analyses, we evaluate how microclimate and leaf temperatures, traits, and gas exchange vary vertically in forests, shaping tree, and ecosystem ecology. In closed-canopy forests, upper canopy leaves are exposed to the highest solar radiation and evaporative demand, which can elevate leaf temperature (Tleaf ), particularly when transpirational cooling is curtailed by limited stomatal conductance. However, foliar traits also vary across height or light gradients, partially mitigating and protecting against the elevation of upper canopy Tleaf . Leaf metabolism generally increases with height across the vertical gradient, yet differences in thermal sensitivity across the gradient appear modest. Scaling from leaves to trees, canopy trees have higher absolute metabolic capacity and growth, yet are more vulnerable to drought and damaging Tleaf than their smaller counterparts, particularly under climate change. By contrast, understory trees experience fewer extreme high Tleaf 's but have fewer cooling mechanisms and thus may be strongly impacted by warming under some conditions, particularly when exposed to a harsher microenvironment through canopy disturbance. As the climate changes, integrating the patterns and mechanisms reviewed here into models will be critical to forecasting forest-climate feedback.

BACKGROUND AND AIMS: Our understanding of plant responses to biotic and abiotic drivers is largely based on above-ground plant traits, with little focus on below-ground traits despite their key role in water and nutrient uptake. Here, we aimed to understand the extent to which above- and below-ground traits are co-ordinated, and how these traits respond to soil moisture gradients and plant intraspecific competition. METHODS: We chose seedlings of five tropical tree species and grew them in a greenhouse for 16 weeks under a soil moisture gradient [low (drought), medium and high (well-watered) moisture levels] with and without intraspecific competition. At harvest, we measured nine above- and five below-ground traits of all seedlings based on standard protocols. KEY RESULTS: In response to the soil moisture gradient, above-ground traits are found to be consistent with the leaf economics spectrum, whereas below-ground traits are inconsistent with the root economics spectrum. We found high specific leaf area and total leaf area in well-watered conditions, while high leaf dry matter content, leaf thickness and stem dry matter content were observed in drought conditions. However, below-ground traits showed contrasting patterns, with high specific root length but low root branching index in the low water treatment. The correlations between above- and below-ground traits across the soil moisture gradient were variable, i.e. specific leaf area was positively correlated with specific root length, while it was negatively correlated with root average diameter across moisture levels. However, leaf dry matter content was unexpectedly positively correlated with both specific root length and root branching index. Intraspecific competition has influenced both above- and below-ground traits, but interacted with soil moisture to affect only below-ground traits. Consistent with functional equilibrium theory, more biomass was allocated to roots under drought conditions, and to leaves under sufficient soil moisture conditions. CONCLUSIONS: Our results indicate that the response of below-ground traits to plant intraspecific competition and soil moisture conditions may not be inferred using above-ground traits, suggesting that multiple resource use axes are needed to understand plant ecological strategies. Lack of consistent leaf-root trait correlations across the soil moisture gradient highlight the multidimensionality of plant trait relationships which needs more exploration.

Growth suppression and defence signalling are simultaneous strategies that plants invoke to respond to abiotic stress. Here, we show that the drought stress response of poplar trees (Populus trichocarpa) is initiated by a suppression in cell wall derived methanol (MeOH) emissions and activation of acetic acid (AA) fermentation defences. Temperature sensitive emissions dominated by MeOH (AA/MeOH

Photosynthesis under oblique illumination has not been studied extensively despite being the prevailing light regime under natural conditions. We studied how photosynthetic rate (An) is affected by the geometrical arrangement between leaf lamina and light rays, in conjunction with key anatomical features; studied plant species selected based on the absence (homobaric) or the occurrence of bundle sheath extensions (BSEs; heterobaric) and the arrangement of these structures, that is, parallel (monocots) or reticulated (dicots). The direction of light ray affected leaf absorptance (Abs) and An; both were maximal when the angle of incidence of light on leaf surface (polar angle, θ) was 90°. For any lower θ, both Abs and An were higher when the angle between the leaf axis and the light rays (azimuthal angle, φ) was zero. The dependence of Abs and An from φ was only evident in monocots and, especially, in heterobaric compared to homobaric leaves. In some species, An was substantially higher than predicted from calculated photon flux density of oblique light. The occurrence of BSEs, especially in monocots, significantly alters leaf optical properties, resulting in more efficient photosynthesis under oblique illumination conditions. Summary statement: Plant leaves harvest light for photosynthesis, usually, in a non‐perpendicular position related to the sun. Leaf anatomy increases light use efficiency under these conditions so that the rate of photosynthesis recorded is often much higher than predicted by optical geometry. [ABSTRACT FROM AUTHOR]

Fabricating three-dimensional (3D) scaffolds is attractive due to various advantages for tissue engineering, such as cell migration, proliferation, and adhesion. Since cell growth depends on transmitting nutrients and cell residues, naturally vascularized scaffolds are superior for tissue engineering. Vascular passages help the inflow and outflow of liquids, nutrients, and waste disposal from the scaffold and cell growth. Porous scaffolds can be prepared by plant tissue decellularization which allows for the cultivation of various cell lines depending on the intended application. To this end, researchers decellularize plant tissues by specific chemical and physical methods. Researchers use plant parts depending on their needs, for example, decellularizing the leaves, stems, and fruits. Plant tissue scaffolds are advantageous for regenerative medicine, wound healing, and bioprinting. Studies have examined various plants such as vegetables and fruits such as orchid, parsley, spinach, celery, carrot, and apple using various materials and techniques such as sodium dodecyl sulfate, Triton X-100, peracetic acid, deoxyribonuclease, and ribonuclease with varying percentages, as well as mechanical and physical techniques like freeze-thaw cycles. The process of data selection, retrieval, and extraction in this review relied on scholarly journal publications and other relevant papers related to the subject of decellularization, with a specific emphasis on plant-based research. The obtained results indicate that, owing to the cellulosic structure and vascular nature of the decellularized plants and their favorable hydrophilic and biological properties, they have the potential to serve as biological materials and natural scaffolds for the development of 3D-printing inks and scaffolds for tissue engineering. [ABSTRACT FROM AUTHOR]

Introduction Many people remove the tobacco leaf from cigars and replace it with cannabis (ie, blunts), but few studies have examined whether messages about the risks of cigars, like warnings on cigar packages, can affect blunt use. Methods Participants were 438 U.S. adults who reported past 30-day cigar use and ever blunt use, recruited from a probability-based national panel to take an online survey. In a 2 × 2 experiment with a between-subjects design, we manipulated two cigar warning characteristics: (1) warning type: text-only versus pictorial (ie, text + image) and (2) warning size: 30% (smaller) versus 50% (larger) of the product package. Participants then viewed six different warnings on a fictious cigarillo package, within their randomly assigned condition. After evaluating all stimuli, participants were asked the extent to which the warnings discouraged them from wanting to use cigars to smoke cannabis (ie, blunt perceived warning effectiveness). Response options ranged from "not at all" (1) to "a great deal" (5). Results We observed no main effects of warning type or size on blunt perceived warning effectiveness. However, a significant interaction existed between the two experimental manipulations (p =.009). Whereas adding images made no difference to blunt perceived warning effectiveness when warnings were smaller (simple effect: −0.22, p =.28), images mattered for larger warnings. Specifically, adding images increased blunt perceived warning effectiveness when warnings were 50% of the product package (simple effect: 0.52, p =.008). Conclusions This experiment provides preliminary evidence that larger pictorial cigar warnings may discourage blunt use relative to larger but text-only warnings. Implications Blunts, which are hollowed out cigars with tobacco leaf wrappers that are filled with cannabis leaf, are one of the most common ways in which tobacco and cannabis are used simultaneously, yet few studies have examined whether messages about the risks of cigars can affect blunt use. We conducted an online experiment concerning the perceived effectiveness of cigar warnings among people who use blunts recruited from a probability-based panel. Results provide novel, preliminary evidence that larger pictorial cigar warnings may discourage blunt use, relative to larger but text-only warnings. More research evaluating cigar warnings on blunt use is needed. [ABSTRACT FROM AUTHOR]

Fungi play a pivotal role in fermentation processes, influencing the breakdown and transformation of metabolites. However, studies focusing on the effects of fungal-metabolite correlations on leaf fermentation quality enhancement are limited. This study investigated specific metabolites and fungi associated with high- and low-quality fermented plant leaves. Their changes were monitored over fermentation periods of 0, 8, 16, and 24 days. The results indicated that organoheterocyclic compounds, lipids, lipid-like molecules, organic nitrogen compounds, phenylpropanoids, and polyketides were predominant in highquality samples. The fungi Saccharomyces (14.8%) and Thermoascus (4.6%) were predominantly found in these samples. These markers exhibited significant changes during the 24-day fermentation period. The critical influence of fungal community equilibrium was demonstrated by interspecies interactions (e.g., between Saccharomyces and Eurotium). A co-occurrence network analysis identified Saccharomyces as the primary contributor to highquality samples. These markers collectively enhance the quality and sensory characteristics of the final product. [ABSTRACT FROM AUTHOR]

Contact electrification has attracted interest as a mechanism for generating electrical charges on surfaces. To explore the factors contributing to electrification by droplets impacting the leaf surface, high-speed image capture and current measurements were used to quantitatively characterize the electrical response under different droplet parameters and leaf surface conditions. Upon impact and rebound from the leaf surface, neutral droplets acquire a positive charge. While this electrification phenomenon has been observed previously, there has been limited understanding of the parameters influencing the extent of droplet charging. In this study, we examine the effects of four parameters (droplet size, impact velocity, droplet ion concentration, and various leaf surfaces) on the electrical response signal. The results indicate that this electrification phenomenon is contingent upon the droplet–leaf contact area and droplet ion concentration. We propose a theoretical model based on the electric double layer to elucidate the electrification process. [ABSTRACT FROM AUTHOR]