Search

Changes in forest cover in the center of the East European Plain (Central Russian Upland) from the end of the 19th century to the end of 20th century have been assessed. Over that period, forest cover has increased in the northern part of the studied territory and declined in the southern part. After the end of the 1990s and beginning of 2000s, increases in forest cover occurred within the subzones of mixed coniferous–broad-leaved forest, while in the southern regions it has hardly manifested at all. The fallow land overgrowth rate, without any anthropogenic interference, has been determined for the Central Russian Upland (from 10 to 50% of fallow area has been covered by forest vegetation over a period of 10 years), decreasing gradually in from west-northwest to east-southeast. Special attention is paid to the forests that grew on nonforested lands over a period of 150 years. This process occurs everywhere in the northern part of the Upland and along the river valleys in the southern part. The forest structure of newly formed forests is studied as well (deciduous, mixed, pine, and spruce). In the southern parts of the Central Russian Upland, the newly grown forests are mostly pine plantations. The analysis of the field data suggests that, in the Central Russian Upland, within the broadleaved forests subzone, fallows are usually overgrown with birch (Betula pendula), or, less frequently, with aspen (Populus tremula). On the western and southwestern slopes, the overgrowth occurs with broadleaved (Querqus robur and Acer platanoides), small-leaved (Populus tremula), and steppe species (Prunus spinosa, Malus praecox, and Pyrus pyraster). In the south, overgrown fallows are dominated by steppe or adventive species (Acer negundo).

Wild pear (Pyrus pyraster (L.) Burgsd.) (P) and wild service tree (Sorbus torminalis (L.) Crantz) (S) are sporadic European tree species that are valued for their high-quality timber production. Although mixed plantations including companion species enhance timber quality of several trees, the performance of the association of P and S is not well known. The objective of this study was to assess growth and survival of P and S in pure plantations and in plantations mixed with other companion tree or shrub species in a non-native habitat. To answer the question of whether growth of these species is enhanced by mixtures, specific combinations of the main and companion species were established in central Chile and monitored for a 12-year period after planting. Besides each main species monoculture, five mixtures were tested: Mix1: P+S; Mix2: P+S+ the N-fixing tree Italian alder (Alnus cordata (Loisel.) Duby); and three associations of P and S including shrubs (Mix3: P+S+ Corylus avellana L., Mix4: P+S+ Sambucus ebulus L., and Mix5: P+S+ Sambucus nigra L.). Both P and S presented the highest height growth in Mix2, being 48.6% and 53.4% higher than in the monoculture, respectively. DBH growth was also enhanced in Mix2 for S. Wild service tree, which showed lower growth and survival than P, was more benefited from the mixture including Italian alder than P. Height growth, vigor and survival of the main species were highest in Mix2, even higher than in pure plantations and in Mix1 without companion species. Specific tree associations might increase the probability to obtain high-quality timber of noble species if a timely and adequate management of companion species is provided.

Pyrus pyraster is the prevailing native pear species in central Europe. The range of this forest tree species is comparatively large within the temperate zone. In most regions wild pear is very rare and considered to be seriously endangered. Thus, conservation of P. pyraster as part of the natural biodiversity is essential. The species may serve as a genetic resource in breeding programs, e.g., use of resistances existing in a wild species. A precondition for suitable conservation and breeding strategies is the identification of pure wild pears. Introgression from cultivated pears, supposed to be one major threat to the native gene pool, needs to be investigated. In total, 636 genotypes of P. pyraster and P. × communis were analysed. The 316 trees initially selected as P. pyraster originated from Germany (242) and Luxembourg (74). Pear trees growing in Germany belonged to populations in the states Rhineland-Palatinate (101), Saxony-Anhalt (120) and Saxony (21). A total of 320 cultivars, separated into old (238) and modern (82) categories, were provided by collections in Germany and Oregon/USA (NCGR, Corvallis). Accessions have been typed for eight polymorphic isozyme loci. A model-based Bayesian clustering approach was applied to all multilocus genotype data. Wild and cultivated pear trees made up two different gene pools but could not be distinguished very clearly by nuclear markers. However, modern cultivars appeared to be distinct from all other subgroups. The discrimination between 'wild' and 'cultivated' was less obvious than in European apples. The genetic result might be expected when following the evolutionary hypothesis that P. pyraster is one primary progenitor of European cultivars. Morphologically wild pears from natural sites and old cultivars looked quite different. The extent of hybridization between the two major gene pools investigated is hard to assess.

Impediments, such as tree logs, can prevent access to saplings for deer, and can increase perceived predation risk by blocking view and escape possibilities for deer in areas with large carnivores. Therefore, impediments can influence deer foraging decisions and the trade-off between safety and food of different quality indirectly influencing tree regeneration. The aim of our study was to test how the presence of an impediment affects deer foraging behavior and tree sapling performance of eight species that differ in preference by deer. We planted saplings without, nearby and inside impediments and followed their fate for three consecutive years in Bialowieza forest, Poland. We constructed 1 m high impediments of 5 × 5 m that would still allow deer to enter the impediment and forage from the saplings planted inside. However, we never recorded deer inside the impediments. Near the impediments deer visitation rate and cumulative visitation time was reduced. As a result, browsing intensity of all tree species was lower nearby and especially inside the impediment. Deer did not select different tree species without, near or inside the impediment. Due to the overall lower browsing intensity, tree saplings increased in height near the impediment and heights increased significantly within the impediment. The palatable, but browsing intolerant, Acer platanoides benefited most from the impediment as this species was highly selected and heavily browsed without an impediment. Followed by the palatable, but more browse tolerant Tilia cordata and Pyrus pyraster. In comparison, the presence of an impediment had a smaller effect on the less preferred Alnus glutinosa, Picea abies and Pinus sylvestris which survived well without an impediment. Our study showed that impediments modified deer behavior as they visited these plots less frequently and thereby indirectly reduced the browsing impact on the preferred tree species. Therefore, the potential for successful recruitment of preferred tree species is higher near an impediment, and especially when surrounded by impediment structures. In the long-term, the presence of natural impediments like tree logs allows browsing intolerant tree species to escape browsing, ultimately leading to a more diverse forest composition.

Facilitation is a positive interaction demonstrated to be one of the important factors shaping the regeneration niche of trees, mostly under stressful conditions which is currently studied in the frame of complex ecological networks. The protection provided by benefactor plants for tree seedlings playing the role of beneficiaries is documented mainly in arid and semi-arid habitats or in situations where herbivores’ pressure constitutes the main stressful factor for tree regeneration. One of the iconic Transylvanian landscapes is the wood-pasture, also one of the oldest agro-forestry systems to which recent forest expansion in abandoned agricultural fields or pastures is added. The proposed work represents a preliminary investigation on the association between benefactor plants, mostly spiny shrubs (Rosa canina, Crataegus monogyna, Prunus spinosa as the most frequently encountered benefactors) and tree seedlings (Quercus spp., Tilia spp., Carpinus betulus, Fraxinus angustifolia, Pyrus pyraster as most frequently encountered beneficiaries), in four different locations from North-Western and Western Romania, wood-pastures, abandoned pastures and abandoned agricultural fields under the consideration that the main stressful factor is represented by livestock grazing. Bipartite, qualitative merged network was generated depicting the interaction between beneficiaries and benefactors. Commonly used metrics were calculated: connectivity, nestedness, modularity, betweenness centrality and centralization compared to similar facilitation networks presented in the literature. Facilitation network is characterized by high nestedness (N=0.896), lack of modularity, relatively high connectance (C=0.233), features encountered in mutualistic networks also. Betweenness centrality scores highlighted the keystone benefactor and beneficiary species, while betweenness centralization score (0.192) indicates the fact that there are several species sharing the dominant position in terms of interactions. The analysis of measurement data (seedlings’ and benefactor plants’ heights, distance from focal seedlings to nearest benefactor species and orientation) showed that there is common pattern in orientation (most of the benefactor species oriented toward South or South West) also in dimensional variability (MANOVA results).

The functional root traits of Pyrus pyraster (L.) Burgsd. and Sorbus domestica L. during early growth stages were evaluated. The aim of the study was to identify the functional traits of root systems that determine the adaptability of these woody species to drought conditions. The experiment was carried out under the controlled environment of a growth chamber. The root systems were analyzed using WinRhizo software. Several functional root traits were identified, including specific root length, root surface area, root length, root volume, root-to-shoot mass ratio (R:S), fine root (ϕ ˂ 2 mm) volume, coarse root (ϕ > 2 mm) volume, and fine-to-coarse root volume ratio (F/C). In drought, P. pyraster maintained the absorptive root surface unchanged, when increased the volume of the fine root fraction. The different strategy of adaptation to drought has been confirmed for S. domestica, which accumulated more dry mass in the root system in comparison to aboveground organs (significant increase of R:S ratio). The functional root traits analyzed here were species-dependent. The key functional traits that indicate the responses of studied tree taxa to drought conditions include root thickening, F/C, and R:S. Increased values of these parameters indicate the investment of the plant towards root extension. A higher proportion of fine roots increases the absorbing surface of the root system, thereby promoting water uptake from the soil.

The aim of this work is to produce the generative rootstocks for the wild pears, which will be of moderate denseness. The initial material is the population of wild pear in the area of Polimlje. The study focused on few segments. Very first one included recording of the phenological traits – first flowering, full flowering, end of flowering and harvest period. The other segment comprised pomological features, i.e. physical [fruit weight (g), fruit size (mm), mass of dry seed (g), and number of seed in 1 kg of the fruit]. Seeds from 9 selected genotypes of wild pears were planted in the nursery and raised seedlings were evaluated for nursery characteristics: germination, seedling vigor, uniformidty and branching. Raised seedlings were used as rootstocks for scion cultivar ‘Grand Champion’. The most important benefit of this study is the fact that the parent trees, the seeds of which provide the best morphological and physiological characteristics for the production of generative rootstocks, were found and favored (in situ). Results of this research show that the rapid growth and uniformity of scions depend on the genetic characteristics of generative rootstocks of selected genotypes of wild pears, such as: plant height, stem diameter (corpulence), branching and uniformity. The selected genotypes, especially ‘Genotype 11’, proved to be the best for mountainous areas of the north of Montenegro, higher altitudes and poorer types of soil. The ‘Genotype 11’ is suggested as the best option for the production of generative rootstocks due to its small vigour level.

Typical symptoms of fire blight, caused by Erwinia amylovora, were observed in late June of 1998 on Crataegus monogyna Jacq. (hawthorn) and Pyrus pyraster Burgsd. (syn. P. caucasia, wild or thorny pear) in the region of Plovdiv. Symptoms observed on hawthorn were shepherd's-crook shoots, necrotic flowers and fruitlets, and dried amber ooze droplets. On thorny pear, only infected shoots were detected. Isolation on King's B medium (2 days, 26°C) resulted in the appearance of whitish, glistening, rounded colonies. Based on their cultural characteristics, positive hypersensitive response (HR) on tobacco leaves, successful laboratory inoculations of hosts' shoots and pear fruitlets, positive serological reaction (slide agglutination), and target-specific polymerase chain reaction (PCR; 23S rDNA), the isolates from both species were placed in the E. amylovora group. The bacterium has also been isolated by the first author from Cydonia oblonga, Pyrus communis, Mespilus germanica, and Malus sylvestris within the 5-year period of 1989-1993 (1). To our knowledge this is the first official report of fire blight on C. monogyna and P. pyraster in Bulgaria. Reference: (1) S. G. Bobev. 1995. Pages 121–126 in: Jubilee Scientific Session, Higher Agricultural Institute of Plovdiv, vol. 3, bk. 1. (In Bulgarian.)

European wild pear (Pyrus pyraster, syn. Pyrus communis subsp. pyraster L.) is widely distributed in Europe, but rarely studied by dendrochronologists. This preliminary study was aimed to assess the age and effect of climate on tree-ring width in the largest Polish population of P. pyraster, in Biedrusko military area (western Poland). On the basis of samples from 21 trees, a chronology (BIE) was constructed, covering 45 years (1963–2007). Mean tree-ring width in the studied trees is 1.92 mm. The performed analyses (pointer years, correlations, and response function) indicate that tree-ring width is strongly dependent on weather conditions in the year preceding formation of the tree-ring. Annual rings of pear trees were wide after cold and rainy previous summer and after rainy previous October, while in the current year, ring width was affected by insolation in February and temperature in August (positive correlations) and precipitation in May (negative correlation). The low similarity of the ring-width pattern and effect of climate on tree-ring width between this population and a wild pear population from the Bielinek Reserve, located 200 km away, indicate that tree-ring width in this species is strongly dependent on habitat and there is a need to continue dendrochronological analyses.

U prezentaciji se prikazuje stanje zaliha sadnica šumskih voćkarica u svim rasadnicima Hrvatskih šuma d.o.o. s 30.09. tekuće godine (obavezna inventura) kao i isporuka iz rasadnika u tekućoj godini za razdoblje od 2012 do 2017. godine. U navedenom razdoblju proizvodile su se i isporučivale sadnice slijedećih vrsta šumskih voćkarica: europski pitomni kesten, crni orah, divlja trešnja i divlja kruška. Posebno je prikazana rasadnička proizvodnja i isporuka šumskih voćkarica iz rasadnika Hrvatskih šuma d.o.o. u 2018. godini te količine posijanog sjemena u istoj godini (europski pitomi kesten, crni orah i divlja trešnja).

The water deficit is considered to be significant cause of photosynthesis defects. Measuring of chlorophyll fluorescence is one of the methods revealing defects in the photosynthetic apparatus. The experiment was established with two woody plant (Pyrus pyraster L. and Sorbus domestica L.) cultivated in two different regimes of the substrate saturation. The measurement of the modulated fluorescence of chlorophyll a was done by FMS1 fluorometer during three-week period between June and September (2012 and 2013). There were analysed selected parameters of chlorophyll fluorescence: Fv/Fm – maximum quantum efficiency of PSII, ΦPSII – effective quantum yield of PSII and RFD – chlorophyll fluorescence decrease ratio. According to the obtained results, Pyrus pyraster has probably higher potential for adaptation to water deficiency. There were recorded the significant decreases mainly in the values of parameter RFD and ΦPSII for Sorbus domestica within duration of experiment with different water regime in both growing seasons 2012 and 2013. The results document a weak sensitivity of the parameter Fv/Fm on changes in the amount of available water in the substrate in both taxa.

Human-wildlife conflict, especially related to crop losses, dramatically reduces tolerance towards wildlife and hinders conservation efforts. Despite being a protected species, the crested porcupine Hystrix cristata, probably an introduced species to Italy, is recorded as one of the worst agricultural pest and is extensively poached. Tree debarking by this rodent is also reported, although no quantitative information was available before this work. We analysed data on crop damages by crested porcupines from complaints obtained by two areas of Central Italy. As well, data on tree debarking were collected and examined. Our results showed that the crop damage by this species is low, even if it may sporadically account for up to 44 % the overall agricultural loss (mostly to sunflower, onion, melon and watermelon). Higher damages may occur on private small vegetable gardens, particularly on underground storage organs. Even if analysed in a single study area and for only 1 year, tree debarking occurred on less than 6 % of trees, mainly young plants (Fraxinus ornus, Ostrya carpinifolia and Pyrus pyraster), with no tree mortality.

Iran is recognized as an important source of genetic diversity of pear germplasm including native and introduced species. It is located in the Mid-Asian, center of diversification of the genus Pyrus, where several species have originated; moreover, the Silk Road historically favoured an intense exchange of cultivated crops and agricultural technologies during the course of trade and cultural transmission between ancient China and central/West Asia. Thus, Iran is maybe one of the first places where specimens of Pyrus communis imported from Europe could have come into contact with Pyrus pyrifolia, syn. P. serotina genotypes coming from eastern Asian countries. Moreover, pear species exhibit the S-RNase-based gametophytic self-incompatibility system that prevents self-fertilization thus forcing out-crossing. Since there is no major barrier for hybridization in Pyrus, several different species might have contributed to the makeup of the Iranian traditional germplasm. The characterization of self-incompatibility ribonucleases in Iranian P. communis cultivars and landrace genotypes revealed that, in addition to the pool of alleles previously detected in European cultivars, the Iranian germplasm shows the presence of alleles most likely introduced via hybridization with cultivated or wild Pyrus species. INTRODUCTION The Pyrus species belong to the subfamily Pomoideae of the Rosaceae which exhibit the so-called S-RNase based gametophytic self-incompatibility(GSI) system; this system controls pollen-pistil recognition through the action of at least two genes that are encoded at a single locus (S-locus) (De Franceschi et al., 2012). As the incompatibility mechanism prevents self-fertilization, and also the allelic composition at the S-locus determines the cross-compatibility between cultivars, knowledge of the S-genotypes of cultivars is important to guarantee efficient cross pollination in orchards and to select correct crossing combinations in breeding programs. The first characterization of the S-RNase in Rosaceae was reported by Sassa and co-workers in Japanese pear (Sassa et al., 1992). The subsequent characterization of multiple S-RNase alleles in Pyrus species facilitated further research on S-genotyping and breeding programs by cloning cDNA and genomic sequences (Ushijima et al., 1998; Zuccherelli et al., 2002; Sanzol, 2002; Takasaki et al., 2004; Sanzol et al., 2006; Moriya et al., 2007; Sanzol and Robbins, 2008; Goldway et al., 2009; Saito et al., 2011). The S-RNase gene is hetero-allelic, highly polymorphic and characteristic for each haplotype, showing enough variation to allow the development of molecular markers for S-genotyping (Goldway et al., 2009). This gene has five consensus conserved regions (C1, C2, C3, RC4, and C5) and the highly conserved non-canonical hexapeptide (IIWPNW) region located exactly downstream of the hyper-variable region (HVR), which can be used to design consensus primer pairs directed to amplify a large number of alleles for S-genotyping through a PCR assay (Sanzol, 2009). Moreover, the results of S-genotyping of wild pear by Wolko et al. (2010) showed that several alleles of Pyrus pyraster display a high degree of homology with the S-RNase alleles of Pyrus communis, Proc. I IS on Fruit Culture and Its Traditional Knowledge along Silk Road Countries Ed.: D. Avanzato Acta Hort. 1032, ISHS 2014 160 but they are not the same, hence their transfer must have occurred a long time ago. It has been proposed that the high S-allele diversity found in the wild pear population could be due to a high immigration rate of new S-alleles, which would subsequently experience positive frequency dependent (balancing) selection. Thus, the gene flow from neighboring wild populations or cultivated varieties could potentially increase the S-allele diversity in a population of wild pear (Hoebee et al., 2011). Iran is located in the Mid-Asian center of diversification, where species such as Pyrus glabra Boiss., Pyrus korshinskyi Litv., Pyrus longipes Coss. & Dur., Pyrus pashia D. Don., Pyrus regelii Rehd., and Pyrus salicifolia Pall. have originated (Kole, 2011). Moreover, as a country on the Silk Road, Iran has historically been involved in commercial exchanges between Europe and the middle and East Asian countries; it is flanked on the one side by the East Asian zone, center of origin of some important cultivated species such as Pyrus ussuriensis Maxim, Pyrus × bretschneideri Rehd. and especially P. pyrifolia (syn. P. serotina); and on the other side by Turkey and Europe, center of origin of P. communis L. (Kole, 2011). In such a position, many different species might have contributed to the Iranian traditional pear germplasm. Most notably, some of the most important Iranian cultivars are supposed to have originated by hybridization of European pear with other cultivated species, among which P. pyrifolia (syn. P. serotina) is supposed to have played the most relevant role (Sharifani et al., 2008; Erfani et al., 2012). In the present study 40 Iranian pear cultivars and wild genotypes, plus 20 European pear cultivars used as references, were genotyped using consensus and allele-specific primers, adopting the PCR-based genotyping assay described by Sanzol (2009). To assess the contribution of Japanese pear, the method was implemented to allow the detection of the most common S-RNase alleles from P. serotina. The results highlighted moreover the presence of two alleles of P. serotina in cultivars and genotypes of P. communis. MATERIALS AND METHODS Plant Material and DNA Extraction Sixty Pyrus genotypes including European and Iranian pear cultivars and landrace genotypes were analyzed in this study (Table 1). Healthy leaf material was gathered from trees maintained at the Seed and Plant Improvement Institute (SPII; Karaj, Iran), Gilan Agricultural & Natural Resources Research Center (GANRC; Gilan, Iran), West Azerbaijan Agricultural & Natural Resources Research Center (WANRC; Uromia, Iran), Research Institute of Forests & Rangelands (RIFR; Tehran, Iran), Dipartimento di Scienze Agrarie (Dipsa; Bologna, Italy) and Centro de Investigacion y Tecnologia Agroalimentaria de Aragon (CITA, Zaragoza, Spain). Leaves were deep-frozen at -80°C and lyophilized in a Heto lyophilizer (HITOSICC, Heto-Holten A/S, Denmark). For extraction of DNA, leaf tissue (0.05 g) of each genotype was ground to fine powder with a mechanical mill (Mixer Mill MM 300, Retsch GmbH & Co. KG) and DNA was extracted following a modified Cetyl Trimethyl Ammonium Bromide (CTAB) protocol (Maguire et al., 1994). DNA concentration and purity were assessed using a Nanodrop ND-1000 UV-Vis spectrophotometer (NanoDrop Technology, Rockland, DE). S-Genotyping Assay, Cloning and Sequence Analysis The PCR-based method described by Sanzol (2009) for the detection of 20 European pear S-RNase alleles was implemented with additional allele-specific primer pairs directed to amplify alleles PcS116, PcS117 and PcS125 from P. communis and also P. pyrifolia (syn. P. serotina) PpS1 to PpS9 (Table 2). All the designed primers were developed using Primer3 (Untergasser et al., 2012). PCR with the consensus Primers PycomC1F1 (5’attttcaatttacgcagcaatatcagc3’) and PycomC5R1 (5’ ctgcaaaggacctcaacc aattc 3’) and allele-specific primer pairs was performed under the following condition: 50 ng genomic DNA, 1× PCR reaction buffer, 2 mM MgCl2, 0.6 unit Taq DNA polymerase (Applied biosystem, Amplitaq Gold DNA Polymerase), 0.2 mM each dNTP

The cytotoxicity of Pyrus pyraster and Pyrus spinosa leaf and bark extracts, as well as their major compound, arbutin was tested against melanoma cell line (Fem-x) and healthy human embryonic lung fibroblast (MRC-5). The methanol extracts of P. pyraster (leaves and bark) exhibited significant cytotoxic effects towards Fem-x cells, with IC50 ranging from 11.55 to 46.78 μg/ml, and the corresponding dichlormethane extract IC50 ranging from 21.59 to 13.34 μg/ml. The dichlormethane extract of P. spinosa bark was active against both cells lines tested (IC50 11.97 and 12.92 μg/ml). Arbutin was found to be no cytotoxic against both Fem-x and MRC-5 cells in vitro with an IC50 > 200 μg/ml. Tested extracts have shown moderate and no cytotoxicity against healthy MRC-5 cell line. The wild pear’s extracts and arbutin showed antibacterial activity against all bacteria species. Minimal inhibitory concentration (MIC) ranged between 0.1-0.3 mg/ml, while minimal bactericidal concentration (MBC) was 0.2-0.3 mg/ml. All extracts and arbutin showed antifungal activities in the MIC range of 0.05-0.2 mg/ml and MFC range of 0.1-0.3 mg/ml. Key words: Pyrus pyraster, Pyrus spinosa, arbutin, antimicrobial activity, cytotoxicity.

Interspecific compatibility and self-compatibility in Pyrus communis, P. pyraster and P. salicifolia were evaluated. Degree of compatibility was determined by means of fluorescence microscope. Self-incompatibility evaluated on the basis of the pollen tubes growth showed that two cultivars of P. communis (Bera Hardy and Lukasówka) were self-compatible and the other three cultivars were self-incompatible. All ecotypes of P. pyraster are self-incompatible. In interspecific crosses full inter-incompatibility or unilateral self-incompatibility was observed.

Shoot tips of Pyrus pyraster were successfully cryopreserved by encapsulation-dehydration. Na--alginate beads each containing one shoot tip, dehydrated for 2 days in 0.75M sucrose and desiccated to 20% moisture content (fresh weight basis), gave 60% recovery after exposure to liquid nitrogen. Regenerated shoots showed no differences in length and leaf shape compared to the mother plant. Multiplication rate and rooting ability of cryopreserved shoots were lower than those of untreated controls after one subculture, but were completely restored following the third subculture. Fifteen cryopreserved lines derived from single buds were used for genetic analyses by RAPDs and SSRs, in comparison with the mother plant. In RAPD analysis, of a total of 24 primers, only 15 showed reproducible and well resolved bands and were further used. These primers produced a total of 66 fragments ranging from about 500 to 2500 base pair size. SSR (microsatellite) marker amplification was performed using 19 primers which produced 57 reproducible fragments. Microsatellites fragments ranged from 60 to 600 base pairs. Both RAPDs and SSRs did not reveal any polymorphism between cryopreserved lines and the original genotype, suggesting that cryopreservation, using encapsulation-dehydration, does not affect genetic stability of wild pear.

Genetic studies show that genetic diversity is positively correlated with population size: however, this correlation has not been found in Swiss populations of Wild Pear. The present investigation implies that the diverse historical human uses of Wild Pear populations offer an explanation for this lack of correlation. Current populations of Wild Pear are located in sparse and structured forests, often characterized by a meadow-like herb layer. For the conservation and augmentation of the mostly small Wild Pear populations, the principle of dominance reduction can be applied. It leads to a variety of light conditions within woodlands and imitates the currently abandoned historical forest uses.

Several species of shrubs and trees used in the revegetation of clay mineral soils in Northern Appennine region were compared. The trial site, a quarry land, with clay soil with high pH and a little organic matter was arranged in three randomized block designs. The trial tested the following shrub species Rhamnus cathartica, Colutea arborescens, Euonymus europea, Viburnum opulus, Sambucus nigra, Cotinus coggygria, Coronilla emerus, Crataegus monogyna, Ligustrum vulgare, Prunus spinosa, Spartium junceum, Cornus sanguinea, Paliurus spina-christi and the tree species Fraxinus excelsior, Fraxinus angustifolia, Corylus avellana, Sorbus domestica, Prunus avium, Acer monspessulanum, Ostrya carpinifolia, Pyrus communis var. pyraster, Ulmus minor, Fraxinus ornus and Acer campestre. The present study was designed to test the adaptive response of the species transplanted in clay soil without preparatory tilling or dressing operations. The overall 9 year data indicate differences in the species tested: Spartium junceum, Ligustrum vulgare and Cotinus coggygria were the shrubs adapted to these edaphics conditions and planting practises together with Sorbus domestica, Pyrus pyraster, Fraxinus ornus and Fraxinus angustifolia. Animal damages were also evaluated. Copyright © 2007 John Wiley & Sons, Ltd.

An in vitro adventitious regeneration system under selective pressure was established in Pyrus pyraster Burgsd to obtain somaclones with higher adaptability to calcareous soils. P. pyraster is important species, both for its relative closeness to cultivated pear and for reforestation of marginal farmland and for the production of timber. Shoot regeneration was induced from leaves and vegetative apices of in vitro-grown shoots on a modified LP medium supplemented with naphtaleneacetic acid (1.07 microM) and benziladenine (BA, 8.9 microM). After 30 days, explants were transferred to an expression medium consisting of the same basal medium with only BA present. Selective treatments utilized MS medium with Fe-EDTA replaced by equimolar amount of FeSO4 with either KHCO(3) or NaHCO(3). Through the selection process 11 putatively tolerant lines were obtained from vegetative shoot apices. RAPD analysis was performed on these lines to allow comparison to the mother clone. A total of seven 10-mer primers were used to amplify all the genotypes and 74 scorable fragments were produced. These were analysed using the Dice similarity index, showing genetic variability among the 11 regenerated clones and between them and the mother clone.

Wild pear (Pyrus pyraster (L.) Burgsd.) is one of Switzerland's rare and endangered tree species. However, its status and situation are unknown, since it is difficult to distinguish from cultivated pear (Pyrus communis L.). The objective of this investigation was to find traits or combinations of traits, which allow the identification and distinction of wild and cultivated pear and to estimate the degree of purity of remaining populations.

Wild pear (Pyrus pyraster, syn. P. communis var. pyraster) is thought to be one of the species that gave rise to all other members of the genus Pyrus, although intraspecific hybridizations with cultivated varieties could cause the disappearance of original species characteristics. S-RNase alleles from 7 different wild pear individuals, collected from various regions of Poland, were cloned on the basis of the PCR method and nucleotide sequence analyses. The hypervariable (HV) region is responsible for allele-specific S-RNase activity in the self-incompatibility mechanism. The high level of polymorphism of its sequences may constitute a source of valuable phylogenetic information. From all individuals, 14 sequences were obtained successfully, and 9 of them were novel alleles. Phylogenetic analysis of these alleles was based on the amino acid sequence interpretation of coding regions and intron nucleotide sequences. The research conducted on a limited pool of available P. pyraster alleles gives only an initial insight into possible S-RNase allele polymorphisms in wild populations. At this stage, the results do not confirm a strong influence of cultivated pear species on the wild pear.

U završnom radu prikazana je morfološka varijabilnost listova divlje kruške na području Vinkovaca. U uvodnom dijelu općenito se govori o morfologiji, području prirodne rasprostranjenosti, staništu, primjeni te varijabilnosti i očuvanju genofonda istraživane vrste. Uzorci listova za morfometrijsku analizu sakupljeni su s 10 stabala. Listovi su herbariziran te zatim skenirani i izmjereni pomoću računalnog programa WinFOLIA. Za svaku mjernu morfološku značajku te za izvedene omjere određeni su sljedeći deskriptivni statički pokazatelji: aritmetička sredina, standardna devijacija, raspon i koeficijent varijabilnosti. Kako bi se utvrdile sličnosti, odnosno razlike između istraživanih stabala korištena je klasterska anliza. Provedenim istraživanjem utvrđena je velika varijabilnost listova divlje kruške, kao i velika varijabilnost između istraživanih stabla.

353-366 Water shortage limits the production of fruit orchards, such as pear, in arid and semi-arid regions. The identification of wild pear germplasm for potential use as rootstock would be valuable for pear cultivation in semi-arid regions. The relative drought tolerance of wild pear germplasm (Pyrus boisseriana) from three different populations distributed along an elevational gradient ('semi-arid 1, 000', 'semi-wet 1, 350' and 'semi-wet 1, 600' populations) was evaluated in a greenhouse trial. Established container-grown seedlings were exposed to 18 days of simulated drought, or not, followed by a seven day recovery period. Biomass allocation and accumulation, physiological (stomatal conductance, photosynthesis, transpiration, xylem water potential) and biochemical parameters (leaf pigments, free proline, malondialdehyde and hydrogen peroxide production) were evaluated. Although all populations were able to recover from water shortage, thereby proving to be relatively drought tolerant, some differences between populations were detected for gas exchange parameters, biomass accumulation and proline concentration in favor of the 'semi-arid 1, 000' elevation population, which was more drought tolerant. This population showed the most rapid and complete recovery of physiological activity (stomatal conductance and carbon fixation). In addition, all populations showed an increase in carotenoid content in the leaves. Overall, we showed that plants from the 'semi-arid 1, 000' elevation had greater tolerance to drought than those from the higher elevations (semi-wet populations). It therefore appears that plants from the 'semi-arid 1, 000' elevation represent a promising source of material to be tested as rootstock for commercial scions of pear in field conditions in areas prone to suffer from water deficit.

Journal of Heredity, 103 (2), ISSN:0022-1503, ISSN:1465-7333

Wild apple (Malus sylvestris /L./ Mill.) and wild pear (Pyrus pyraster /L./ Burgsd.) are direct ancestors of modern apple (M. domestica Borkh.) and pear (P. communis L.) cultivars grown and utilized for human consumption. These endangered species are native to central, western and southern Europe. They occur in a scattered distribution pattern as single individuals or in small groups. In late summer of 2012 and 2013, leaves of 140 wild pear and 61 wild apple trees from ten locations across Croatia were collected and tested for presence of phytoplasma DNA. Disease symptoms (yellowing leaves) were observed on nine apple and five pear trees that were sampled. Leaf veins were excised for total DNA extraction using CTAB containing extraction buffer as described in Šeruga et al. (2003) and amplification of phytoplasma 16S rRNA gene by using generic primers P1/P7 in a direct PCR assay followed by a nested PCR using primer pair R16F2n/R2 (Gundersen and Lee 1996). DNA isolation and PCR were performed twice with phytoplasma DNA extracts from infected in vitro grown Catharatnus roseus plants as positive controls as well as appropriate negative controls (DNA extracts from healthy plants and water control). Amplicons from consistently positive samples (~1, 2 kb) were subjected to (I) restriction fragment length polymorphism (RFLP) using restriction endonucleases AluI, KpnI and MseI, and to (II) reamplification of the phytoplasma DNA using original extracts with P1/P7 direct, followed with R16F2n/R2 nested primer pairs, purification using PCR purification kit (Qiagen), and sequencing. Sequences produced that way were searched for in the NCBI database using BLAST tool and identified. In total, phytoplasma DNA was detected in four wild pears (two of them being completely asymptomatic) and two wild apple samples from three different locations in Croatia. Their 16S rDNA sequences (NCBI accessions KP006694-KP006699) and RFLP patterns indicated the following affiliations: phytoplasmas from two wild pear trees and one wild apple tree from Moslavačka Gora (MOS_P13: KP006695, MOS_P5: KP006696 and MOS_M4: KP006698) belonged to Apple proliferation group (SrX) (100% identity with KJ676480 for example) ; phytoplasmas from one wild pear tree from Brinje (BR_P18: KP006694) and one from Moslavačka gora (MOS_P14: KP006697) belonged to Aster yellows group (SrI) (100% identity with KP662136 for example) and phytoplasma from one wild apple tree sampled in Vinkovci (VK_M4: KP006699) belonged to X–disease group (SrIII) (99% identity with KC283217 for example). This is the first report of wild apple infected with SrIII group phytoplasma, and third accidental finding of a phytoplasma belonging to this group in Croatia (Ježić et al. 2013). Phytoplasmas belonging to SrI and SrX groups were previously reported in Croatia on fruit trees grown in orchards (Križanac et al. 2010). Our findings confirm the presence of phytoplasmas belonging to these three groups (SrI, SrIII and SrX) in new hosts - wild apples and pears. The results imply that these phytoplasmas might infect a number of yet unknown hosts that either do not show any symptoms or show weak, uncharacteristic symptoms. Furthermore, they might pose a threat to commercially grown pears and apples.

Pyrus communis Linnaeus var. pyraster Linnaeus, Species Plantarum 1:479. 1753. RCN: 3660. Type not designated. Original material: Herb. Burser XXIII: 37? (UPS). Current name: Pyrus pyraster (L.) Burgsd. (Rosaceae)., Published as part of Jarvis, Charlie, 2007, Chapter 7: Linnaean Plant Names and their Types (part P), pp. 718-782 in Order out of Chaos. Linnaean Plant Types and their Types, London :Linnaean Society of London in association with the Natural History Museum on page 781, DOI: 10.5281/zenodo.291971

The modern nursery industry requires seed sources of a high quality and regular quantity year by year. Besides the seed sources of processed cultivars (Bartlett pear, Shipley, Elberta peach) special seed orchards are planted with selected seed trees producing high quality and genetically determined seed (hybrid seed or inbred lines). Seedlings are still the most common commercial source of rootstocks for stone fruits (almond, apricot, peach, plum, prune and walnut). Although clonal rootstocks are spreading, usage of seedlings is still predominant at stone fruits and nuts. For successful seed production and planning of seed orchard the knowledge on floral biology, flower fertility, pollination, blossom time of trees (selected clone or cultivars) used for seed production is essential. In this field very little systematic research was carried out most of the papers were published in the second half of the 20th century. Our mini review gives an overview on the importance of flower fertility in the mating systems applied in seed orchards, and the research results on floral biology of fruit tree rootstocks propagated by seed (Prunus avium, Prunus mahaleb, Prunus armeniaca, Prunus cerasifera, Prunus insititia, Prunus amygdalus, P persica, P amygdalopersica, Pyrus pyraster, Pyrus communis and Pyrus betulifolia) over the last decades.

International audience; The second EUFORGEN Noble Hardwoods Network meeting was held from 22 to 25 March1997. The workplan established at the previous meeting (held in Escherode, Germany, in March 1996) was revised during the working sessions of the meeting. The individual activities listed in the workplan resulted in outputs such as the European gene conservation strategy for four genera and groups of species, the common list of descriptors, literature reviews, overview of ongoing research projects, summary of the evaluation methods for genetic resources and a public awareness leaflet. Most of these outputs are provided in this volume and are also available electronically on the Internet.

The occurrence of 10 lower taxa within species Pyrus pyraster L. (Burgsd.) was confirmed in Slovakia. Among 507 of the evaluated plants on 64 localities, there were recorded 2 sub-species of the wild pear - Pyrus pyraster subsp. pyraster and Pyrus pyraster subsp. achras. Subspecies pyraster was represented by 4 varieties ( pyraster, elongata, penzesiana, brachypoda) and 5 forms ( populifolia, cordifolia, rhomboidea, ovata, slovenica). All lower taxa were visu - ally classified according to the leaf and fruit characteristics. Numerical classification based on discriminant analysis according to quantitative traits was done. Some discrepancies were found up to 16.7% between visual and numerical classification on particular levels of the lower taxa identification.