Search

Objective: To evaluate the efficacy of traditional Chinese medicine (TCM) for preventing acute mountain sickness (AMS). Methods: We included randomized controlled trials (RCTs) which evalueded the effect of TCM for preventing AMS, compared with a placebo, no treatment or acetazolamide. The literature was searched in 6 major databases. RevMan 5.4 software was used for the meta-analysis. The relative risk for discrete variables and the mean difference for continuous variables with 95% confidence intervals (CIs) were applied to express the effect size. The risk of bias in the included studies was evaluated using the Cochrane risk assessment tool 2.0 (RoB 2.0), and the evidence certainty was assessed using the Grading of Recommendations Assessment and the Development and Evaluation (GRADE) approach. Results: Twenty RCTs involving 3015 participants and 16 TCM patent drugs were included. The overall risk of bias in the majority of studies (15/20) was of some concerns. In terms of the AMS incidence, Rhodiola rosea (R. rosea, Hong Jing Tian) and Ginkgo biloba (G. biloba, Yin Xing Ye) were equivalent to the placebo/no treatment [RR (95% CI): 0.66 (0.43–1.01), 0.82 (0.63–1.06), respectively]. The AMS incidence in the G. biloba group was higher than that in the acetazolamide group [RR (95% CI): 2.92 (1.69–5.06)]. In terms of improving the AMS symptom score on days 1 and 3 in the plateau, R. rosea and G. biloba were superior to the placebo or no treatment [MD (95% CI): -0.98 (-1.71, -0.25), -2.05 (-3.14, -0.95), respectively]. The other 14 Chinese patent medicines were evaluated in a single trial, and the majority of the results were negative. The subgroup analysis showed that the effect of R. rosea was related to the intervention time, way of ascending, and altitude. Conclusion: R. rosea and G. biloba were effective in improving AMS symptoms but had no effect in reducing the AMS incidence. There was insufficient evidence to support the use of other TCM patent drugs to prevent AMS. More randomized double-blind placebo-controlled trials are warranted to evaluate and screen effective Chinese patent medicines for AMS prevention.

Maize (Zea mays) is one of the most important food crops in the world with the greatest global production, and contributes to satiating the demands for human food, animal feed, and biofuels. With population growth and deteriorating environment, efficient and innovative breeding strategies to develop maize varieties with high yield and stress resistance are urgently needed to augment global food security and sustainable agriculture. CRISPR-Cas-mediated genome-editing technology (clustered regularly interspaced short palindromic repeats (CRISPR)-Cas (CRISPR-associated)) has emerged as an effective and powerful tool for plant science and crop improvement, and is likely to accelerate crop breeding in ways dissimilar to crossbreeding and transgenic technologies. In this review, we summarize the current applications and prospects of CRISPR-Cas technology in maize gene-function studies and the generation of new germplasm for increased yield, specialty corns, plant architecture, stress response, haploid induction, and male sterility. Optimization of gene editing and genetic transformation systems for maize is also briefly reviewed. Lastly, the challenges and new opportunities that arise with the use of the CRISPR-Cas technology for maize genetic improvement are discussed.

Crop breeding is an important global strategy to meet sustainable food demand. CRISPR/Cas is a most promising gene-editing technology for rapid and precise generation of novel germplasm and promoting the development of a series of new breeding techniques, which will certainly lead to the transformation of agricultural innovation. In this review, we summarize recent advances of CRISPR/Cas technology in gene function analyses and the generation of new germplasms with increased yield, improved product quality, and enhanced resistance to biotic and abiotic stress. We highlight their applications and breakthroughs in agriculture, including crop de novo domestication, decoupling the gene pleiotropy tradeoff, crop hybrid seed conventional production, hybrid rice asexual reproduction, and double haploid breeding; the continuous development and application of these technologies will undoubtedly usher in a new era for crop breeding. Moreover, the challenges and development of CRISPR/Cas technology in crops are also discussed.

Maize (Zea mays L.) is a food crop with the largest planting area and the highest yield in the world, and it plays a vital role in ensuring global food security. Conventional breeding methods are costly, time-consuming, and ineffective in maize breeding. In recent years, CRISPR-Cas editing technology has been used to quickly generate new varieties with high yield and improved grain quality and stress resistance by precisely modifying key genes involved in specific traits, thus becoming a new engine for promoting crop breeding and the competitiveness of seed industries. Using CRISPR-Cas, a range of new maize materials with high yield, improved grain quality, ideal plant type and flowering period, male sterility, and stress resistance have been created. Moreover, many patents have been filed worldwide, reflecting the huge practical application prospects and commercial value. Based on the existing patent data, we analyzed the development process, current status, and prospects of CRISPR-Cas technology in dissecting gene function and creating new germplasm in maize, providing information for future basic research and commercial production.

Objective: To evaluate whether the traditional Chinese medicine (TCM) theory of five circuits and six qi (FCSQ) is beneficial in terms of improving clinical effectiveness. Methods: Randomized controlled trials (RCTs) evaluating the clinical value of FCSQ theory were reviewed. Multiple databases (China Network Knowledge Infrastructure, Chinese Scientific Journals Database, Wanfang Data, SinoMed, Cochrane Library, PubMed, and Embase) were systematically searched from inception to June 12, 2018. Two authors independently extracted the data and performed a methodological quality assessment of the RCTs. RevMan 5.3 software was used for the data analysis. The effect sizes for the primary outcome measures were expressed as relative risks or mean differences with 95% confidence intervals. Results: A total of 13 RCTs were selected, involving 12 types of diseases and 4695 patients. The methodological quality of the RCTs was generally low. Five studies compared the effectiveness of TCM treatments guided by FCSQ theory with conventional TCM therapies, and the remaining eight studies compared the effectiveness of TCM treatments guided by FCSQ theory with biomedical treatments. All of the RCTs reported that the effectiveness of the treatment intervention was better than that of the intervention in the control group. Conclusion: Because of many methodological problems in existing clinical studies, it remains impossible to definitively conclude that FCSQ theory can improve clinical effectiveness. It is difficult to unify the clinical application of FCSQ theory. The feasibility and repeatability of FCSQ as an intervention should be given more attention in future clinical research. Future work should also follow international norms for clinical research implementation and reporting to provide high-quality evidence for evaluating the clinical value of FCSQ theory. Keywords: Five circuits and six qi, Randomized controlled trial, Effectiveness, Evaluation

With the widespread cultivation of transgenic crops, there is increasing concern about unintended effects of these crops on soil environmental quality. In this study, we used the Biolog method and ELISA to evaluate the possible effects of OsrHSA transgenic rice on soil microbial utilization of carbon substrates under field conditions. There were no significant differences in average well-color development (AWCD) values, Shannon–Wiener diversity index (H), Simpson dominance indices (D) and Shannon–Wiener evenness indices (E) of microbial communities in rhizosphere soils at eight samplings between OsrHSA transgenic rice and its non-transgenic counterpart. The main carbon sources utilized by soil microbes were carbohydrates, carboxylic acids, amino acids and polymers. The types, capacities and patterns of carbon source utilization by microbial communities in rhizosphere soils were similar throughout the detection period. We detected no OsrHSA protein in the roots of OsrHSA transgenic rice. We concluded that OsrHSA transgenic rice and the rHSA protein it produced did not alter the functional diversity of microbial communities in the rhizosphere.

Glyphosate is a widely used herbicide, due to its broad spectrum, low cost, low toxicity, high efficiency, and non-selective characteristics. Rice farmers rarely use glyphosate as a herbicide, because the crop is sensitive to this chemical. The development of transgenic glyphosate-tolerant rice could greatly improve the economics of rice production. Here, we transformed the Pseudomonas fluorescens G2 5-enolpyruvyl shikimate-3-phosphate synthase (EPSPS) gene G2-EPSPS, which conferred tolerance to glyphosate herbicide into a widely used japonica rice cultivar, Zhonghua 11 (ZH11), to develop two highly glyphosate-tolerant transgenic rice lines, G2-6 and G2-7, with one exogenous gene integration. Seed germination tests and glyphosate-tolerance assays of plants grown in a greenhouse showed that the two transgenic lines could greatly improve glyphosate-tolerance compared with the wild-type; The glyphosate-tolerance field test indicated that both transgenic lines could grow at concentrations of 20,000 ppm glyphosate, which is more than 20-times the recommended concentration in the field. Isolation of the flanking sequence of transgenic rice G2-6 indicated that the 5′-terminal of T-DNA was inserted into chromosome 8 of the rice genome. An event-specific PCR test system was established and the limit of detection of the primers reached five copies. Overall, the G2-EPSPS gene significantly improved glyphosate-tolerance in transgenic rice; furthermore, it is a useful candidate gene for the future development of commercial transgenic rice.

In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

Background: Ischemic stroke (IS) is more common every year, the condition is serious, and have a poor prognosis. New, efficient, and safe therapeutic targets are desperately needed as early treatment especially prevention and reperfusion is the key to lowering the occurrence of poorer prognosis. Generally circulating proteins are attractive therapeutic targets, this study aims to identify potential pharmacological targets among plasma and cerebrospinal fluid (CSF) proteins for the prevention and treatment of IS using a multicenter Mendelian randomization (MR) approach. Methods: First, the genetic instruments of 734 plasma and 151 CSF proteins were assessed for causative connections with IS from MEGASTROKE consortium by MR to identify prospective therapeutic targets. Then, for additional validation, plasma proteins from the deCODE consortium and the Fenland consortium, as well as IS GWAS data from the FinnGen cohort, the ISGC consortium and UK biobank, were employed. A thorough evaluation of the aforementioned possible pharmacological targets was carried out using meta-analysis. The robustness of MR results was then confirmed through sensitivity analysis using several techniques, such as bidirectional MR analysis, Steiger filtering, and Bayesian colocalization. Finally, methods like Protein-Protein Interaction (PPI) Networking were utilized to investigate the relationship between putative drug targets and therapeutic agents. Results: The authors discovered three proteins that may function as promising therapeutic targets for IS and meet the Bonferroni correction (P< 0.05/885=5.65 × 10-5). Prekallikrein (OR= 0.41, 95% CI: 0.27-0.63, P=3.61 × 10-5), a protein found in CSF, has a 10-fold protective impact in IS, while the plasma proteins SWAP70 (OR= 0.85, 95% CI: 0.80-0.91, P=1.64 × 10-6) and MMP-12 (OR= 0.92, 95% CI: 0.89-0.95, P= 4.49 × 10-6) of each SD play a protective role in IS. Prekallikrein, MMP-12, SWAP70 was replicated in the FinnGen cohort and ISGC database. MMP-12 (OR =0.93, 95% CI: 0.91-0.94, P <0.001), SWAP70 (OR= 0.92, 95% CI: 0.90-0.94, P< 0.001), and prekallikrein (OR =0.53, 95% CI: 0.33-0.72, P<0.001) may all be viable targets for IS, according to the combined meta-analysis results. Additionally, no evidence of reverse causality was identified, and Bayesian colocalization revealed MMP-12 (PPH4= 0.995), SWAP70 (PPH4=0.987), and prekallikrein (PPH4=0.894) shared the same variant with IS, supporting the robustness of the aforementioned causation. Prekallikrein and MMP-12 were associated with the target protein of the current treatment of IS. Among them, Lanadelumab, a new drug whose target protein is a prekallikrein, may be a promising new drug for the treatment of IS. Conclusion: The prekallikrein, MMP-12, and SWAP70 are causally associated with the risk of IS. Moreover, MMP-12 and prekallikrein may be treated as promising therapeutic targets for medical intervention of IS. [ABSTRACT FROM AUTHOR]

Copyright of Agricultural Science & Technology is the property of Hunan Academy of Agricultural Sciences and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Transgenic safety issues cause more and more controversies with the planting area of transgenic crops increased year by year. Gene flow from transgenic crops to wild relatives through pollen dispersal is one of the focus problems. Gene splitting technique provides a new strategy for the control of transgene flow by biological containment. The construction of gene splitting technique is based on protein trans-splicing mediated by intein. Currently, it has been proved in Arabidopsis, tabacco, wheat, etc. that active and functional proteins can be reassembled by intein mediated protein trans-splicing after gene splitting, which provides theoretical basis and experimental supporting for the limit of transgene flow by gene splitting technique. The theoretical basis of gene splitting technique and research progresses of its application on the control of transgene flow were reviewed in this paper. [ABSTRACT FROM AUTHOR]

Insect resistance and herbicide tolerance are the dominant traits of commercialized transgenic cotton. In this study, we constructed a general standard reference plasmid for transgenic cotton detection. Target genes, including the cowpea trypsin gene cptI, the insect resistance gene cry1Ab/1Ac, the herbicide tolerance gene cp4-epsps, the Agrobacterium tumefaciens nopaline synthase (Nos) terminator that exists in transgenic cotton and part of the endogenous cotton SadI gene were amplified from plasmids pCPT1, pBT, pCP4 and pBI121 and from DNA of the nontransgenic cotton line K312, respectively. The genes cry1Ab/1Ac and cptI, as well as cp4-epsps and the Nos terminator gene, were ligated together to form the fusion genes cptI-Bt and cp4-Nos, respectively, by overlapping PCR. We checked the validity of genes Sad1, cptI-Bt and cp4-Nos by DNA sequencing. Then, positive clones of cptI-Bt, cp4-Nos and Sad1 were digested with the corresponding restriction enzymes and ligated sequentially into vector pCamBIA2300, which contains the CAMV 35S promoter and nptII gene, to form the reference plasmid pMCS. Qualitative detection showed that pMCS is a good positive control for transgenic cotton detection. Real-time PCR detection efficiencies with pMCS as a calibrator ranged from 94.35% to 98.67% for the standard curves of the target genes (R2≥0.998). The relative standard deviation of the mean value for the known sample was 11.95%. These results indicate that the strategy of using the pMCS plasmid as a reference material is feasible and reliable for the detection of transgenic cotton. Therefore, this plasmid can serve as a useful reference tool for qualitative and quantitative detection of single or stacked trait transgenic cotton, thus paving the way for the identification of various products containing components of transgenic cotton. [ABSTRACT FROM AUTHOR]