Search

FinR is required for the induction of fpr (ferredoxin-[NADP.sup.+] reductase) under superoxide stress conditions in Pseudomonas putida. Many proteobacteria harbour FinR homologues in their genome as a putative LysR-type protein. Three cysteine residues (at positions 150, 239 and 289 in P. putida FinR) are conserved in all FinR homologues. When these conserved cysteines, along with two other cysteine residues present in FinR, were individually mutated to serines, the FinR remained active, unlike SoxR and OxyR in Escherichia coli. The results of our in vitro DNA-binding assay with cellular extracts showed that FinR binds directly to the fpr promoter region. In order to identify the FinR functional domain for sensing superoxide stress, we employed random and site-directed mutagenesis of FinR. Among 18 single amino acid mutants, three mutants (T39A, R194A and E225A) abolished fpr induction without any alteration of their DNA-binding ability, whereas other mutants also abrogated their DNA-binding abilities. Interestingly, two mutants (L215P and D51A) appeared to be constitutively active, regardless of superoxide stress conditions. Ferrous iron depletion, ferric iron addition and fdxA (ferredoxin) gene deletion also participate in the regulation of fpr. These data indicate that FinR has unusual residues for redox sensing and that the redox-sensing mechanism of FinR differs from the well-known mechanisms of OxyR and SoxR. DOI 10.1099/mic.0.034181-0

Pseudomonas putida GJ31 has been reported to grow on chlorobenzene using a meta-cleavage pathway with chlorocatechol 2,3-dioxygenase (CbzE) as a key enzyme. The CbzE-encoding gene was found to be localized on the 180 kb plasmid pKW1 in a cbzTEXGS cluster, which is flanked by transposases and encodes only a partial (chloro)catechol meta-cleavage pathway comprising ferredoxin reductase, chlorocatechol 2,3-dioxygenase, an unknown protein, 2-hydroxymuconic semialdehyde dehydrogenase and glutathione S-transferase. Downstream of cbzTEXGS are located cbzJ, encoding a novel type of 2-hydroxypent-2,4-dienoate hydratase, and a transposon region highly similar to Tn5501. Upstream of cbzTEXGS, traNEOFG transfer genes were found. The search for gene clusters possibly completing the (chloro)catechol metabolic pathway of GJ31 revealed the presence of two additional catabolic gene clusters on pKW1. The mhpRBCDFETP cluster encodes enzymes for the dissimilation of 2,3-dihydroxyphenylpropionate in a novel arrangement characterized by the absence of a gene encoding 3-(3-hydroxyphenyl)propionate monooxygenase and the presence of a GntR-type regulator, whereas the nahINLOMKJ cluster encodes part of the naphthalene metabolic pathway. Transcription studies supported their possible involvement in chlorobenzene degradation. The upper pathway cluster, comprising genes encoding a chlorobenzene dioxygenase and a chlorobenzene dihydrodiol dehydrogenase, was localized on the chromosome. A high level of transcription in response to chlorobenzene revealed it to be crucial for chlorobenzene degradation. The chlorobenzene degradation pathway in strain GJ31 is thus a mosaic encoded by four gene clusters. DOI 10.1099/mic.0.032110-0

A multidrug efflux pump, SrpaBC, plays a key role in Pseudomonas putida S12 tolerance to toxic organic solvents. SrpRS are putative regulators of the SrpaBC efflux pump encoded upstream of the srpaBC structural genes, and previous studies suggest that SrpS is a repressor of SrpaBC expression. An S12 isolate able to withstand extreme solvent stress carries a novel insertion sequence, ISPpu21, interrupting srpS. This insertion preadapts S12 to extreme solvent conditions through constitutive SrpaBC expression. doi: 10.1128/JB.00832-09

Pseudomonas putida CA-3 is a styrene-degrading bacterium capable of accumulating medium-chain-length polyhydroxyalkanoate (mcIPHA) when exposed to limiting concentrations of a nitrogen source in the growth medium. Using shotgun proteomics we analysed global proteome expression in P. putida CA-3 supplied with styrene as the sole carbon and energy source under N-limiting (condition permissive for mclPHA synthesis) and non-limiting (condition non-permissive for mclPHA accumulation) growth conditions in order to provide insight into the molecular response of P. putida CA-3 to limitation of nitrogen when grown on styrene. A total of 1761 proteins were identified with high confidence and the detected proteins could be assigned to functional groups including styrene degradation, energy, nucleotide metabolism, protein synthesis, transport, stress response and motility. Proteins involved in the upper and lower styrene degradation pathway were expressed throughout the 48 h growth period under both nitrogen limitation and excess. Proteins involved in polyhydroxyalkanoate (PHA) biosynthesis, nitrogen assimilation and amino acid transport, and outer membrane proteins were upregulated under nitrogen limitation. PHA accumulation and biosynthesis were only expressed under nitrogen limitation. Nitrogen assimilation proteins were detected on average at twofold higher amounts under nitrogen limitation. Expression of the branched-chain amino acid ABC transporter was up to 16-fold higher under nitrogen-limiting conditions. Branched chain amino acid uptake by nitrogen-limited cultures was also higher than that by non-limited cultures. Outer membrane lipoproteins were expressed at twofold higher levels under nitrogen limitation. This was confirmed by Western blotting (immunochemical detection) of cells grown under nitrogen limitation. Our study provides the first global description of protein expression changes during growth of any organism on styrene and accumulating mclPHA (nitrogen-limited growth). DOI 10.1099/mic.0.031153-0

Pseudomonasputida KT2440 is a model strain for studying bacterial biodegradation processes. However, very little is known about nitrogen regulation in this strain. Here, we show that the nitrogen regulatory NtrC proteins from P. putida and Escherichia coli are functionally equivalent and that substitutions leading to partially active forms of enterobacterial NtrC provoke the same phenotypes in P. putida NtrC. P. putida has only a single [P.sub.II]-like protein, encoded by glnK, whose expression is nitrogen regulated. Two contiguous NtrC binding sites located upstream of the [[sigma].sup.N]-dependent glnK promoter have been identified by footprinting analysis. In vitro experiments with purified proteins demonstrated that glnK transcription was directly activated by NtrC and that open complex formation at this promoter required integration host factor. Transcription of genes orthologous to enterobacterial codB, dppA, and ureD genes, whose transcription is dependent on [[sigma].sup.70] and which are activated by Nac in E. coli, has also been analyzed for P. putida. Whereas dppA does not appear to be regulated by nitrogen via NtrC, the codB and ureD genes have [[sigma].sup.N]-dependent promoters and their nitrogen regulation was exerted directly by NtrC, thus avoiding the need for Nac, which is missing in this bacterial species. Based upon these results, we propose a simplified nitrogen regulatory network in P. putida (compared to that in enterobacteria), which involves an indirect-feedback autoregulation of glnK using NtrC as an intermediary. doi: 10.1128/JB.00744-09

We report here the identification and characterization of mrdH, a novel chromosomal metal resistance determinant, located in the genomic island 55 of Pseudomonas putida KT2440. It encodes for MrdH, a predicted protein of ~40 kDa with a chimeric domain organization derived from the RcnA and RND (for resistance-nodulation-cell division) metal efflux proteins. The metal resistance function ofmrdHwas identified by the ability to confer nickel resistance upon its complementation into rcnA mutant (a nickel- and cobalt-sensitive mutant) of Escherichia coli. However, the disruption of mrdH in P. putida resulted in an increased sensitivity to cadmium and zinc apart from nickel. Expression studies using quantitative reverse transcription-PCR showed the induction of mrdH by cadmium, nickel, zinc, and cobalt. In association with mrdH, we also identified a conserved hypothetical gene mreA whose encoded protein showed significant homology to NreA and NreA-like proteins. Expression of the mreA gene in rcnA mutant of E. coli enhanced its cadmium and nickel resistance. Transcriptional studies showed that both mrdH and mreA underwent parallel changes in gene expression. The mobile genetic elements Tn4652 and IS1246, flanking mrdH and mreA were found to be induced by cadmium, nickel, and zinc, but not by cobalt. This study is the first report of a single-component metal efflux transporter, mrdH, showing chimeric domain organization, a broad substrate spectrum, and a location amid metal-inducible mobile genetic elements. doi: 10.1128/JB.00465-09

The growth pattern of Pseudomonas putida KT2440 in the presence of glucose and phenylacetic acid (PAA), where the sugar is used in preference to the aromatic compound, suggests that there is carbon catabolite repression (CCR) of PAA metabolism by glucose or gluconate. Furthermore, CCR is regulated at the transcriptional level. However, this CCR phenomenon does not occur in PAA-amended minimal medium containing fructose, pyruvate or succinate. We previously identified 2-keto-3-deoxy-6-phosphogluconate (KDPG) as an inducer of glucose metabolism, and this has led to this investigation into the role of KDPG as a signal compound for CCR. Two mutant strains, the edd mutant (non-KDPG producer) and the eda mutant (KDPG overproducer), grew in the presence of PAA but not in the presence of glucose. The edd mutant utilized PAA even in the presence of glucose, indicating that CCR had been abolished. This observation has additional support from the finding that there is high phenylacetyI-CoA ligase activity in the edd mutant, even in the presence of glucose + PAA, but not in wild-type cells under the same conditions. Unlike the edd mutant, the eda mutant did not grow in the presence of glucose-t-PAA. Interestingly, there was no uptake and/or metabolism of PAA in the eda mutant cells under the same conditions. Targeted disruption of PaaX, a repressor of the PAA operon, had no effect on CCR of PAA metabolism in the presence of glucose, suggesting that there is another transcriptional repression system associated with the KDPG signal. This is the first study to demonstrate that KDPG is the true CCR signal of PAA metabolism in P. putida KT2440.

Pseudomonas putida CBB5 was isolated from soil by enrichment on caffeine. This strain used not only caffeine, theobromine, paraxanthine, and 7-methylxanthine as sole carbon and nitrogen sources but also theophylline and 3-methylxanthine. Analyses of metabolites in spent media and resting cell suspensions confirmed that CBB5 initially N demethylated theophylline via a hitherto unreported pathway to 1- and 3-methylxanthines. NAD(P)H-dependent conversion of theophylline to 1- and 3-methylxanthines was also detected in the crude cell extracts of theophylline-grown CBB5. 1-Methylxanthine and 3-methylxanthine were subsequently N demethylated to xanthine. CBB5 also oxidized theophylline and 1- and 3-methylxanthines to 1,3-dimethyluric acid and 1- and 3-methyluric acids, respectively. However, these methyluric acids were not metabolized further. A broad-substrate-range xanthine-oxidizing enzyme was responsible for the formation of these methyluric acids. In contrast, CBB5 metabolized caffeine to theobromine (major metabolite) and paraxanthine (minor metabolite). These dimethylxanthines were further N demethylated to xanthine via 7-methylxanthine. Theobromine-, paraxanthine-, and 7-methylxanthine-grown cells also metabolized all of the methylxanthines mentioned above via the same pathway. Thus, the theophylline and caffeine N-demethylation pathways converged at xanthine via different methylxanthine intermediates. Xanthine was eventually oxidized to uric acid. Enzymes involved in theophylline and caffeine degradation were coexpressed when CBB5 was grown on theophylline or on caffeine or its metabolites. However, 3-methyixanthine-grown CBB5 cells did not metabolize caffeine, whereas theophylline was metabolized at much reduced levels to only methyluric acids. To our knowledge, this is the first report of theophylline N demethylation and coexpression of distinct pathways for caffeine and theophylline degradation in bacteria.

RpoS is a bacterial sigma factor of RNA polymerase which is involved in the expression of a large number of genes to facilitate survival under starvation conditions and other stresses. The results of our study demonstrate that the frequency of emergence of base substitution mutants is significantly increased in long-term-starved populations of rpoS-deficient Pseudomonas putida cells. The increasing effect of the lack of RpoS on the mutation frequency became apparent in both a plasmid-based test system measuring [Phe.sup.+] reversion and a chromosomal rpoB system detecting rifampin-resistant mutants. The elevated mutation frequency coincided with the death of about 95% of the cells in a population of rpoS-deficient P. putida. Artificial overexpression of superoxide dismutase or catalase in the rpoS-deficient strain restored the survival of cells and resulted in a decline in the mutation frequency. This indicated that, compared to wild-type bacteria, rpoS-deficient cells are less protected against damage caused by reactive oxygen species. 7,8-Dihydro-8-oxoguanine (GO) is known to be one of the most stable and frequent base modifications caused by oxygen radical attack on DNA. However, the spectrum of base substitution mutations characterized in rpoS-deficient P. putida was different from that in bacteria lacking the GO repair system: it was broader and more similar to that identified in the wild-type strain. Interestingly, the formation of large deletions was also accompanied by a lack of RpoS. Thus, the accumulation of DNA damage other than GO elevates the frequency of mutation in these bacteria. It is known that oxidative damage of proteins and membrane components, but not that of DNA, is a major reason for the death of cells. Since the increased mutation frequency was associated with a decline in the viability of bacteria, we suppose that the elevation of the mutation frequency in the surviving population of carbon-starved rpoS-deficient P. putida may be caused both by oxidative damage of DNA and enzymes involved in DNA replication and repair fidelity.

Transposition activity in bacteria is generally maintained at a low level. The activity of mobile DNA elements can be controlled by bacterially encoded global regulators. Regulation of transposition of Tn4652 in Pseudomonas putida is one such example. Activation of transposition of Tn4652 in starving bacteria requires the stationary-phase sigma factor RpoS and integration host factor (IHF). IHF plays a dual role in Tn4652 translocation by activating transcription of the transposase gene tnpA of the transposon and facilitating TnpA binding to the inverted repeats of the transposon. Our previous results have indicated that besides IHF some other P. putida-encoded global regulator(s) might bind to the ends of Tn4652 and regulate transposition activity. In this study, employing a DNase I footprint assay we have identified a binding site of P. putida Fis (factor for inversion stimulation) centred 135 bp inside the left end of Tn4652. Our results of gel mobility shift and DNase I footprint studies revealed that Fis out-competes IHF from the left end of Tn4652, thereby abolishing the binding of TnpA. Thus, the results obtained in this study indicate that the transposition of Tn4652 is regulated by the cellular amount of P. putida global regulators Fis and IHF.

The transcriptional regulation of three distinct alcohol oxidation systems, alcohol dehydrogenase (ADH)-I, ADH-IIB and ADH-IIG, in Pseudomonas putida HK5 was investigated under various induction conditions. The promoter activities of the genes involved in alcohol oxidation were determined using a transcriptional lacZ fusion promoter-probe vector. Ethanol was the best inducer for the divergent promoters of qedA and qedC, encoding ADH-I and a cytochrome c, respectively. Primary and secondary C3 and C4 alcohols and butyraldehyde specifically induced the divergent promoters of qbdBA and aldA, encoding ADH-IIB and an NAD-dependent aldehyde dehydrogenase, respectively. The qgdA promoter of ADH-IIG responded well to (S)-(+)-1,2-propanediol induction. In addition, the roles of genes encoding the response regulators exaE and agmR, located downstream of qedA, were inferred from the properties of exaE- or agmR-disrupted mutants and gene complementation tests. The gene products of both exaE and agmR were strictly necessary for qedA transcription. The mutation and complementation studies also suggested a role for AgmR, but not ExaE, in the transcriptional regulation of qbdBA (ADH-IIB) and qgdA (AGH-IIG). A hypothetical scheme describing a regulatory network, which directs expression of the three distinct alcohol oxidation systems in P. putida HK5, was derived.

Pseudomonas putida G7 carries a naphthalene-catabolic and self-transmissible plasmid, NAH7, which belongs to the IncP-9 incompatibility group. Adjacent to the putative origin of conjugative transfer (oriT) of NAH7 are three genes, traD, traE, and traF, whose functions and roles in conjugation were previously unclear. These three genes were transcribed monocistronically and thus were designated the traD operon. Mutation of the three genes in the traD operon resulted in 10- to [10.sup.5]-fold decreases in the transfer frequencies of the plasmids from Pseudomonas to Pseudomonas and Escherichia coli and from E. coli to E. coli. On the other hand, the traD operon was essential for the transfer of NAH7 from E. coli to Pseudomonas strains. These results indicated that the traD operon is a host-range modifier in the conjugative transfer of NAH7. The TraD, TraE, and TraF proteins were localized in the cytoplasm, periplasm, and membrane, respectively, in strain G7 cells. Our use of a bacterial two-hybrid assay system showed that TraE interacted in vivo with other essential components for conjugative transfer, including TraB (coupling protein), TraC (relaxase), and MpfH (a channel subunit in the mating pair formation system).

RNase R is a 3'-5' highly processive exoribonuclease that can digest RNAs with extensive secondary structure. We analyzed the global elect of eliminating RNase R on the Pseudomonas putida transcriptome and the expression of the rnr gene under diverse conditions. The absence of RNase R led to increased levels of many mRNAs, indicating that it plays an important role in mRNA turnover.

Pseudomonas putida PCL1445 secretes two cyclic lipopeptides, putisolvin I and putisolvin II, which possess a surface-tension-reducing ability, and are able to inhibit biofilm formation and to break down biofilms of Pseudomonas species including Pseudomonas aeruginosa. The putisolvin synthetase gene cluster (pso) and its surrounding region were isolated, sequenced and characterized. Three genes, termed psoA, psoB and psoC, were identified and shown to be involved in putisolvin biosynthesis. The gene products encode the 12 modules responsible for the binding of the 12 amino acids of the putisolvin peptide moiety. Sequence data indicate that the adenylation domain of the 11th module prioritizes the recognition of Val instead of Leu or lle and consequently favours putisolvin I production over putisolvin II. Detailed analysis of the thiolation domains suggests that the first nine modules recognize the D form of the amino acid residues while the two following modules recognize the L form and the last module the L or D form, indifferently. The psoR gene, which is located upstream of psoA, shows high similarity to luxR-type regulatory genes and is required for the expression of the pso cluster. In addition, two genes, macA and macB, located downstream of psoC were identified and shown to be involved in putisolvin production or export.

Pseudomonas putida DS1 is able to utilize dimethyl sulfone as a sulfur source. Expression of the sfnFG operon responsible for dimethyl sulfone oxygenation is directly regulated by a [sigma]54-dependent transcriptional activator, SfnR, which is encoded within the sfnECR operon. We investigated the transcription mechanism for the sulfate starvation-induced expression of these sfn operons. Using an in vivo transcription assay and in vitro DNA-binding experiments, we revealed that SfnR negatively regulates the expression of sfnECR by binding to the downstream region of the transcription start point. Additionally, we demonstrated that a LysR-type transcriptional regulator, CysB, directly activates the expression of sfnECR by binding to its upstream region. CysB is a master regulator that controls the sulfate starvation response of the sfn operons, as is the case for the sulfonate utilization genes of Escherichia coli, although [CySB.sub.Ds1] appeared to differ from that of E. coli CysB in terms of the effect of O-acetylserine on DNA-binding ability. Furthermore, we investigated what effector molecules repress the expression of sfnFG and sfnECR in vivo by using the disruptants of the sulfate assimilatory genes cysNC and cysI. The measurements of mRNA levels of the sfn operons in these gene disruptants suggested that the expression of sfnFG is repressed by sulfate itself while the expression of sfnECR is repressed by the downstream metabolites in the sulfate assimilatory pathway, such as sulfide and cysteine. These results indicate that SfnR plays a role independent of CysB in the sulfate starvation-induced expression of the sfn operons.

Oxidative damage of DNA is a source of mutation in living cells. Although all organisms have evolved mechanisms of defense against oxidative damage, little is known about these mechanisms in nonenteric bacteria, including pseudomonads. Here we have studied the involvement of oxidized guanine (GO) repair enzymes and DNA-protecting enzyme Dps in the avoidance of mutations in starving Pseudomonas putida. Additionally, we examined possible connections between the oxidative damage of DNA and involvement of the error-prone DNA polymerase (Pol)V homologue RulAB in stationary-phase mutagenesis in P. putida. Our results demonstrated that the GO repair enzymes MutY, MutM, and MutT are involved in the prevention of base substitution mutations in carbon-starved P. putida. Interestingly, the antimutator effect of MutT was dependent on the growth phase of bacteria. Although the lack of MutT caused a strong mutator phenotype under carbon starvation conditions for bacteria, only a twofold increased effect on the frequency of mutations was observed for growing bacteria. This indicates that MutT has a backup system which efficiently complements the absence of this enzyme in actively growing cells. The knockout of MutM affected only the spectrum of mutations but did not change mutation frequency. Dps is known to protect DNA from oxidative damage. We found that dps-defective P. putida cells were more sensitive to sudden exposure to hydrogen peroxide than wild-type cells. At the same time, the absence of Dps did not affect the accumulation of mutations in populations of starved bacteria. Thus, it is possible that the protective role of Dps becomes essential for genome integrity only when bacteria are exposed to exogenous agents that lead to oxidative DNA damage but not under physiological conditions. Introduction of the Y family DNA polymerase PolV homologue rulAB into P. putida increased the proportion of A-to-C and A-to-G base substitutions among mutations, which occurred under starvation conditions. Since PolV is known to perform translesion synthesis past damaged bases in DNA (e.g., some oxidized forms of adenine), our results may imply that adenine oxidation products are also an important source of mutation in starving bacteria.

The genome sequences of several pseudomonads have revealed a gene cluster containing genes for a two-component heavy metal histidine sensor kinase and response regulator upstream of cinA and cinQ, which we show herein to encode a copper-containing azurin-like protein and a pre-[Q.sub.0] reductase, respectively. In the presence of copper, Pseudomonas putida KT2440 produces the CinA and CinQ proteins from a bicistronic mRNA. UV-visible spectra of CinA show features at 439, 581, and 719 nm, which is typical of the plastocyanin family of proteins. The redox potential of the protein was shown to be 456 [+ or -] 4 mV by voltametric titrations. Surprisingly, CinQ is a pyridine nucleotide-dependent nitrile oxidoreductase that catalyzes the conversion of pre-[Q.sub.0] to pre-[Q.sub.1] in the nucleoside queuosine biosynthetic pathway. Gene disruptions of cinA and cinQ did not lead to a significant increase in the copper sensitivity of P. putida KT2440 under the conditions tested. Possible roles of CinA and CinQ to help pseudomonads adapt and survive under prolonged copper stress are discussed.

In this study, we show that glucose catabolism in Pseudomonas putida occurs through the simultaneous operation of three pathways that converge at the level of 6-phosphogluconate, which is metabolized by the Edd and Era Entner/Doudoroff enzymes to central metabolites. When glucose enters the periplasmic space through specific OprB porins, it can either be internalized into the cytoplasm or be oxidized to gluconate. Glucose is transported to the cytoplasm in a process mediated by an ABC uptake system encoded by open reading frames PPI015 to PPI018 and is then phosphorylated by glucoldnase (encoded by' the glk gene) and converted by glucose-6-phosphate dehydrogenase (encoded by the zwf genes) to 6-phosphogluconate. Gluconate in the periplasm can be transported into the cytoplasm and subsequently phosphorylated by gluconokinase to 6-phosphogluconate or oxidized to 2-ketogluconate, which is transported to the cytoplasm, and subsequently phosphorylated and reduced to 6-phosphoglnconate. In the wild-type strain, glucose was consumed at a rate of around 6 mmol [g.sup.-1] [h.sup.-1], which allowed a growth rate of 0.58 h J and a biomass yield of 0.44 g/g carbon used. Flux analysis of 13C-labeled glucose revealed that, in the Krebs cycle, most of the oxalacetate fraction was produced by the pyruvate shunt rather than by the direct oxidation of malate by malate dehydrogenase. Enzymatic and microarray assays revealed that the enzymes, regulators, and transport systems of the three peripheral glucose pathways were induced in response to glucose in the outer medium. We generated a series of isogenic mutants in one or more of the steps of all three pathways and found that, although all three functioned simultaneously, the glucokinase pathway and the 2-ketogluconate loop were quantitatively more important than the direct phosphorylation of gluconate. In physical terms, glucose catabolism genes were organized in a series of clusters scattered along the chromosome. Within each of the clusters, genes encoding porins, transporters, enzymes, and regulators formed operons, suggesting that genes in each cluster coevolved. The glk gene encoding glucokinase was located in an operon with the edd gene, whereas the zwf-1 gene, encoding glucose-6-phosphate dehydrogenase, formed an operon with the eda gene. Therefore, the enzymes of the glucokinase pathway and those of the Entner-Doudoroff pathway are physically linked and induced simultaneously. It can therefore be concluded that the glucokinase pathway is a sine qua non condition for P. putida to grow with glucose.

Genetic differentiation by natural selection is readily observed among microbial populations, but a more comprehensive understanding of evolutionary forces, genetic causes, and resulting phenotypic advantages is not often sought. Recently, a surface population of Pseudomonas putida bacteria was shown to evolve rapidly by natural selection of better-adapted variants in a mixed-species biofilm consortium (S. K. Hansen, P. B. Rainey, J. A. Haagensen, and S. Molin, Nature 445:533-536, 2007). Adaptation was caused by mutations in a wapH homolog (PP4943) involved in core lipopolysaccharide biosynthesis. Here we investigate further the biofilm physiology and the phenotypic characteristics of the selected P. putida rough colony variants. The coexistence of the P. putida population in a mixed-species biofilm with Acinetobacter sp. strain C6 is dependent on the benzoate excreted from Acinetobacter during the catabolism of benzyl alcohol, the sole carbon source. Examination of biofilm development and the dynamics of the wild-type consortium revealed that the biofilm environment became oxygen limited, possibly with low oxygen concentrations around Acinetobacter microcolonies. In contrast to P. putida wild-type cells, which readily dispersed from the mixed-species biofilm in response to oxygen starvation, the rough variant cells displayed a nondispersal phenotype. However, in monospecies biofilms proliferating on benzoate, the rough variant (like the wild-type population) dispersed in response to oxygen starvation. A key factor explaining this conditional, nondispersal phenotype is likely to be the acquired ability of the rough variant to coaggregate specifically with Acinetobacter cells. We further show that the P. putida rough variant displayed enhanced production of a cellulose-like polymer as a consequence of the mutation in wapH. The resulting phenotypic characteristics of the P. putida rough variant explain its enhanced fitness and ability to form tight structural associations with Acinetobacter microcolonies.

The enzyme 2- hydroxychromene-2-carboxylix acid (HCCA) isomerase catalyzes the glutathione (GSH)-dependent interconversion ([K.sub.eq] =1.5) of HCCA and trans-a-hydroxybenzylidene pyruvic acid (tHBPA) in the naphthalene catabolic pathway of Pseudomonas putida. The results suggests that isomerization reaction involves a short-lived covalent adduct between the sulfur of GSH and C7 of the substrate.

Transcription of the plasmid-borne phenol catabolic operon pheBA in Pseudomonas putida is activated by the LysR-family regulator CatR in the presence of the effector molecule cis, cis-muconate (CCM), which is an intermediate of the phenol degradation pathway. In addition to the positive control of the operon, several factors negatively affect transcription initiation from the pheBA promoter. First, the activation of the pheBA operon depends on the extracellular concentration of phenol. The pheBA promoter is rapidly activated in the presence of micromolar concentrations of phenol in minimal growth medium, but the initiation of transcription from this promoter is severely delayed after sudden exposure of bacteria to 2.5 mM phenol. Second, the transcriptional activation from this promoter is impeded when the growth medium of bacteria contains amino acids. The negative effects of amino acids can be suppressed either by overproducing CatR or by increasing, the intracellular amount of CCM. However, the intracellular amount of CCM is a major limiting factor for the transcriptional activation of the pheBA operon, as accumulation of CCM in a P. putida catB-defective strain, unable to metabolize CCM (but expressing CatR at a natural level), almost completely relieves the negative effects of amino acids. The intracellular amount of CCM is negatively affected by the catabolite repression control protein via downregulating at the post-transcriptional level the expression of the pheBA-encoded catechol 1,2-dioxygenase and the phenol monooxygenase, the enzymes needed for CCM production.

The genome of Pseudomonas putida KT2440 encodes five proteins of the phosphoenolpyruvate-earbohydrate phosphotransferase system. Two of these (FruA and FruB) form a dedicated system for fructose intake, while enzyme [I.sup.Ntr] (E[I.sup.Ntr]; encoded by ptsP), NPr (ptsO), and EI[I.sup.Ntr] (ptsN) act in concert to control the intracellular accumulation of polyhydroxyalkanoates, a typical product of carbon overflow.

The competitive fitness of three phenanthrene-mineralizing isolates is evaluated to find whether the contaminant availability determine the isolates competitive fitness. The results indicate that contaminant availability alone does not determine the isolates competitive fitness.

The isolation of a Pseudomonas putida DTB bacterium capable of utilizing N,N-diethyl-m-toluamide (DEET) as sole carbon and energy source and hydrolyzing DEET into 3-methylbenzoate and diethylamine is reported.

We analyzed the target preferences of a Tn3 family transposon Tn4652. Alignment of 93 different insertion sites revealed a consensus sequence which resembles that of Tn3, indicating that despite a low similarity between Tn4652 and Tn3 transposases, their target site recognition is conserved. doi:10.1128/JB.01863-06

Pseudomonas putida uses L-lysine as the sole carbon and nitrogen source which preferentially requires its metabolism through two parallel pathways. In one of the pathways [delta]-aminovalerate is the key metabolite, whereas in the other L-lysine is racemized to D-lysine, and L-pipecolate and [alpha]-aminoadipate are the key metabolites. All the genes and enzymes involved in the D-lysine pathway, except for those involved in the conversion of D-lysine into [[DELTA].sup.1]-piperideine-2-carboxylate, have been identified previously (30). In this study we report that the conversion of D-lysine into [[DELTA].sup.1]-piperideine-2-carboxylate can be mediated by a D-lysine aminotransferase (PP3590) and a D-lysine dehydrogenase (PP3596). From a physiological point of view PP3596 plays a major role in the catabolism of D-lysine since its inactivation leads to a marked reduction in the growth rate with L- or D-lysine as the sole carbon and nitrogen source, whereas inactivation of PP3590 leads only to slowed growth. The gene encoding PP3590, called here amaC, forms an operon with dpkA, the gene encoding the enzyme involved in conversion of [[DELTA].sup.1]-piperideine-2-carboxylate to L-pipecolate in the D-lysine catabolic pathway. The gene encoding PP3596, called here amaD, is the fifth gene in an operon made up of seven open reading frames (ORFs) encoding PP3592 through PP3597. The dpkA amaC operon was transcribed divergently from the operon ORF3592 to ORF3597. Both promoters were mapped by primer extension analysis, which showed that the divergent -35 hexamers of these operon promoters were adjacent to each other. Transcription of both operons was induced in response to L- or D-lysine in the culture medium.

Pseudomonas putida encodes 20 extracytoplasmic sigma factors (ECFs). In this study, we show that one of these ECFs, known as ECF-Pp12 (PP3006), plays a role in tolerance of toluene and other organic solvents. Based on this finding, we have called the gene that encodes this new ECF rpoT. The rpoT gene forms an operon with the preceding gene and with the gene located downstream. The translated gene product of the open reading frame PP3005 is an inner membrane protein, whereas the PP3007 protein is periplasmic. A nonpolar [DELTA]rpoT mutant was generated by homologous recombination, and survival of the mutant was tested under various stress conditions. The mutant strain was hypersensitive to toluene and other solvents but just as tolerant as the wild type of stress imposed by heat, antibiotics, NaCI, paraquat, sodium dodecyl sulfate, [H.sub.2][O.sub.2], and benzoate. In the [DELTA]rpoT mutant background, expression of around 50 transcriptional units was affected: 31 cistrons were upregulated, and 23 cistrons were downregulated. This indicates that about 1% of all P. putida genes are under the direct or indirect influence of RpoT. The rpoT gene controls the expression of a number of membrane proteins, including components of the respiratory chains, porins, transporters, and multidrug efflux pumps. Hypersensitivity of the P. putida RpoT-deficient mutant to organic solvents can be attributed to the fact that in the [DELTA]rpoT strain, expression of the toluene etflux pump ttgGHI genes is severalfold lower than in the parental strain.

The metabolically versatile soil bacterium Pseudomonas putida has to cope with numerous abiotic stresses in its habitats. The stress responses of P. putida KT2440 to 4[degrees]C, pH 4.5, 0.8 M urea, and 45 mM sodium benzoate were analyzed by determining the global mRNA expression profiles and screening for stress-intolerant non-auxotrophic Tn5 transposon mutants. In 392 regulated genes or operons, 36 gene regions were differentially expressed by more than 2.5-fold, and 32 genes in 23 operons were found to be indispensable for growth during exposure to one of the abiotic stresses. The transcriptomes of the responses to urea, benzoate, and 4[degrees]C correlated positively with each other but negatively with the transcriptome of the mineral acid response. The CbrAB sensor kinase, the cysteine synthase CysM, PcnB and VacB, which control mRNA stability, and BipA, which exerts transcript-specific translational control, were essential to cope with cold stress. The cyo operon was required to cope with acid stress. A functional PhoP, PtsP, RelA/SpoT modulon, and adhesion protein LapA were necessary for growth in the presence of urea, and the outer membrane proteins OmlA and FepA and the phosphate transporter PstBACS were indispensable for growth in the presence of benzoate. A lipid A acyltransferase (PP0063) was a mandatory component of the stress responses to cold, mineral acid, and benzoate. Adaptation of the membrane barrier, uptake of phosphate, maintenance of the intracellular pH and redox status, and translational control of metabolism are key mechanisms of the response of P. putida to abiotic stresses.

We have characterized the Pseudomonas putida KT2440 insertion element ISPpu10. This insertion sequence encodes a transposase which exhibits homology to the transposases and specific recombinases of the Piv/Moov family, and no inverted repeats are present at the borders of its left and right ends, thus constituting a new member of the atypical IS110/IS492 family. ISPpu10 was found in at least seven identical loci in the KT2440 genome, and variants were identified having an extra insertion at distinct loci. ISPpu10 always appeared within the core of specific repetitive extragenic palindromic (REP) sequences TCGCGGGTAAACCCGCTCCTAC, exhibiting high target stringency. One intragenic target was found associated with the truncation of a GGD EF/EAL domain protein. After active in vitro transposition to a plasmid-borne target, a duplication of the CT (underlined above) at the junction as a consequence of the ISPpu10 insertion was experimentally demonstrated for the first time in the ISl10/IS492 family. The same duplication was observed after transposition of ISPpul0 from a plasmid to the chromosome of P. putida DOT-TIE, an ISPpu10-free strain with REPs similar to those of strain KT2440. Plasmid ISPpu10-mediated rearrangements were observed in vivo under laboratory conditions and in the plant rhizosphere.

The value of the multivariate data analysis tools principal component analysis (PCA) and principal component discriminant analysis (PCDA) for prioritizing leads generated by microarrays was evaluated. To this end, Pseudomonas putida S12 was grown in independent triplicate fermentations on four different carbon sources, i.e. fructose, glucose, gluconate and succinate. RNA isolated from these samples was analysed in duplicate on an anonymous clone-based array to avoid bias during data analysis. The relevant transcripts were identified by analysing the loadings of the principal components (PC) and discriminants (D) in PCA and PCDA, respectively. Even more specifically, the relevant transcripts for a specific phenotype could also be ranked from the loadings under an angle (biplot) obtained after PCDA analysis. The leads identified in this way were compared with those identified using the commonly applied fold-difference and hierarchical clustering approaches. The different data analysis methods gave different results. The methods used were complementary and together resulted in a comprehensive picture of the processes important for the different carbon sources studied. For the more subtle, regulatory processes in a cell, the PCDA approach seemed to be the most effective. Except for glucose and gluconate dehydrogenase, all genes involved in the degradation of glucose, gluconate and fructose were identified. Moreover, the transcriptomics approach resulted in potential new insights into the physiology of the degradation of these carbon sources. Indications of iron limitation were observed with cells grown on glucose, gluconate or succinate but not with fructose-grown cells. Moreover, several cytochrome- or quinone-associated genes seemed to be specifically up- or downregulated, indicating that the composition of the electron-transport chain in P. putida S12 might change significantly in fructose-grown cells compared to glucose-, gluconate- or succinate-grown cells.

A new cell surface display system in Pseudomonas putida KT2442 is developed using OprF, an outer membrane protein of Pseudomonas aeruginosa, as an anchoring motif in a C-terminal deletion-fusion strategy. The results have demonstrated that the OprF anchor can be used for efficient display of proteins in Pseudomonas putida KT2442 and also for various biocatalytic applications.

Esterase (EST) from Pseudomonas putida IFO12996 catalyzes the stereoselective hydrolysis of methyl DL-[beta]-acetylthioisobutyrate (DL-MATI) to produce D-[beta]-acetylthioisobutyric acid (DAT), serving as a key intermediate for the synthesis of angiotensin-converting enzyme inhibitors. The EST gene was cloned and expressed in Escherichia coli; the recombinant protein is a non-disulfide-linked homotrimer with a monomer molecular weight of 33,000 in both solution and crystalline states, indicating that these ESTs function as trimers. EST hydrolyzed DL-MATI to produce DAT with a degree of conversion of 49.5% and an enantiomeric excess value of 97.2% at an optimum pH of about 8 to 10 and an optimum temperature of about 57 to 67[degrees]C. The crystal structure of EST has been determined by X-ray diffraction to a resolution of 1.6 [Angstrom], confirming that EST is a member of the [alpha]/[beta] hydrolase fold superfamily of enzymes and includes a catalytic triad of Ser97, Asp227, and His256. The active site is located approximately in the middle of the molecule at the end of a pocket ~12 [Angstrom] deep. EST can hydrolyze the methyl ester group without affecting the acetylthiol ester moiety in DL-MATI. The examination of substrate specificity of EST toward other linear esters revealed that the enzyme showed specific activity toward methyl esters and that it recognized the configuration at C-2.

Delftia tsuruhatensis AD9 was isolated as an aniline-degrading bacterium from the soil surrounding a textile dyeing plant. The gene cluster involved in aniline degradation was cloned from the total DNA of strain AD9 into Escherichia coli JM109. After shotgun cloning, two recombinant E. coil strains showing aniline oxidation activity or catechol meta-cleavage activity were obtained by simple plate assays. These strains contained 9.3 kb and 15.4 kb DNA fragments, respectively. Sequence analysis of the total 24.7 kb region revealed that this region contains a gene cluster (consisting of at least 17 genes, named tadQTA1A2BRD1C1D2C2EFGIJKL) responsible for the complete metabolism of aniline to TCA-cycle intermediates. In the gene cluster, the first five genes (tadQTA1A2B) and the subsequent gene (tadR) were predicted to encode a multi-component aniline dioxygenase and a LysR-type regulator, respectively, while the others (tadD1C1D2C2EFGIJKL) were expected to encode meta-cleavage pathway enzymes for catechol degradation. In addition, it was found that the gene cluster is surrounded by two IS 1071 sequences, indicating that it has a class I transposon-like structure. PFGE and Southern hybridization analyses confirmed that the tad gene cluster is encoded on the chromosome of strain AD9 in a single copy. These results suggest that, in strain AD9, aniline is degraded via catechol through a meta-cleavage pathway by the chromosome-encoded tad gene cluster. The tad gene cluster showed significant similarity in nucleotide sequence and genetic organization to the plasmid-encoded aniline degradation gene cluster of Pseudomonas putida UCC22.

Pseudomonas putida PCL1445 produces two cyclic lipopeptides, putisolvins I and II, which possess surfactant activity and play an important role in biofilm formation and degradation. In order to identify genes and traits that are involved in the regulation of putisolvin production of PCL1445, a Tn5luxAB library was generated and mutants were selected for the lack of biosurfactant production using a drop-collapsing assay. Sequence analysis of the Tn5luxAB flanking region of one biosurfactant mutant, strain PCL1627, showed that the transposon had inserted in a dnaK homologue which is located downstream of grpE and upstream of dnaJ. Analysis of putisolvin production and expression studies indicate that dnaK, together with the dnaJ and grpE heat shock genes, takes part in the positive regulation (directly or indirectly) of putisolvin biosynthesis at the transcriptional level. Growth of PCL1445 at low temperature resulted in an increased level of putisolvins, and mutant analyses showed that this requires dnaK and dnaJ but not grpE. In addition, putisolvin biosynthesis of PCL1445 was found to be dependent on the GacA/GacS two-component signaling system. Expression analysis indicated that dnaK is positively regulated by GacA/GacS.

A study of fatty acid compositions in growing and resulting cells of several strains of Pseudomonas putida (P8, NCTC 10936, and KT 2440) is presented with an focus on alterations of the saturation degree, cis-trans isomerization, and cyclopropane formation. It is also demonstrated that harvesting and sample preparation for analysis could provoke the enzyme-catalyzed formation of trans fatty acids.

Pseudomonas putida strain MnB1, a biofilm-forming bacterial culture, was used as a model for the analysis of bacterial Mn oxidation in freshwater and soil environments. The distribution of Mn oxidation states was spatially heterogeneous within and between the clusters of bacterial cells and the scanning transmission X-ray microscopy was very useful for studying the hydrated interfaces between minerals and bacteria, particularly in cases where the structure of bacterial biofilms needs to be maintained.

Glucose and other C sources exert an atypical form of catabolic repression on the [[sigma].sup.54]-dependent promoter Pu, which drives transcription of an operon for m-xylene degradation encoded by the TOL plasmid pWW0 in Pseudomonas putida. We have used a genetic approach to identify the catabolite(s) shared by all known repressive C sources that appears to act as the intracellular signal that triggers downregulation of Pu. To this end, we reconstructed from genomic data the pathways for metabolism of repressor (glucose, gluconate) and nonrepressor (fructose) C sources. Since P. putida lacks fructose-6-phosphate kinase, glucose and gluconate appear to be metabolized exclusively by the Entner-Doudoroff (ED) pathway, while fructose can be channeled through the Embden-Meyerhof (EM) route. An insertion in the gene fda (encoding fructose-1,6-bisphosphatase) that forces fructose metabolism to be routed exclusively to the ED pathway makes this sugar inhibitory for Pu. On the contrary, a crc mutation known to stimulate expression of the ED enzymes causes the promoter to be less sensitive to glucose. Interrupting the ED pathway by knocking out eda (encoding 2-dehydro3-deoxyphosphogluconate aldolase) exacerbates the inhibitory effect of glucose in Pu. These observations pinpoint the key catabolites of the ED route, 6-phosphogluconate and/or 2-dehydro-3-deoxyphosphogluconate, as the intermediates that signal Pu repression. This notion is strengthened by the observation that 2-ketogluconate, which enters the ED pathway by conversion into these compounds, is a strong repressor of the Pu promoter.

The Arctic plant growth-promoting rhizobacterium Pseudomonas putida GR12-2 secretes an antifreeze protein (AFP) that promotes survival at subzero temperatures. The AFP is unusual in that it also exhibits a low level of ice nucleation activity. A DNA fragment with an open reading frame encoding 473 amino acids was cloned by PCR and inverse PCR using primers designed from partial amino acid sequences of the isolated AFP. The predicted gene product, AfpA, had a molecular mass of 47.3 kDa, a pI of 3.51, and no previously known function. Although AfpA is a secreted protein, it lacked an N-terminal signal peptide and was shown by sequence analysis to have two possible secretion systems: a hemolysin-like, calcium-binding secretion domain and a type V autotransporter domain found in gram-negative bacteria. Expression of afpA in Escherichia coli yielded an intracellular 72-kDa protein modified with both sugars and lipids that exhibited lower levels of antifreeze and ice nucleation activities than the native protein. The 164-kDa AFP previously purified from P. putida GR12-2 was a lipoglycoprotein, and the carbohydrate was required for ice nucleation activity. Therefore, the recombinant protein may not have been properly posttranslationally modified. The AfpA sequence was most similar to cell wall-associated proteins and less similar to ice nucleation proteins (INPs). Hydropathy plots revealed that the amino acid sequence of AfpA was more hydrophobic than those of the INPs in the domain that forms the ice template, thus suggesting that AFPs and INPs interact differently with ice. To our knowledge, this is the first gene encoding a protein with both antifreeze and ice nucleation activities to be isolated and characterized.

Pseudomonas putida metabolizes Phe and Tyr through a peripheral pathway involving hydroxylation of Phe to Tyr (PhhAB), conversion of Tyr into 4-hydroxyphenylpyruvate (TyrB), and formation of homogentisate (Hpd) as the central intermediate. Homogentisate is then catabolized by a central catabolic pathway that involves three enzymes, homogentisate dioxygenase (HmgA), fumarylacetoacetate hydrolase (HmgB), and maleylacetoacetate isomerase (HmgC), finally yielding fumarate and acetoacetate. Whereas the phh, tyr, and hpd genes are not linked in the P. putida genome, the hmgABC genes appear to form a single transcriptional unit. Gel retardation assays and lacZ translational fusion experiments have shown that hmgR encodes a specific repressor that controls the inducible expression of the divergently transcribed hmgABC catabolic genes, and homogentisate is the inducer molecule. Footprinting analysis revealed that HmgR protects a region in the Phmg promoter that spans a 17-bp palindromic motif and an external direct repetition from position -16 to position 29 with respect to the transcription start site. The HmgR protein is thus the first IclR-type regulator that acts as a repressor of an aromatic catabolic pathway. We engineered a broad-host-range mobilizable catabolic cassette harboring the hmgABC, hpd, and tyrB genes that allows heterologous bacteria to use Tyr as a unique carbon and energy source. Remarkably, we show here that the catabolism of 3-hydroxyphenylacetate in P. putida U funnels also into the homogentisate central pathway, revealing that the hmg cluster is a key catabolic trait for biodegradation of a small number of aromatic compounds.

The substrate specificity of polyhydroxyalkanoate (PHA) synthase 1 (PhaC[1.sub.Pp], class II) from Pseudomonas putida Gpo1 (formerly known as Pseudomonas oleovorans Gpo1) was successfully altered by localized semirandom mutagenesis. The enzyme evolution system introduces multiple point mutations, designed on the basis of the conserved regions of the PHA synthase family, by using PCR-based gene fragmentation with degenerate primers and a reassembly PCR. According to the opaqueness of the colony, indicating the accumulation of large amounts of PHA granules in the cells, 13 PHA-accumulating candidates were screened from a mutant library, with Pseudomonas putida GPp104 PH[A.sup.-] as the host. The in vivo substrate specificity of five candidates, L1-6, D7-47, PS-A2, PS-C2, and PS-E1, was evaluated by the heterologous expression in Ralstonia eutropha PHB-4 supplemented with octanoate. Notably, the amount of 3-hydroxybutyrate (short-chain-length [SCL] 3-hydroxyalkanoate [3-HA] unit) was drastically increased in recombinants that expressed evolved mutant enzymes L1-6, PS-A2, PS-C2, and PS-E1 (up to 60, 36, 50, and 49 mol%, respectively), relative to the amount in the wild type (12 mol%). Evolved enzyme PS-E1, in which 14 amino acids had been changed and which was heterologously expressed in R. eutropha PH[B.sup.-]4, not only exhibited broad substrate specificity (49 mol% SCL 3-HA and 51 mol% medium-chain-length [MCL] 3-HA) but also conferred the highest PHA production (45% dry weight) among the candidates. The 3-HA and MCL 3-HA units of the PHA produced by R. eutropha PH[B.sup.-]4/pPS-E1 were randomly copolymerized in a single polymer chain, as analytically confirmed by acetone fractionation and the [sup.13]C nuclear magnetic resonance spectrum.

Pseudomonas putida KT2440 is a soil microorganism that attaches to seeds and efficiently colonizes the plant's rhizosphere. Lysine is one of the major compounds in root exudates, and P. putida KT2440 uses this amino acid as a source of carbon, nitrogen, and energy. Lysine is channeled to [delta]-aminovaleric acid and then further degraded to glutaric acid via the action of the davDT gene products. We show that the davDT genes form an operon transcribed from a single [[sigma].sup.70]-dependent promoter. The relatively high level of basal expression from the davD promoter increased about fourfold in response to the addition of exogenous lysine to the culture medium. However, the true inducer of this operon seems to be [delta]-aminovaleric acid because in a mutant unable to metabolize lysine to [delta]-aminovaleric acid, this compound, but not lysine, acted as an elector. Effective induction of the P. putida [P.sub.davD] promoter by exogenously added lysine requires efficient uptake of this amino acid, which seems to proceed by at least two uptake systems for basic amino acids that belong to the superfamily of ABC transporters. Mutants in these ABC uptake systems retained basal expression from the davD promoter but exhibited lower induction levels in response to exogenous lysine than the wild-type strain.

The low bioavailability of nutrients and oxygen in the soil environment has hampered successful expression of biodegradation and biocontrol genes that are driven by promoters highly active during routine laboratory conditions of high availability of nutrients and oxygen. Hence, in the present study, expression of the gus-tagged genes in 12 Tn5-gus mutants of the soil microbe Pseudomonas putida PNL-MK25 were examined under various conditions chosen to mimic the soil environment: low carbon, phosphate, nitrate or oxygen, and in the rhizosphere. Based on their expression profiles, three nutrient-responsive mutant (NRM) strains, NRM5, NRM7 and NRM17, were selected for identification of the tagged genes. In strain NRM5, expression of the glutamate dehydrogenase (gdhA) gene was increased 4-9-26.4-fold under various low-nutrient conditions. In NRM?, expression of the novel NADPH : quinone oxidoreductase-like (nql) gene was consistently amongst the highest and was synergistically upregulated by low-nutrient and anoxic conditions. The cyoD gene in NRM17, which encodes the fourth subunit of the cytochrome o ubiquinol oxidase complex, had decreased expression in low-nutrient conditions but its absolute expression level was still amongst the highest. Additionally, it was independent of oxygen availability, in contrast to that in Escherichia coli.

The TtgGHI efflux pump of Pseudomonas putida extrudes a variety of antibiotics and solvents. We show that the ttgGHI operon is transcribed in vitro and in vivo from a single promoter and not from two overlapping promoters as previously proposed. The expression of this promoter is controlled by the TtgV repressor, whose operator expands through four helical turns that overlap the -10 region of the promoter. We also show that TtgV is released from its operator on binding of effectors such as aliphatic alcohols. Mutational analysis of the ttgGHI promoter revealed that substitutions at -13, -12, and -8 yielded promoters that were unable to drive transcription whereas certain mutations at -9, -11, and -6 to -3 increased expression in vivo. The cause of the increased expression was either a decrease in the affinity of the TtgV protein for its operator or an increase in the affinity of RNA polymerase for the mutant promoters.

In this work we studied involvement of DNA polymerase IV (Pol IV) (encoded by the dinB gene) in stationary-phase mutagenesis in Pseudomonas putida. For this purpose we constructed a novel set of assay systems that allowed detection of different types of mutations (e.g., 1-bp deletions and different base substitutions) separately. A significant effect of Pol IV became apparent when the frequency of accumulation of 1-bp deletion mutations was compared in the P. putida wild-type strain and its Pol Iv-defective dinB knockout derivative. Pol IV-dependent mutagenesis caused a remarkable increase (approximately 10-fold) in the frequency of accumulation of 1-bp deletion mutations on selective plates in wild-type P. putida populations starved for more than 1 week. No effect of Pol IV on the frequency of accumulation of base substitution mutations in starving P. putida cells was observed. The occurrence of 1-bp deletions in P. putida cells did not require a functional RecA protein. RecA independence of Pol IV-associated mutagenesis was also supported by data showing that transcription from the promoter of the P. putida dinB gene was not significantly influenced by the DNA damage-inducing agent mitomycin C. Therefore, we hypothesize that mechanisms different from the classical RecA-dependent SOS response could elevate Pol IV-dependent mutagenesis in starving P. putida cells.

The crotonase superfamily catalyzes different overall reactions. Bacterial (3S)-Methylglutaconyl-CoA Hydratase (MGCHS) provides an example of opportunistic evolution.

A new method that utilizes Streptomyces lividans and Pseudomonas putida as additional hosts with different expression capabilities and, which can be used for transferring environmental libraries into all three expression hosts is described. The use of the new method suggests that the three expression hosts may differ in their abilities to express gene encoding of chemically diverse small molecules.

Cr(VI) chromate is a known environmental contaminant because of the widespread use of chromium compounds by tanning, corrosion control or plating industries but bacteria can reduce chromate to the insoluble and less toxic Cr(III), thus making chromate bioremediation a matter of great interest. Studies were conducted on chromate reductase activities of two electophoretically soluble bacterial flavoproteins.

Pseudomonas putida strain mt-2 unsaturated biofilm formation proceeds through three distinct developmental phases, culminating in the formation of a microcolony. The form and severity of reduced water availability alter cell morphology, which influences microcolony size and ultrastructure. The dehydration (matric stress) treatments resulted in biofilms comprised of smaller cells, but they were taller and more porous and had a thicker extracellular polysaccharide layer at the air interface. In the solute stress treatments, cell filamentation occurred more frequently in the presence of high concentrations of ionic (but not nonionic) solutes, and these filamented cells drastically altered the biofilm architecture.

Pseudomonas putida PML2 can convert the flavonoid compound quercetin to naringenin, according to researchers who compared the metabolism of quercetin by native and mutant strains. This strain of Pseudomonas is a plant growth-promoting bacterium that lives in the rhizosphere.