Search

The red and far-red light photoreceptor phytochrome B (phyB) transmits light signals following cytosol-to-nuclear translocation to regulate transcriptional networks therein. This necessitates changes in protein-protein interactions of phyB in the cytosol, about which little is presently known. Via introduction of a nucleus-excluding G767R mutation into the dominant, constitutively active phyBY276H (YHB) allele, we explore the functional consequences of expressing a cytosol-localized YHBG767R variant in transgenic Arabidopsis seedlings. We show that YHBG767R elicits selective constitutive photomorphogenic phenotypes in dark-grown phyABCDE null mutants, wild type and other phy-deficient genotypes. These responses include light-independent apical hook opening, cotyledon unfolding, seed germination and agravitropic hypocotyl growth with minimal suppression of hypocotyl elongation. Such phenotypes correlate with reduced PIF3 levels, which implicates cytosolic targeting of PIF3 turnover or PIF3 translational inhibition by YHBG767R. However, as expected for a cytoplasm-tethered phyB, YHBG767R elicits reduced light-mediated signaling activity compared with similarly expressed wild-type phyB in phyABCDE mutant backgrounds. YHBG767R also interferes with wild-type phyB light signaling, presumably by formation of cytosol-retained and/or otherwise inactivated heterodimers. Our results suggest that cytosolic interactions with PIFs play an important role in phyB signaling even under physiological conditions.

Mycena s.s. is a ubiquitous mushroom genus whose members degrade multiple dead plant substrates and opportunistically invade living plant roots. Having sequenced the nuclear genomes of 24 Mycena species, we find them to defy the expected patterns for fungi based on both their traditionally perceived saprotrophic ecology and substrate specializations. Mycena displayed massive genome expansions overall affecting all gene families, driven by novel gene family emergence, gene duplications, enlarged secretomes encoding polysaccharide degradation enzymes, transposable element (TE) proliferation, and horizontal gene transfers. Mainly due to TE proliferation, Arctic Mycena species display genomes of up to 502 Mbp (2-8× the temperate Mycena), the largest among mushroom-forming Agaricomycetes, indicating a possible evolutionary convergence to genomic expansions sometimes seen in Arctic plants. Overall, Mycena show highly unusual, varied mosaic-like genomic structures adaptable to multiple lifestyles, providing genomic illustration for the growing realization that fungal niche adaptations can be far more fluid than traditionally believed.

Human milk oligosaccharides (HMOs) are a diverse class of carbohydrates which support the health and development of infants. The vast health benefits of HMOs have made them a commercial target for microbial production; however, producing the approximately 200 structurally diverse HMOs at scale has proved difficult. Here we produce a diversity of HMOs by leveraging the robust carbohydrate anabolism of plants. This diversity includes high-value and complex HMOs, such as lacto-N-fucopentaose I. HMOs produced in transgenic plants provided strong bifidogenic properties, indicating their ability to serve as a prebiotic supplement with potential applications in adult and infant health. Technoeconomic analyses demonstrate that producing HMOs in plants provides a path to the large-scale production of specific HMOs at lower prices than microbial production platforms. Our work demonstrates the promise in leveraging plants for the low-cost and sustainable production of HMOs.

Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5 and 3 regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5: GTTAACTTCA) and Syn3-10b-2 (3: GGGCCTGTGG). These promoters activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5 sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3 sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter.

Guarana (GUA) seed extract, containing caffeine (CAF) and additional bioactive compounds, may positively affect mental performance, but evidence regarding exercise is limited. This investigation assessed acute GUA ingestion compared with CAF on endurance performance. Eleven endurance-trained noncyclists and cyclists (V ˙ O 2 peak = 49.7 ± 5.9, 60.4 ± 4.6 ml·kg·min−1) completed a double-blind, crossover experiment after ingesting (a) 100 mg CAF, (b) 500 mg GUA (containing 130 mg CAF), or (c) placebo (P) prior to 60-min fixed cycling workload (FIX) + 15-min time trial. Oxygen uptake, heart rate, respiratory exchange ratio, blood glucose, and lactate were not different (p ≥.052) during FIX. A significant interaction (p =.042) for perceived exertion was observed at 50-min FIX with lower rating (p =.023) for GUA versus CAF but not compared with P. Work accumulated over 15-min time trial was greater (p =.038) for GUA versus P due to higher early (1–11 min) work outputs. Work performance favored (effect size = 0.18; 95% confidence interval [0.003, 0.355], p =.046) GUA (241.4 ± 39.9 kJ) versus P (232.1 ± 46.6 kJ), but CAF (232.3 ± 43.9) was not different from GUA (effect size = 0.19; 95% confidence interval [−0.022, 0.410], p =.079) or P. Postexercise strength loss was not attenuated with GUA (−5.6 ± 8.5%) or CAF (−8.3 ± 9.4%) versus P (−10.3 ± 5.1%). Acute GUA ingestion improved work performance relative to P, but effects were trivial to small and unrelated to altered substrate oxidation or muscular strength. Ergogenicity may involve central mechanisms reducing perceived effort with GUA (containing 130 mg caffeine). Due to issues related to identical matching of dosage, whether GUA confers additional benefits beyond its CAF content cannot be determined at present. [ABSTRACT FROM AUTHOR]

BACKGROUND: The colonization of land and the diversification of terrestrial plants is intimately linked to the evolutionary history of their symbiotic fungal partners. Extant representatives of these fungal lineages include mutualistic plant symbionts, the arbuscular mycorrhizal (AM) fungi in Glomeromycota and fine root endophytes in Endogonales (Mucoromycota), as well as fungi with saprotrophic, pathogenic and endophytic lifestyles. These fungal groups separate into three monophyletic lineages but their evolutionary relationships remain enigmatic confounding ancestral reconstructions. Their taxonomic ranks are currently fluid. RESULTS: In this study, we recognize these three monophyletic linages as phyla, and use a balanced taxon sampling and broad taxonomic representation for phylogenomic analysis that rejects a hard polytomy and resolves Glomeromycota as sister to a clade composed of Mucoromycota and Mortierellomycota. Low copy numbers of genes associated with plant cell wall degradation could not be assigned to the transition to a plant symbiotic lifestyle but appears to be an ancestral phylogenetic signal. Both plant symbiotic lineages, Glomeromycota and Endogonales, lack numerous thiamine metabolism genes but the lack of fatty acid synthesis genes is specific to AM fungi. Many genes previously thought to be missing specifically in Glomeromycota are either missing in all analyzed phyla, or in some cases, are actually present in some of the analyzed AM fungal lineages, e.g. the high affinity phosphorus transporter Pho89. CONCLUSION: Based on a broad taxon sampling of fungal genomes we present a well-supported phylogeny for AM fungi and their sister lineages. We show that among these lineages, two independent evolutionary transitions to mutualistic plant symbiosis happened in a genomic background profoundly different from that known from the emergence of ectomycorrhizal fungi in Dikarya. These results call for further reevaluation of genomic signatures associated with plant symbiosis.

QS-21 is a potent vaccine adjuvant and remains the only saponin-based adjuvant that has been clinically approved for use in humans1,2. However, owing to the complex structure of QS-21, its availability is limited. Today, the supply depends on laborious extraction from the Chilean soapbark tree or on low-yielding total chemical synthesis3,4. Here we demonstrate the complete biosynthesis of QS-21 and its precursors, as well as structural derivatives, in engineered yeast strains. The successful biosynthesis in yeast requires fine-tuning of the host's native pathway fluxes, as well as the functional and balanced expression of 38 heterologous enzymes. The required biosynthetic pathway spans seven enzyme families-a terpene synthase, P450s, nucleotide sugar synthases, glycosyltransferases, a coenzyme A ligase, acyl transferases and polyketide synthases-from six organisms, and mimics in yeast the subcellular compartmentalization of plants from the endoplasmic reticulum membrane to the cytosol. Finally, by taking advantage of the promiscuity of certain pathway enzymes, we produced structural analogues of QS-21 using this biosynthetic platform. This microbial production scheme will allow for the future establishment of a structure-activity relationship, and will thus enable the rational design of potent vaccine adjuvants.

The α-Aurora kinase is a crucial regulator of spindle microtubule organization during mitosis in plants. Here, we report a post-mitotic role for α-Aurora in reorganizing the phragmoplast microtubule array. In Arabidopsis thaliana, α-Aurora relocated from spindle poles to the phragmoplast midzone, where it interacted with the microtubule cross-linker MAP65-3. In a hypomorphic α-Aurora mutant, MAP65-3 was detected on spindle microtubules, followed by a diffuse association pattern across the phragmoplast midzone. Simultaneously, phragmoplast microtubules remained belatedly in a solid disk array before transitioning to a ring shape. Microtubules at the leading edge of the matured phragmoplast were often disengaged, accompanied by conspicuous retentions of MAP65-3 at the phragmoplast interior edge. Specifically, α-Aurora phosphorylated two residues towards the C-terminus of MAP65-3. Mutation of these residues to alanines resulted in an increased association of MAP65-3 with microtubules within the phragmoplast. Consequently, the expansion of the phragmoplast was notably slower compared to wild-type cells or cells expressing a phospho-mimetic variant of MAP65-3. Moreover, mimicking phosphorylation reinstated disrupted MAP65-3 behaviors in plants with compromised α-Aurora function. Overall, our findings reveal a mechanism in which α-Aurora facilitates cytokinesis progression through phosphorylation-dependent restriction of MAP65-3 associating with microtubules at the phragmoplast midzone.

Photobodies (PBs) are membraneless subnuclear organelles that self-assemble via concentration-dependent liquid-liquid phase separation (LLPS) of the plant photoreceptor and thermosensor phytochrome B (PHYB). The current PHYB LLPS model posits that PHYB phase separates randomly in the nucleoplasm regardless of the cellular or nuclear context. Here, we established a robust Oligopaints method in Arabidopsis to determine the positioning of individual PBs. We show surprisingly that even in PHYB overexpression lines - where PHYB condensation would be more likely to occur randomly - PBs positioned at twelve distinct subnuclear locations distinguishable by chromocenter and nucleolus landmarks, suggesting that PHYB condensation occurs nonrandomly at preferred seeding sites. Intriguingly, warm temperatures reduce PB number by inducing the disappearance of specific thermo-sensitive PBs, demonstrating that individual PBs possess different thermosensitivities. These results reveal a nonrandom PB nucleation model, which provides the framework for the biogenesis of spatially distinct individual PBs with diverse environmental sensitivities within a single plant nucleus.

Photoactivation of the plant photoreceptor and thermosensor phytochrome B (PHYB) triggers its condensation into subnuclear membraneless organelles named photobodies (PBs). However, the function of PBs in PHYB signaling remains frustratingly elusive. Here, we found that PHYB recruits PHYTOCHROME-INTERACTING FACTOR 5 (PIF5) to PBs. Surprisingly, PHYB exerts opposing roles in degrading and stabilizing PIF5. Perturbing PB size by overproducing PHYB provoked a biphasic PIF5 response: while a moderate increase in PHYB enhanced PIF5 degradation, further elevating the PHYB level stabilized PIF5 by retaining more of it in enlarged PBs. Conversely, reducing PB size by dim light, which enhanced PB dynamics and nucleoplasmic PHYB and PIF5, switched the balance towards PIF5 degradation. Together, these results reveal that PB formation spatially segregates two antagonistic PHYB signaling actions - PIF5 stabilization in PBs and PIF5 degradation in the surrounding nucleoplasm - which could enable an environmentally sensitive, counterbalancing mechanism to titrate nucleoplasmic PIF5 and environmental responses.

Plants shed organs such as leaves, petals, or fruits through the process of abscission. Monitoring cues such as age, resource availability, and biotic and abiotic stresses allow plants to abscise organs in a timely manner. How these signals are integrated into the molecular pathways that drive abscission is largely unknown. The INFLORESCENCE DEFICIENT IN ABSCISSION (IDA) gene is one of the main drivers of floral organ abscission in Arabidopsis and is known to transcriptionally respond to most abscission-regulating cues. By interrogating the IDA promoter in silico and in vitro, we identified transcription factors that could potentially modulate IDA expression. We probed the importance of ERF- and WRKY-binding sites for IDA expression during floral organ abscission, with WRKYs being of special relevance to mediate IDA up-regulation in response to biotic stress in tissues destined for separation. We further characterized WRKY57 as a positive regulator of IDA and IDA-like gene expression in abscission zones. Our findings highlight the promise of promoter element-targeted approaches to modulate the responsiveness of the IDA signaling pathway to harness controlled abscission timing for improved crop productivity.

The fundamental goal of a rare plant translocation is to create self-sustaining populations with the evolutionary resilience to persist in the long term. Yet, most plant translocation syntheses focus on a few factors influencing short-term benchmarks of success (e.g., survival and reproduction). Short-term benchmarks can be misleading when trying to infer future growth and viability because the factors that promote establishment may differ from those required for long-term persistence. We assembled a large (n = 275) and broadly representative data set of well-documented and monitored (7.9 years on average) at-risk plant translocations to identify the most important site attributes, management techniques, and species' traits for six life-cycle benchmarks and population metrics of translocation success. We used the random forest algorithm to quantify the relative importance of 29 predictor variables for each metric of success. Drivers of translocation outcomes varied across time frames and success metrics. Management techniques had the greatest relative influence on the attainment of life-cycle benchmarks and short-term population trends, whereas site attributes and species' traits were more important for population persistence and long-term trends. Specifically, large founder sizes increased the potential for reproduction and recruitment into the next generation, whereas declining habitat quality and the outplanting of species with low seed production led to increased extinction risks and a reduction in potential reproductive output in the long-term, respectively. We also detected novel interactions between some of the most important drivers, such as an increased probability of next-generation recruitment in species with greater seed production rates, but only when coupled with large founder sizes. Because most significant barriers to plant translocation success can be overcome by improving techniques or resolving site-level issues through early intervention and management, we suggest that by combining long-term monitoring with adaptive management, translocation programs can enhance the prospects of achieving long-term success.

Single-cell and single-nucleus RNA-sequencing technologies capture the expression of plant genes at an unprecedented resolution. Therefore, these technologies are gaining traction in plant molecular and developmental biology for elucidating the transcriptional changes across cell types in a specific tissue or organ, upon treatments, in response to biotic and abiotic stresses, or between genotypes. Despite the rapidly accelerating use of these technologies, collective and standardized experimental and analytical procedures to support the acquisition of high-quality data sets are still missing. In this commentary, we discuss common challenges associated with the use of single-cell transcriptomics in plants and propose general guidelines to improve reproducibility, quality, comparability, and interpretation and to make the data readily available to the community in this fast-developing field of research.

Herbal medicines are used by patients with IBD despite limited evidence. We present a systematic review and meta-analysis of randomized controlled trials (RCTs) investigating treatment with herbal medicines in active ulcerative colitis (UC). A search query designed by a library informationist was used to identify potential articles for inclusion. Articles were screened and data were extracted by at least two investigators. Outcomes of interest included clinical response, clinical remission, endoscopic response, endoscopic remission, and safety. We identified 28 RCTs for 18 herbs. In pooled analyses, when compared with placebo, clinical response rates were significantly higher for Indigo naturalis (IN) (RR 3.70, 95% CI 1.97-6.95), but not for Curcuma longa (CL) (RR 1.60, 95% CI 0.99-2.58) or Andrographis paniculata (AP) (RR 0.95, 95% CI 0.71-1.26). There was a significantly higher rate of clinical remission for CL (RR 2.58, 95% CI 1.18-5.63), but not for AP (RR 1.31, 95% CI 0.86-2.01). Higher rates of endoscopic response (RR 1.56, 95% CI 1.08-2.26) and remission (RR 19.37, 95% CI 2.71-138.42) were significant for CL. CL has evidence supporting its use as an adjuvant therapy in active UC. Research with larger scale and well-designed RCTs, manufacturing regulations, and education are needed.

Successful alien species may experience a period of quiescence, known as the lag phase, before becoming invasive and widespread. The existence of lags introduces severe uncertainty in risk analyses of aliens as the present state of species is a poor predictor of future distributions, invasion success and impact. Predicting a species' ability to invade and pose negative impacts requires a quantitative understanding of the commonality and magnitude of lags, environmental factors and mechanisms likely to terminate lag. Using herbarium and climate data, we analysed over 5,700 time series (species × regions) in 3,505 naturalized plant species from nine regions in temperate and tropical climates to quantify lags and test whether there have been shifts in the species' climatic space during the transition from the lag phase to the expansion phase. Lags were identified in 35% of the assessed invasion events. We detected phylogenetic signals for lag phases in temperate climate regions and that annual self-fertilizing species were less likely to experience lags. Where lags existed, they had an average length of 40 years and a maximum of 320 years. Lengthy lags (>100 years) were more likely to occur in perennial plants and less frequent in self-pollinating species. For 98% of the species with a lag phase, the climate spaces sampled during the lag period differed from those in the expansion phase based on the assessment of centroid shifts or degree of climate space overlap. Our results highlight the importance of functional traits for the onset of the expansion phase and suggest that climate discovery may play a role in terminating the lag phase. However, other possibilities, such as sampling issues and climate niche shifts, cannot be ruled out.

Plant-systemic neonicotinoid (NN) insecticides can exert non-target impacts on organisms like beneficial insects and soil microbes. NNs can affect plant microbiomes, but we know little about their effects on microbial communities that mediate plant-insect interactions, including nectar-inhabiting microbes (NIMs). Here we employed two approaches to assess the impacts of NN exposure on several NIM taxa. First, we assayed the in vitro effects of six NN compounds on NIM growth using plate assays. Second, we inoculated a standardised NIM community into the nectar of NN-treated canola (Brassica napus) and assessed microbial survival and growth after 24 h. With few exceptions, in vitro NN exposure tended to decrease bacterial growth metrics. However, the magnitude of the decrease and the NN concentrations at which effects were observed varied substantially across bacteria. Yeasts showed no consistent in vitro response to NNs. In nectar, we saw no effects of NN treatment on NIM community metrics. Rather, NIM abundance and diversity responded to inherent plant qualities like nectar volume. In conclusion, we found no evidence that NIMs respond to field-relevant NN levels in nectar within 24 h, but our study suggests that context, specifically assay methods, time and plant traits, is important in assaying the effects of NNs on microbial communities.

Plants with the C4 photosynthesis pathway typically respond to climate change differently from more common C3-type plants, due to their distinct anatomical and biochemical characteristics. These different responses are expected to drive changes in global C4 and C3 vegetation distributions. However, current C4 vegetation distribution models may not predict this response as they do not capture multiple interacting factors and often lack observational constraints. Here, we used global observations of plant photosynthetic pathways, satellite remote sensing, and photosynthetic optimality theory to produce an observation-constrained global map of C4 vegetation. We find that global C4 vegetation coverage decreased from 17.7% to 17.1% of the land surface during 2001 to 2019. This was the net result of a reduction in C4 natural grass cover due to elevated CO2 favoring C3-type photosynthesis, and an increase in C4 crop cover, mainly from corn (maize) expansion. Using an emergent constraint approach, we estimated that C4 vegetation contributed 19.5% of global photosynthetic carbon assimilation, a value within the range of previous estimates (18-23%) but higher than the ensemble mean of dynamic global vegetation models (14 ± 13%; mean ± one standard deviation). Our study sheds insight on the critical and underappreciated role of C4 plants in the contemporary global carbon cycle.

Chlorophyll c is a key photosynthetic pigment that has been used historically to classify eukaryotic algae. Despite its importance in global photosynthetic productivity, the pathway for its biosynthesis has remained elusive. Here we define the CHLOROPHYLL C SYNTHASE (CHLCS) discovered through investigation of a dinoflagellate mutant deficient in chlorophyll c. CHLCSs are proteins with chlorophyll a/b binding and 2-oxoglutarate-Fe(II) dioxygenase (2OGD) domains found in peridinin-containing dinoflagellates; other chlorophyll c-containing algae utilize enzymes with only the 2OGD domain or an unknown synthase to produce chlorophyll c. 2OGD-containing synthases across dinoflagellate, diatom, cryptophyte, and haptophyte lineages form a monophyletic group, 8 members of which were also shown to produce chlorophyll c. Chlorophyll c1 to c2 ratios in marine algae are dictated in part by chlorophyll c synthases. CHLCS heterologously expressed in planta results in the accumulation of chlorophyll c1 and c2, demonstrating a path to augment plant pigment composition with algal counterparts.

Soil microbiomes are highly diverse, and to improve their representation in biogeochemical models, microbial genome data can be leveraged to infer key functional traits. By integrating genome-inferred traits into a theory-based hierarchical framework, emergent behaviour arising from interactions of individual traits can be predicted. Here we combine theory-driven predictions of substrate uptake kinetics with a genome-informed trait-based dynamic energy budget model to predict emergent life-history traits and trade-offs in soil bacteria. When applied to a plant microbiome system, the model accurately predicted distinct substrate-acquisition strategies that aligned with observations, uncovering resource-dependent trade-offs between microbial growth rate and efficiency. For instance, inherently slower-growing microorganisms, favoured by organic acid exudation at later plant growth stages, exhibited enhanced carbon use efficiency (yield) without sacrificing growth rate (power). This insight has implications for retaining plant root-derived carbon in soils and highlights the power of data-driven, trait-based approaches for improving microbial representation in biogeochemical models.

BACKGROUND: Fungal plant pathogens have dynamic genomes that allow them to rapidly adapt to adverse conditions and overcome host resistance. One way by which this dynamic genome plasticity is expressed is through effector gene loss, which enables plant pathogens to overcome recognition by cognate resistance genes in the host. However, the exact nature of these loses remains elusive in many fungi. This includes the tomato pathogen Cladosporium fulvum, which is the first fungal plant pathogen from which avirulence (Avr) genes were ever cloned and in which loss of Avr genes is often reported as a means of overcoming recognition by cognate tomato Cf resistance genes. A recent near-complete reference genome assembly of C. fulvum isolate Race 5 revealed a compartmentalized genome architecture and the presence of an accessory chromosome, thereby creating a basis for studying genome plasticity in fungal plant pathogens and its impact on avirulence genes. RESULTS: Here, we obtained near-complete genome assemblies of four additional C. fulvum isolates. The genome assemblies had similar sizes (66.96 to 67.78 Mb), number of predicted genes (14,895 to 14,981), and estimated completeness (98.8 to 98.9%). Comparative analysis that included the genome of isolate Race 5 revealed high levels of synteny and colinearity, which extended to the density and distribution of repetitive elements and of repeat-induced point (RIP) mutations across homologous chromosomes. Nonetheless, structural variations, likely mediated by transposable elements and effecting the deletion of the avirulence genes Avr4E, Avr5, and Avr9, were also identified. The isolates further shared a core set of 13 chromosomes, but two accessory chromosomes were identified as well. Accessory chromosomes were significantly smaller in size, and one carried pseudogenized copies of two effector genes. Whole-genome alignments further revealed genomic islands of near-zero nucleotide diversity interspersed with islands of high nucleotide diversity that co-localized with repeat-rich regions. These regions were likely generated by RIP, which generally asymmetrically affected the genome of C. fulvum. CONCLUSIONS: Our results reveal new evolutionary aspects of the C. fulvum genome and provide new insights on the importance of genomic structural variations in overcoming host resistance in fungal plant pathogens.

The rice receptor kinase XA21 confers broad-spectrum resistance to Xanthomonas oryzae pv. oryzae (Xoo), the causal agent of rice bacterial blight disease. To investigate the relationship between the expression level of XA21 and resulting resistance, we generated independent HA-XA21 transgenic rice lines accumulating the XA21 immune receptor fused with an HA epitope tag. Whole-genome sequence analysis identified the T-DNA insertion sites in sixteen independent T0 events. Through quantification of the HA-XA21 protein and assessment of the resistance to Xoo strain PXO99 in six independent transgenic lines, we observed that XA21-mediated resistance is dose dependent. In contrast, based on the four agronomic traits quantified in these experiments, yield is unlikely to be affected by the expression level of HA-XA21. These findings extend our knowledge of XA21-mediated defense and contribute to the growing number of well-defined genomic landing pads in the rice genome that can be targeted for gene insertion without compromising yield.

Understanding the circumstances under which insect herbivores will adopt a novel host plant is a longstanding question in basic and applied ecology. While geographic variation in host use can arise through differences in both herbivore preference and plant characteristics, there is a tendency to attribute geographic variation in host use to regional differences in herbivore preference alone. This is especially true for herbivores specialized to one or a few plant species. We compared how geographic variation in herbivore preference and host plant origin shape regional differences in host plant use by the specialized herbivore, Euphydryas phaeton. In parts of its range, E. phaeton uses only a native host, Chelone glabra, while in others, it also uses an introduced host, Plantago lanceolata. We offered female butterflies from each region the non-native host plant sourced from both regions and compared their oviposition behavior. The non-native host was almost universally rejected by butterflies in the region where only the native plant is used. In the region where butterflies use both hosts, females accepted non-native plants from their natal region twice as often as non-native plants from the other region where they are not used. Acceptance differed substantially among individual butterflies within regions but not among plants within regions. Thus, both individual preference and regional differences in both the insect and non-native host contributed to the geographic variation in different ways. These results highlight that, in addition to herbivore preference, regional differences in perceived plant suitability may be an important driver of diet breadth.

Ecosystems generate a wide range of benefits for humans, including some market goods as well as other benefits that are not directly reflected in market activity1. Climate change will alter the distribution of ecosystems around the world and change the flow of these benefits2,3. However, the specific implications of ecosystem changes for human welfare remain unclear, as they depend on the nature of these changes, the value of the affected benefits and the extent to which communities rely on natural systems for their well-being4. Here we estimate country-level changes in economic production and the value of non-market ecosystem benefits resulting from climate-change-induced shifts in terrestrial vegetation cover, as projected by dynamic global vegetation models (DGVMs) driven by general circulation climate models. Our results show that the annual population-weighted mean global flow of non-market ecosystem benefits valued in the wealth accounts of the World Bank will be reduced by 9.2% in 2100 under the Shared Socioeconomic Pathway SSP2-6.0 with respect to the baseline no climate change scenario and that the global population-weighted average change in gross domestic product (GDP) by 2100 is -1.3% of the baseline GDP. Because lower-income countries are more reliant on natural capital, these GDP effects are regressive. Approximately 90% of these damages are borne by the poorest 50% of countries and regions, whereas the wealthiest 10% experience only 2% of these losses.

Plant lignocellulosic biomass, i.e. secondary cell walls of plants, is a vital alternative source for bioenergy. However, the acetylation of xylan in secondary cell walls impedes the conversion of biomass to biofuels. Previous studies have shown that REDUCED WALL ACETYLATION (RWA) proteins are directly involved in the acetylation of xylan but the regulatory mechanism of RWAs is not fully understood. In this study, we demonstrate that overexpression of a Populus trichocarpa PtRWA-C gene increases the level of xylan acetylation and increases the lignin content and S/G ratio, ultimately yielding poplar woody biomass with reduced saccharification efficiency. Furthermore, through gene coexpression network and expression quantitative trait loci (eQTL) analysis, we found that PtRWA-C was regulated not only by the secondary cell wall hierarchical regulatory network but also by an AP2 family transcription factor HARDY (HRD). Specifically, HRD activates PtRWA-C expression by directly binding to the PtRWA-C promoter, which is also the cis-eQTL for PtRWA-C. Taken together, our findings provide insights into the functional roles of PtRWA-C in xylan acetylation and consequently saccharification and shed light on synthetic biology approaches to manipulate this gene and alter cell wall properties. These findings have substantial implications for genetic engineering of woody species, which could be used as a sustainable source of biofuels, valuable biochemicals, and biomaterials.

Hybrid breeding for increased vigour has been used for over a century to boost agricultural outputs without requiring higher inputs. While this approach has led to some of the most substantial gains in crop productivity, breeding barriers have fundamentally limited soybean (Glycine max) from reaping the benefits of hybrid vigour. Soybean flowers self-pollinate prior to opening and thus are not readily amenable to outcrossing. In this study, we demonstrate that the barnase/barstar male sterility/rescue system can be used in soybean to produce hybrid seeds. By expressing the cytotoxic ribonuclease, barnase, under a tapetum-specific promoter in soybean anthers, we are able to completely block pollen maturation, creating male sterile plants. We show that fertility can be rescued in the F1 generation of these barnase-expressing lines when they are crossed with pollen from plants that express the barnase inhibitor, barstar. Importantly, we found that the successful rescue of male fertility is dependent on the relative dosage of barnase and barstar. When barnase and barstar were expressed under the same tapetum-specific promoter, the F1 offspring remained male sterile. When we expressed barstar under a relatively stronger promoter than barnase, we were able to achieve a successful rescue of male fertility in the F1 generation. This work demonstrates the successful implementation of a biotechnology approach to produce fertile hybrid offspring in soybean.

Fossilized lipids offer a rare glimpse into ancient ecosystems. 2-Methylhopanes in sedimentary rocks were once used to infer the importance of cyanobacteria as primary producers throughout geological history. However, the discovery of hopanoid C-2 methyltransferase (HpnP) in Alphaproteobacteria led to the downfall of this molecular proxy. In the present study, we re-examined the distribution of HpnP in a new phylogenetic framework including recently proposed candidate phyla and re-interpreted a revised geological record of 2-methylhopanes based on contamination-free samples. We show that HpnP was probably present in the last common ancestor of cyanobacteria, while the gene appeared in Alphaproteobacteria only around 750 million years ago (Ma). A subsequent rise of sedimentary 2-methylhopanes around 600 Ma probably reflects the expansion of Alphaproteobacteria that coincided with the rise of eukaryotic algae-possibly connected by algal dependency on microbially produced vitamin B12. Our findings re-establish 2-methylhopanes as cyanobacterial biomarkers before 750 Ma and thus as a potential tool to measure the importance of oxygenic cyanobacteria as primary producers on early Earth. Our study illustrates how genetics can improve the diagnostic value of biomarkers and refine the reconstruction of early ecosystems.

Since Bakers attempt to characterize the ideal weed over 50 years ago, ecologists have sought to identify features of species that predict invasiveness. Several of Bakers ideal weed traits are well studied, and we now understand that many traits can facilitate different components of the invasion process, such as dispersal traits promoting transport or selfing enabling establishment. However, the effects of traits on invasion are context dependent. The traits promoting invasion in one community or at one invasion stage may inhibit invasion of other communities or success at other invasion stages, and the benefits of any given trait may depend on the other traits possessed by the species. Furthermore, variation in traits among populations or species is the result of evolution. Accordingly, evolution both prior to and after invasion may determine invasion outcomes. Here, we review how our understanding of the ecology and evolution of traits in invasive plants has developed since Bakers original efforts, resulting from empirical studies and the emergence of new frameworks and ideas such as community assembly theory, functional ecology, and rapid adaptation. Looking forward, we consider how trait-based approaches might inform our understanding of less-explored aspects of invasion biology ranging from invasive species responses to climate change to coevolution of invaded communities.

Monoterpenoid indole alkaloids (MIAs) represent a large class of plant natural products with marketed pharmaceutical activities against a wide range of indications, including cancer, malaria and hypertension. Halogenated MIAs have shown improved pharmaceutical properties; however, synthesis of new-to-nature halogenated MIAs remains a challenge. Here we demonstrate a platform for de novo biosynthesis of two MIAs, serpentine and alstonine, in baker's yeast Saccharomyces cerevisiae and deploy it to systematically explore the biocatalytic potential of refactored MIA pathways for the production of halogenated MIAs. From this, we demonstrate conversion of individual haloindole derivatives to a total of 19 different new-to-nature haloserpentine and haloalstonine analogs. Furthermore, by process optimization and heterologous expression of a modified halogenase in the microbial MIA platform, we document de novo halogenation and biosynthesis of chloroalstonine. Together, this study highlights a microbial platform for enzymatic exploration and production of complex natural and new-to-nature MIAs with therapeutic potential.

The proliferation of alien species that can suppress resident species via biotic interactions represents a growing concern worldwide. Yet, how above‐ and below‐ground communities simultaneously respond to plant invasion, particularly across large spatial scales, remains poorly explored. We hypothesized plant invasion has a greater impact on recipient above‐ and below‐ground communities at lower than higher latitudes given that biotic interactions play a more significant role in shaping communities in more favourable, lower latitude environments. To test this hypothesis, we conducted a comprehensive field survey of 124 sites spanning a 1700‐km latitudinal gradient in China, to explore the effects of invasion of Alternanthera philoxeroides, a globally widespread invasive plant, on plant, soil fungal and above‐ground arthropod communities. Invasion of A. philoxeroides had divergent effects on beta diversity (i.e. variation in taxa composition among sites) of plants, above‐ground arthropods and soil saprotrophic fungi, with negative, neutral and positive responses, respectively. Notably, the compositional dissimilarity of plant and arthropod communities between adjacent invaded and non‐invaded sites remained constant across latitudes. In contrast, the compositional dissimilarity of the entire and pathogenic fungal communities between adjacent invaded and non‐invaded sites increased with latitude. This resulted in a decreasing difference in invasion effects on the composition of plant and fungal communities with increasing latitude. Synthesis. Our study provides novel insights into the complexities of invasion effects by revealing contrasting responses of above‐ and below‐ground communities to plant invasion across latitudes. The contrasting responses could weaken or reshape above‐ and below‐ground interactions, and, in turn, affect future species invasions and the functioning of terrestrial ecosystems. [ABSTRACT FROM AUTHOR]

Summary RNA‐dependent RNA Polymerases (RdRPs) synthesize double‐stranded RNA (dsRNA) from a single‐stranded RNA (ssRNA) template. In plants, dsRNAs produced by RdRPs can be further processed into small interfering RNA (siRNAs) with different lengths, ranging from 21 to 24 nucleotides (nt). These siRNAs play a pivotal role in various biological processes, including antiviral responses, transposable elements silencing, DNA methylation, and the regulation of plant reproduction and development. Recent research has reported significant progress in uncovering the molecular mechanisms of plant RNA‐DEPENDENT RNA POLYMERASE 2 (RDR2), a representative RdRP involved in the RNA‐directed DNA methylation (RdDM) pathway. These discoveries provide a molecular basis underlying the principles of RdRP function and offer insights into potential advancements in crop breeding and antiviral defense strategies. [ABSTRACT FROM AUTHOR]

Metabolomics is one of the "omics" sciences that can reveal the metabolic phenotype of organisms. This capability makes it a valuable tool for plant investigation, as plants present a vast chemical diversity. From the analytical point of view, two main techniques are frequently used in metabolomics and are often complementary: Mass spectrometry (MS) and Nuclear Magnetic Resonance (NMR) spectroscopy. Here, we describe NMR and its applications in plant metabolomics. We start by contextualizing the research field to then explore study design, sample collection, sample preparation, NMR data acquisition, and data analysis, showing the key features for achieving quality and relevant results. Within these topics, the most common databases used for plant metabolites identification and assignments are listed, as these help to shorten the laborious task of metabolomics investigation of natural products. Concerning NMR parameters, we discuss the key pulse sequences, recommend acquisition parameters, and examine the data each sequence can provide. Similarly, we delve into data analysis, highlighting the most commonly used chemometric methods and how to achieve high-quality results. Therefore, this review aims to provide a comprehensive guide for NMR-based metabolomics analysis of plants. [ABSTRACT FROM AUTHOR]

Background: Rumex vesicarius is a wild leafy plant belonging to the family Polygonaceae, renowned for its therapeutic benefits. The genus Rumex comprises approximately 150 species distributed globally. Objective: The study aimed to investigate the biological activities of R. vesicarius using in vitro and in silico methods. Methods: Rumex vesicarius was collected from the mountains in Hail and extracted with methanol. The phytochemical composition was qualitatively determined using colorimetric detection methods. Additional analyses included elemental analysis, in silico docking, antioxidant, antibacterial, and anti-biofilm properties. Results: The extract contained various classes of phytochemicals, including flavonoids, phenolics, tannins, terpenes, and saponins. Sixteen constituents were identified through molecular docking, revealing inhibition against the filamentous temperature-sensitive protein Z (FtsZ), a crucial factor in bacterial cell division. Six compounds exhibited low binding scores ranging from -8.3 to -5.0 kcal/mol, indicating efficient interaction at the active site. Elemental analysis identified 15 elements, with potassium being the most abundant, followed by calcium, aluminum, silicon, iron, phosphorus, sulfur, magnesium, titanium, strontium, zinc, manganese, bromine, and chromium. Antioxidant analysis revealed significant properties at lower concentrations compared to ascorbic acid, butylated hydroxytoluene, and b-carotene. Antibacterial analysis demonstrated inhibitory effects on Bacillus subtilis MTCC121 and Pseudomonas aeruginosa MTCC 741, with inhibition zones of 13.67 ± 1.0 mm and 11.50 ± 1.0 mm, respectively. The MIC and MBC values ranged from 250 to 500 mg/mL. R. vesicarius also exhibited anti-biofilm activity. Conclusion: Wild-grown R. vesicarius from the mountains of Hail is rich in bioactive phytochemicals and essential minerals, exhibiting notable antioxidant and antibacterial properties. [ABSTRACT FROM AUTHOR]

The widely observed negative scaling relationship between organism size and abundance is predicted to have a universal −0.75 scaling exponent across all life forms. However, factors influencing frequently observed deviations from this exponent, such as ecosystem succession and organism traits, remain poorly understood. We explore the dependence of size–density scaling on ecosystem succession and organism traits by analysing size–density relationships in trees and soil invertebrates across 183 temperate forest plots comprising urban secondary forests, urban old‐growth forests and non‐urban natural forests. Exponents of scaling relationships in urban tree and invertebrate communities progressively steepened with increasing restored (planted) forest stand age as small organisms increased in abundance. In contrast, non‐urban tree scaling relationships flattened during succession with exponents veering away from −0.75, whereas urban tree and invertebrate communities converged towards this prediction in later successional stages. Our results shed light on how the body size structure of tree and soil invertebrate communities spanning multiple trophic levels shift over successional time as the relative abundances of large versus small‐bodied organisms increase. This study emphasises the fundamental influence of organismal traits and ecosystem succession on scaling relationships of organism body size and abundance. Read the free Plain Language Summary for this article on the Journal blog. [ABSTRACT FROM AUTHOR]

This study discusses the essential need of re-naturalizing the built environment, focusing on schools. Leveraging research on the impact of nature on health, children's development, and learning, we analyze case studies from America, Asia, and Europe with distinct trajectories of interplay between architecture and pedagogy. Using a theoretical framework on plant-architecture relationship, we identify effective re-naturalization solutions in some applications of biophilic design in rural and urban contexts, cautioning against superficial nature incorporations in schools. Our study asserts that technological sustainability is needed but insufficient, emphasizing the necessity of concurrent efforts in architecture and education to create meaningful student-nature connections. [ABSTRACT FROM AUTHOR]

Cancer refers to the proliferation and multiplication of aberrant cells inside the human body, characterized by their capacity to proliferate and infiltrate various anatomical regions. Numerous biochemical pathways and signaling molecules have an impact on the cancer auto biogenesis process. The regulation of crucial cellular processes necessary for cell survival and proliferation, which are triggered by phytochemicals, is significantly influenced by signaling pathways. These pathways or components are regulated by phytochemicals. Medicinal plants are a significant reservoir of diverse anticancer medications employed in chemotherapy. The anticancer effects of phytochemicals are mediated by several methods, including induction of apoptosis, cessation of the cell cycle, inhibition of kinases, and prevention of carcinogenic substances. This paper analyzes the phytochemistry of seven prominent plant constituents, namely, alkaloids, tannins, flavonoids, phenols, steroids, terpenoids, and saponins, focusing on the involvement of the MAPK/ERK pathway, TNF signaling, death receptors, p53, p38, and actin dynamics. Hence, this review has examined a range of phytochemicals, encompassing their structural characteristics and potential anticancer mechanisms. It has underscored the significance of plant-derived bioactive compounds in the prevention of cancer, utilizing diverse molecular pathways. In addition, this endeavor also seeks to incentivize scientists to carry out clinical trials on anticancer medications derived from plants. [ABSTRACT FROM AUTHOR]

Sterols play important structural and regulatory roles in numerous intracellular processes. Unlike animals, plants contain a distinctive and diverse variety of sterols. Recently, information has emerged showing that stigmasterol is a "stress sterol". Stigmasterol is synthesized via the mevalonate biosynthesis pathway and has structural similarity to β-sitosterol but differs in the presence of a trans-oriented double bond in the side chain. In plants, the accumulation of stigmasterol has been observed in response to various stresses. However, the precise ways that stigmasterol is involved in the stress responses of plants remain unclear. This comprehensive review provides an update on the biology of stigmasterol, particularly the physicochemical properties of this ethylsterol, its biosynthesis, and its occurrence in higher plants and extremophilic organisms, e.g., mosses and lichens. Special emphasis is given to the evolutionary aspects of stigmasterol biosynthesis, particularly the variations in the gene structure of C22-sterol desaturase, which catalyzes the formation of stigmasterol from β-sitosterol, in a diversity of evolutionarily distant organisms. The roles of stigmasterol in the tolerance of plants to hostile environments and the prospects for its biomedical applications are also discussed. Taken together, the available data suggest that stigmasterol plays important roles in plant metabolism, although in some aspects, it remains an enigmatic compound. [ABSTRACT FROM AUTHOR]

The present study was aimed at assessing the impact of azoxystrobin—a fungicide commonly used in plant protection against pathogens (Amistar 250 SC)—on the soil microbiota and enzymes, as well as plant growth and development. The laboratory experiment was conducted in three analytical terms (30, 60, and 90 days) on sandy clay (pH—7.0). Azoxystrobin was applied to soil in doses of 0.00 (C), 0.110 (F) and 32.92 (P) mg kg−1 d.m. of soil. Its 0.110 mg kg−1 dose stimulated the proliferation of organotrophic bacteria and actinobacteria but inhibited that of fungi. It also contributed to an increase in the colony development index (CD) and a decrease in the ecophysiological diversity index (EP) of all analyzed groups of microorganisms. Azoxystrobin applied at 32.92 mg kg−1 reduced the number and EP of microorganisms and increased their CD. PP952051.1 Bacillus mycoides strain (P), PP952052.1 Prestia megaterium strain (P) bacteria, as well as PP952052.1 Kreatinophyton terreum isolate (P) fungi were identified in the soil contaminated with azoxystrobin, all of which may exhibit resistance to its effects. The azoxystrobin dose of 0.110 mg kg−1 stimulated the activity of all enzymes, whereas its 32.92 mg kg−1 dose inhibited activities of dehydrogenases, alkaline phosphatase, acid phosphatase, and urease and stimulated the activity of catalase. The analyzed fungicide added to the soil at both 0.110 and 32.92 mg kg−1 doses inhibited seed germination and elongation of shoots of Lepidium sativum L., Sinapsis alba L., and Sorgum saccharatum L. [ABSTRACT FROM AUTHOR]

Deserts are subject to significant anthropogenic pressure. The capacity to buffer against changes in the local environment and biodiversity are critical for ecosystem functioning. Foundation species can be a solution to rapidly assess ecological function and provide a simple nature‐based solution to protect against continuing biodiversity losses. A foundation species is defined as a species that exerts and promotes a positive set of processes for the biotic network. Two different shrub species in the central drylands of California were used to assay a potential buffer for plant species richness and to examine the species‐specificity of foundation facilitation. A five‐year dataset in two distinct regions differing in aridity was used to test the hypothesis that the direct effects of foundation plants facilitate other plant species and buffer diversity losses to a changing climate. The predicted positive effects of both shrub species on species richness increased with increasing local temperatures sampled. Finally, projected temperature increases for the region in trained Bayesian models demonstrated that both shrub species can profoundly increase in their capacity to facilitate plant species richness. Colloquially, this positive ecological effect can be described as the patronus charm hypothesis because regardless of the form of the protector, shrub species provided a talisman against local loss of richness driven by temperature increases. [ABSTRACT FROM AUTHOR]

The paper reports the effects of organic fertilisers on the photosynthetic characteristics and growth of soybean plants. The photosynthetic parameters were performed through gas exchange analysis by chlorophyll a fluorescence emission, in three phenological stages of culture. Photosynthetic activity, liquid CO₂ assimilation rates, stomatal conductance and water use efficiency were favoured by the addition of organic fertilisers to the soil. The addition of organic fertilisers reduced the initial chlorophyll a fluorescence, increased the electron transport rate, the internal CO₂ concentration, the potential efficiency of photosystem (II) and the effective quantum efficiency of photosystem (II) in soybean plants. [ABSTRACT FROM AUTHOR]

Summary As a non‐collinear expression form of genetic information, chimeric RNAs increase the complexity of transcriptome in diverse organisms. Although chimeric RNAs have been identified in plants, few common features have been revealed. Here, we systemically explored the landscape of chimeric RNAs across multi‐accession and multi‐tissue using pan‐genome and transcriptome data of four plants: rice, maize, soybean, and Arabidopsis. Among the four species, conserved characteristics of breakpoints and parental genes were discovered. In each species, chimeric RNAs displayed a high level of diversity among accessions, and the clustering of accessions using chimeric events was generally concordant with clustering based on genomic variants, implying a general relationship between genetic variations and chimeric RNAs. Through mass spectrometry, we confirmed a fusion protein OsNDC1‐OsGID1L2 and observed its subcellular localization, which differed from the original proteins. Phenotypic cues in transgenic rice suggest the potential functions of OsNDC1‐OsGID1L2. Moreover, an intriguing chimeric event Os01g0216500–Os01g0216900, generated by a large deletion in basmati rice, also exists in another accession without the deletion, demonstrating its convergence in evolution. Our results illuminate the characteristics and hint at the evolutionary implications of plant chimeric RNAs, which serve as a supplement to genetic variations, thus expanding our understanding of genetic diversity. [ABSTRACT FROM AUTHOR]

Arsenic (As) is one of the most important water pollutant of global concern due to its extreme hazard. In the present study, B. subtilis synthesized iron oxide nanoparticles (Fe3O4 NPs) were used for mitigation of harmful metalloid As from the aqueous solution. Initially, the arsenic removal efficiency was tested in a batch culture experiment across various concentrations (5, 10 and 15 ppm) of B. subtilis synthesized Fe3O4 NPs at different pH, time interval and agitation speed. Optimal removal efficiency of As by using B. subtilis synthesized Fe3O4 NPs was observed at pH 7, after 80 min, and with agitation at 200 rpm. Additionally, hydroponic culture experiment was designed to assess B. subtilis synthesized Fe3O4 NPs efficiency in removal of As from As-contaminated water used to irrigate rice plants. Results revealed that B. subtilis synthesized Fe3O4 NPs effectively removed As from the contiminated water and reduced its uptake by the different parts of rice plants (root, shoot and leaf). Furthermore, these B. subtilis synthesized Fe3O4 NPs also reduced the bioaccumulation and enhanced plant tolerance to As, suggesting their potential in mitigating heavy metal toxicity, especially As and promoting plant growth. Thus, this study proposes B. subtilis synthesized Fe3O4 NPs as nano-adsorbents in reducing arsenic toxicity in rice plants. [ABSTRACT FROM AUTHOR]

Formulating a nanoemulsion (NE) of essential oil (EO) could enhance its efficiency while requiring lower concentrations. Eucalyptus cladocalyx F. Muell EO was rich in monoterpenes hydrocarbons. NE was prepared and the effect of surfactant (Tween 20, 40 and 80) and shearing time were investigated. The results showed that the best NE was formed using Tween 80 after 25 min of emulsification. Small droplet size (40 nm), low polydispersity index PDI (0.49), and stable zeta potential highlighted the excellent NE stability which was tested under storage conditions for 4 months. The results showed that the antioxidant and anticancer activities of NE were enhanced compared to free EO. Furthermore, NE and EO exhibited high anti-inflammatory effects by inhibiting nitric oxide (NO), Interleukin 6 (IL-6), and tumor necrosis factors alpha (TNF-α) production in liposaccharides (LPS)-induced RAW264.7 cells. In conclusion, a stable Eucalyptus cladocalyx-NE was produced, with improved biological activities. [ABSTRACT FROM AUTHOR]

Plant protein components contribute positively to human well-being as they modulate the immune status of a consumer, especially when the enzymatic method is employed in order to release their bioactive peptides. These peptides are derived from plant-based foods such as soy, wheat, barley, rye, oats, rice, corn, sorghum, and millet, the famous staple foods around the world. Since these peptides are crucial to functional food among other key industries, the present study endeavored to scout for relevant information within the past three decades, using the Web of Science, Scopus, and Google search engines. In this review, first, the core of immunomodulation and types of immunomodulatory agents will be discussed, followed by the production of plant-based immunomodulatory peptides and their immunomodulatory mechanisms in cells, animals, and humans are also studied. Finally, applications and challenges associated with plant-based immunomodulatory peptides are put forward. [ABSTRACT FROM AUTHOR]