Search

Objective: Elevated triglyceride (TG) is the major plasma lipid abnormality in obese and diabetic patients and contributes to cardiovascular morbidity in these disorders. We sought to identify novel mechanisms leading to hypertriglyceridemia. Resistance to negative feedback signals from adipose tissue in key central nervous system (CNS) energy homeostatic circuits contributes to the development of obesity. Because triglycerides both represent the largest energy depot in the body and are elevated in both the plasma and adipose in obesity and diabetes, we hypothesized that the same neural circuits that regulate energy balance also regulate the secretion of TGs into plasma., Research Design and Methods: In normal fasting rats, the TG secretion rate was estimated by serial blood sampling after intravascular tyloxapol pretreatment. Neuropeptide Y (NPY) signaling in the CNS was modulated by intracerebroventricular injection of NPY, receptor antagonist, and receptor agonist., Results: A single intracerebroventricular injection of NPY increased TG secretion by 2.5-fold in the absence of food intake, and this was determined to be VLDL by fast performance liquid chromatography (FPLC). This effect was recapitulated by activating NPY signaling in downstream neurons with an NPY-Y5 receptor agonist. An NPY-Y1 receptor antagonist decreased the elevated TGs in the form of VLDL secretion rate by 50% compared with vehicle. Increased TG secretion was due to increased secretion of VLDL particles, rather than secretion of larger particles, because apolipoprotein B100 was elevated in FPLC fractions corresponding to VLDL., Conclusions: We find that a key neuropeptide system involved in energy homeostasis in the CNS exerts control over VLDL-TG secretion into the bloodstream.

Glucose phosphorylation, catalyzed by hexokinase, is the first committed step in glucose uptake in skeletal muscle. Hexokinase II (HKII) is the isoform that is present in muscle and is regulated by insulin and muscle contraction. Glucose phosphorylation and HKII expression are both reduced in obese and type 2 diabetic subjects. A single bout of exercise increases HKII mRNA and activity in muscle from healthy subjects. The present study was performed to determine if a moderate exercise increases HKII mRNA expression and activity in patients with type 2 diabetes. Muscle biopsies were performed before and 3 hours after a single bout of cycle ergometer exercise in obese and type 2 diabetic patients. HKII mRNA and activity and glycogen synthase activity were determined in the muscle biopsies. Exercise increased HKII mRNA in obese and diabetic subjects by 1.67 +/- 0.34 and 1.87 +/- 0.26-fold, respectively (P <.05 for both). Exercise did not significantly increase HKI mRNA. When HKII mRNA increases were compared with the 2.26 +/- 0.36-fold increase in HKII mRNA previously reported for healthy lean subjects, no statistically significant differences were found. In contrast to the increase in HKII activity observed after exercise by lean healthy controls, exercise did not increase HKII activity in obese nondiabetic or diabetic subjects. Exercise increased glycogen synthase activity (GS(0.1) and GS(FV)) significantly in both obese nondiabetic and type 2 diabetic patients. The present results indicate that there is a posttranscriptional defect in the response of HKII expression to exercise in obese and type 2 diabetic subjects. This defect may contribute to reduced HKII activity and glucose uptake in these patients., (Copyright 2001 by W.B. Saunders Company)

Expression of the hexokinase (HK) II gene in skeletal muscle is upregulated by electrically stimulated muscle contraction and moderate-intensity exercise. However, the molecular mechanism by which this occurs is unknown. Alterations in intracellular Ca(2+) homeostasis accompany contraction and regulate gene expression in contracting skeletal muscle. Therefore, as a first step in understanding the exercise-induced increase in HK II, the ability of Ca(2+) to increase HK II mRNA was investigated in cultured skeletal muscle cells, namely L6 myotubes. Exposure of cells to the ionophore A-23187 resulted in an approximately threefold increase in HK II mRNA. Treatment of cells with the extracellular Ca(2+) chelator EGTA did not alter HK II mRNA, nor was it able to prevent the A-23187-induced increase. Treatment of cells with the intracellular Ca(2+) chelator 1,2-bis(o-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid tetra(acetoxymethyl) ester (BAPTA-AM) also resulted in an approximately threefold increase in HK II mRNA in the absence of ionophore, which was similar to the increase in HK II mRNA induced by the combination of BAPTA-AM and A-23187. In summary, a rise in intracellular Ca(2+) is not necessary for the A-23187-induced increase in HK II mRNA, and increases in HK II mRNA occur in response to treatments that decrease intracellular Ca(2+) stores. Depletion of intracellular Ca(2+) stores may be one mechanism by which muscle contraction increases HK II mRNA.

NF-YA, B, and C comprise the heterotrimeric transcription factor known as nuclear factor Y (NF-Y) or CCAAT-binding protein (CBF). NF-Y binds many CCAAT and Y box (an inverted CCAAT box, ATTGG) elements. Mutations of these elements that disrupt the binding of NF-Y result in decreased transcription from various tissue-specific and inducible promoters. We employed a yeast two-hybrid system to screen a human liver cDNA library in an effort to isolate proteins that interact with NF-Y and that may play a role in tissue-specific or hormone-inducible promoter activity. Using a fragment of the NF-YA subunit as bait we isolated a cDNA that encodes most of the open reading frame of the human zinc fingers and homeobox 1 (ZHX1) protein. The complete open reading frame was subsequently isolated and found to encode a protein of 873 amino acids that contains two zinc fingers and five homeodomain motifs. Northern blot analysis of poly(A)(+) RNA isolated from various tissues revealed two major ZHX1 transcripts of about 4.5 and 5 kilobases. Both transcripts were expressed ubiquitously, although the 5-kilobase transcript is of greater abundance in most tissues examined. The human ZHX1 gene is located on chromosome 8q, between markers CHCL.GATA50B06 and CHLC. GATA7G07., (Copyright 1999 Academic Press.)

A single bout of exercise increases the rate of insulin-stimulated glucose uptake and metabolism in skeletal muscle. Exercise also increases insulin-stimulated glucose 6-phosphate in skeletal muscle, suggesting that exercise increases hexokinase activity. Within 3 h, exercise increases hexokinase II (HK II) mRNA and activity in skeletal muscle from rats. It is not known, however, if a single bout of moderate-intensity exercise increases HK II expression in humans. The present study was undertaken to answer this question. Six subjects had percutaneous biopsies of the vastus lateralis muscle before and 3 h after a single 3-h session of moderate-intensity aerobic (60% of maximal oxygen consumption) exercise. Glycogen synthase, HK I, and HK II activities as well as HK I and HK II mRNA content were determined from the muscle biopsy specimens. The fractional velocity of glycogen synthase was increased by 446 +/- 84% after exercise (P < 0.005). Hexokinase II activity in the soluble fraction of the homogenates increased from 1.2 +/- 0.4 to 4.5 +/- 1.6 pmol.min-1.microgram-1 (P < 0.05) but was unchanged in the particulate fraction (4.3 +/- 1.3 vs. 5.3 +/- 1.5). HK I activity in neither the soluble nor particulate fraction changed after exercise. Relative to a 28S rRNA control signal, HK II mRNA increased from 0.091 +/- 0.02 to 0.195 +/- 0.037 (P < 0.05), whereas HK I mRNA was unchanged (0.414 +/- 0.061 vs. 0.498 +/- 0.134, P < 0.20). The increase in HK II activity after moderate exercise in healthy subjects could be one factor responsible for the enhanced rate of insulin-stimulated glucose uptake seen after exercise.

The phosphorylation of glucose to glucose-6-phosphate, catalyzed by hexokinase, is the first committed step in glucose uptake into skeletal muscle. Two isoforms of hexokinase, HKI and HKII, are expressed in human skeletal muscle, but only HKII expression is regulated by insulin. HKII messenger RNA, protein, and activity are increased after 4 h of insulin infusion; however, glucose uptake is stimulated much more rapidly, occurring within minutes. Studies in rat muscle suggest that changes in the subcellular distribution of HKII may be an important regulatory factor for glucose uptake. The present studies were undertaken to determine if insulin causes an acute redistribution of HKII activity in human skeletal muscle in vivo. Muscle biopsies (vastus lateralis muscle) were performed before and at the end of 30 min insulin infusion, performed using the euglycemic clamp technique. Muscle biopsies were subfractionated into soluble and particulate fractions to determine if insulin acutely changes the subcellular distribution of HKII. Insulin decreased HKII activity in the soluble fraction from 2.20 +/- 0.31 to 1.40 +/- 0.18 pmoles/(min[chempt]micrograms) and increased HKII activity in the particulate fraction from 3.02 +/- 0.46 to 3.45 +/- 0.46 pmoles/(min[chempt]micrograms) (P < 0.01 for both). These changes in HKII activity were correlated with changes in HKII protein, as determined by immunoblot analysis (r = 0.53, P = 0.05). Insulin had no effect on the subcellular distribution of HKII activity, which was primarily restricted to the soluble fraction. These studies are consistent with the conclusion that, in vivo in human skeletal muscle, insulin changes the subcellular distribution of HKII within 30 min.

Hexokinase II, one member of a family of structurally similar enzymes that catalyze the phosphorylation of glucose in the 6-position, has been suggested to play a role in the pathophysiology of noninsulin-dependent diabetes mellitus (NIDDM). The gene for hexokinase II, HK2, has been previously mapped to human chromosome 2p13 by fluorescence in situ hybridization, and two-point linkage analysis has placed it near the locus for transforming growth factor alpha, TGFA. We now report the characterization of a (TA)n polymorphism in intron 12 of HK2. Using multipoint analysis of CEPH family genotypes, we have determined the most likely locus order to be cen-D2S169-[D2S286-HK2]-[D2S145-D2S291]-[+ ++D2S45-D2S101-TGFA]-tel. As HKII is a candidate gene that could contribute to the manifestation of insulin resistance and NIDDM, we genotyped 1152 Pima Indians, a Native American tribe that has the highest reported prevalence of NIDDM in the world. Although we did not detect any linkage or association of HK2 with insulin resistance or NIDDM in the Pima Indians, the polymorphism and detailed mapping of HK2 described in this report should prove useful in the assessment of the role of this gene in the predisposition to NIDDM in other populations.

Phosphoenolpyruvate carboxykinase (PEPCK) catalyses the rate limiting step in hepatic and renal gluconeogenesis. Glucagon (acting via cyclic AMP (cAMP)) and glucocorticoids stimulate PEPCK gene transcription, whereas insulin has the opposite effect. Since these are the major regulatory hormones controlling glucose homeostasis, and because increased hepatic glucose production is one of the characteristics of non-insulin dependent diabetes mellitus (NIDDM), investigators have speculated that the regulation of PEPCK gene expression may be defective in patients with NIDDM. To begin to investigate this possibility we have isolated and sequenced the human PEPCK gene promoter. In addition, we have constructed and analyzed a human PEPCK promoter-chloramphenicol acetyltransferase (CAT) fusion gene in an effort to correlate differences between the rat and human promoter sequences and the hormonal regulation of transcription.

A DNA segment that is highly conserved in glucokinase (hexokinase IV) and hexokinase I cDNA was used to identify specific cDNAs in a library prepared from rat adipose tissue mRNA. Some of these cDNAs were identified as being hexokinase I cDNA. Others, although similar to both the glucokinase and hexokinase I cDNAs, were unique. Two of these unique cDNAs overlapped and contained an open reading frame that encoded a protein of 103 kDa which, when expressed in Escherichia coli, had kinetic properties characteristic of hexokinase II. The entire hexokinase II mRNA sequence and the exon-intron structure of the hexokinase II gene were determined. A single transcription initiation site and two distinct termination sites account for the two observed hexokinase II RNA species of 5500 and 4400 nucleotides that were detected when either of the cDNAs was used as a hybridization probe against poly(A)+ RNA isolated from rat adipose tissue. Hexokinase II mRNA was decreased in adipose tissue from diabetic rats, but was restored by insulin treatment to levels found in nondiabetic control rats. Insulin also induced hexokinase II mRNA in two adipose cell lines (3T3-F442A and BFC-1B) and two skeletal muscle cell lines (C2C12 and L6). In L6 cells, this increase was accounted for by a corresponding increase of hexokinase II gene transcription. Comparison of the structures of the hexokinase II and glucokinase genes support the hypothesis that the 100-kDa hexokinase arose by gene duplication and tandem ligation of a 50-kDa glucokinase-like ancestral gene.

The C repeat family was first observed in the rabbit beta-like gene family. We have estimated the repetition frequency of the C repeats, determined the nucleotide sequence of three intact members and one truncated member, and have investigated the size, tissue specificity, and intracellular localization of C repeat transcripts. Members of the C repeat family are short (average size of 316 base-pairs) and are repeated about 170,000 times per haploid genome in a widely dispersed pattern. They end in a 3' poly(dA) tract and are flanked by direct repeats that range in size from 8 to 16 base-pairs. The consensus internal control regions for polymerase III transcription are located near the 5' end. Different amounts of C repeat RNA accumulate in a variety of tissues, and most of the transcripts are confined to the nucleus. A heterogeneous distribution of C repeat RNA sizes was found, ranging from about 330 to 8200 nucleotides. These structural and transcriptional properties are similar to those of primate and rodent Alu and Alu-like repeats. However, the C repeats are not similar in sequence to the Alu repeats. Thus two different types of short, interspersed repeats capable of being transcribed and proposed to be transposable elements have now been identified in mammals. The positions of these short repeats in mammalian beta-like globin gene families are not tightly conserved.

The C family of short, interspersed repeats (SINES) is highly repeated in the rabbit genome, and most members have a structure suggestive of a model for their dispersal via reinsertion of a double-stranded copy of an RNA polymerase III transcribed RNA. We have determined the nucleotide sequence of additional members of the repeat family and have compiled them to obtain an improved consensus sequence. This compilation shows that although most regions of the repeat are well conserved, two regions show high variability. Some individual repeats are truncated, and one truncated repeat retains the characteristic structures of a retroposon. The consensus sequence for C repeats does not match the sequence of any other sequenced mammalian SINE over large regions, but short imperfect matches to several primate and rodent SINES are observed. A sequence similar to the 27 nucleotide consensus sequence TCCCAGCAACCACATGGGAGGCAGAGA was found in all mammalian SINES examined. The 3' portion of this sequence matches a DNA segment found at the replication origins of papovaviruses.

The activity of a purified high molecular weight phosphoprotein phosphatase was inhibited by purified type II cAMP-dependent protein kinase. This effect required cAMP and was obtained in the absence of ATP. The isolated type II regulatory subunits (R-subunits) from several species also inhibited the phosphatase activity in both crude extracts and purified preparations. Half maximal inhibition was observed at 0.06-0.25 microM, well within the physiological range of R-subunit concentrations. The inhibitory potency of R-subunit was greater using the thiophosphorylated form. Limited trypsinization of the R-subunit abolished the inhibitory activity. The C-subunit released the bound cAMP when combined with R-subunit, but the phosphatase did not, implying that the inhibited species is a R.cAMP-phosphatase complex. The results suggest that the R-subunit might have at least one physiological role in addition to inhibition of the C-subunit, i.e., inhibition of phosphatase. The latter would occur only when cAMP is elevated.