Search

Abstract: The cyclic AMP (cAMP)/protein kinase A (PKA) cascade plays a central role in cardiomyocyte proliferation and apoptosis. Here, we show that H2O2 stimulates expression of the antiapoptotic myocardial ischemic preconditioning up-regulated protein 1 (Mipu1) gene in H9c2 cardiomyocytes through a pathway involving the cAMP-response element binding protein (CREB). Stimulation of H9c2 cardiomyocytes with H2O2 resulted in increased Mipu1 promoter activity. Analysis of the rat Mipu1 promoter revealed two potential cAMP-response elements, one of which (CRE-II, TGTGGATGTTGACGAGCTTGT) was shown, using mutagenesis and deletion analysis, to be functional. Subsequent studies established that H2O2 increased phosphorylation of CREB serine 133 through a pathway involving PKA activation. Phospho-CREB was demonstrated to bind to CRE-II of the Mipu1 promoter, and H2O2 treatment resulted in increases in their interaction as assessed by ChIP. Furthermore, H2O2-mediated up-regulation of Mipu1 protein expression was abrogated by the suppression of CREB expression with small interfering RNA of CREB. It was demonstrated that the H2O2-induced up-regulation of Mipu1 in H9c2 cardiomyocytes was mediated by cAMP/PKA-dependent CREB activation. [Copyright &y& Elsevier]

Scleroderma (systemic sclerosis, SSc) is a complex autoimmune disease caused by progressive fibrotic replacement of normal tissue architecture, a progressive and ultimately fatal process that currently has no cure. Although dysregulation of microRNAs (miRNAs) is known to be involved in a variety of pathophysiologic processes, the role of miRNAs in SSc is unclear. In comparison with the normal skin tissues, miRNAs were aberrantly expressed in limited cutaneous scleroderma and diffuse cutaneous scleroderma skin tissues. We also identified miRNAs whose expressions were correlated with SSc fibrosis: miR-21, miR-31, miR-146, miR-503, miR-145, and miR-29b were predicted to be involved. This study further confirmed that miR-21 was increased whereas miR-145 and miR-29b were decreased both in the skin tissues and fibroblasts. As predicted target genes, SMAD7, SAMD3, and COL1A1 were regulated by these miRNAs. After stimulation with transforming growth factor β, the expression of miR-21 was increased and that of SMAD7 mRNA was decreased. MiR-145 was upregulated whereas the mRNA level of SMAD3 was downregulated. The downregulation of miR-29b was correlated with the upregulation of COL1A1 mRNA. MiRNAs might play an important role in the pathogenesis of SSc and suggest a potential therapy. [ABSTRACT FROM AUTHOR]

Aims Doxorubicin (DOX) is an anthracycline drug with a wide spectrum of clinical antineoplastic activity, but increased apoptosis has been implicated in its cardiotoxicity. Resveratrol (RES) was shown to harbour major health benefits in diseases associated with oxidative stress. In this study, we aimed to determine the effect of RES on DOX-induced myocardial apoptosis in mice. Methods and results Male Balb/c mice were randomized to one of the following four treatments: saline, RES, DOX, or RES plus DOX (10 mice in each group). DOX treatment markedly depressed cardiac function, decreased the heart weight, the body weight, and the ratio of heart weight to body weight, but inversely increased the level of protein carbonyl, malondialdehyde, and serum lactate dehydrogenase, and induced mitochondrial cytochrome c release and cardiomyocyte apoptosis. However, these effects of DOX were ameliorated by its combination with RES. Further studies with a co-immunoprecipitation assay revealed an interaction between p53 and Sirtuin 1 (SIRT1). It was found by western blot and electrophoretic mobility shift assay that DOX treatment increased p53 protein acetylation and cytochrome c release from mitochondria, activated p53 binding at the Bax promoter, and up-regulated Bax expression, but supplementation with RES could weaken all these effects. Conclusion The protective effect of RES against DOX-induced cardiomyocyte apoptosis is associated with the up-regulation of SIRT1-mediated p53 deacetylation. [ABSTRACT FROM AUTHOR]

• The abnormal expression of piRNA and PIWI protein in diabetes and cardiovascular disease is associated with disease progression. • Serum extracellular vesicles-related piRNA has been detected in a surprisingly stable form and defined as a potential disease biomarker and a novel therapeutic target in CVD. • piRNA promotes the occurrence and development of CVD mainly through piRNA/LINE-1/AKT, AKT and AMPK signal pathways. Cardiovascular disease (CVD) is still one of the most significant diseases and is a considerable threat to human health globally. PIWI-interacting RNAs (piRNAs) are novel small noncoding RNAs (ncRNAs) traditionally considered to be specifically expressed in the germline of many animal species and involved in the maintenance of germline stem cells and spermatogenesis. Although little is known about the origin and action of piRNAs and PIWI proteins in somatic cells, these molecules are emerging as readily available biomarkers for the diagnosis and treatment of cardiac injury and multiform CVD. Accumulating evidence reveals that piRNAs and PIWI proteins are associated with some molecular and cellular pathways in CVD. Here, we summarize recent evidence and evaluate the molecular mechanism of the involvement of piRNAs and PIWI proteins in CVD. [ABSTRACT FROM AUTHOR]

• We summarized the role of circRNA in the pathogenesis of diabetic cardiomyopathy. • CircRNA defined as a potential biomarker and a novel therapeutic target in diabetic cardiomyopathy. • We reviewed the biogenesis and function of circRNA can better understand circRNAs and effectively control diabetic cardiomyopathy. Diabetic cardiomyopathy is an important irreversible chronic cardiovascular complication in diabetic patients. This condition is described as early diastolic dysfunction, myocardial fibrosis, cardiac hypertrophy, systolic dysfunction and other complex pathophysiological events, which ultimately lead to heart failure. Despite these characteristics, the underlying mechanisms resulting in diabetic cardiomyopathy are still unknown. With the developments in molecular biotechnology, increasing evidence shows that circRNAs play critical roles in the pathogenesis of diabetic cardiomyopathy. The purpose of this review is to summarize recent studies on the role of circRNAs in the pathophysiological process to provide novel prevention and treatment strategies for diabetic cardiomyopathy, oxidative stress, inflammation, endothelial dysfunction, myocardial fibrosis and cell death in diabetic cardiomyopathy. [ABSTRACT FROM AUTHOR]

• Accumulating experiments revealed TGF-β signaling pathway plays a protective role in the development of AAAs. Besides, some dysregulated miRNAs implicated in the process of AAAs expansion, and miRNA-based therapeutics have been shown to be effective in inhibiting AAAs development. • Interaction between TGF-β signaling and miRNAs could influence the process of VSMC preservation, inflammation, and ECM degradation characterized in AAA pathology. • Given the protective role of the TGF-β signaling pathway in AAAs, it is meaningful to find more relevant miRNAs that regulate the TGF-β signaling pathway. Abdominal aortic aneurysms (AAA) are permanent and irreversible local dilatations of the abdominal aortic wall. Recent data indicate that the transforming growth factor-beta (TGF-β) signaling pathway exerts a protective effect on the development of AAA. Some dysregulated microRNAs (miRNA) also appear involved in the expansion of AAA and miRNA-based therapeutics have been shown to effectively inhibit this process. New evidence has revealed that TGF-β signaling and miRNA interaction may of physiologic and pathophysiologic significance including the progression of AAA. As such, miRNA that regulate TGF-β signaling may hold promise as potential therapeutic targets. This review explores potential crosstalk between TGF-β signaling and miRNA in AAA in order improve our understanding of this pathology and explore development of potential therapeutic targets. [ABSTRACT FROM AUTHOR]

• Some drugs affect the synthesis of bile acid by regulating intestinal microbiota. • GUDCA or intestinal FXR may become a target for the treatment of metabolic diseases. • Clinical trials of FXR agonist for the treatment of NAFLD have shown good prospects. Studies have demonstrated that intestinal microbiota is associated with various metabolic diseases including obesity, nonalcoholic fatty liver, and insulin resistance. Farnesoid X receptor (FXR), also known as the bile acid receptor, belongs to the nuclear receptor superfamily, which is involved in the regulation of bile acid, glucose, and lipid metabolism. Researchers have found that intestinal microbiota can regulate FXR activity by affecting bile acid composition, and then regulate the balance of in vivo metabolism. The intestinal microbiota -FXR axis may be an ideal drug target for metabolic diseases. This review summarizes the latest research on the intestinal microbiota /FXR axis, hoping to provide a theoretical basis for further research and clinical application. [ABSTRACT FROM AUTHOR]

PIWI‐interacting RNAs (piRNAs) are a kind of non‐coding small RNAs, which play a biological role by specifically binding to PIWI proteins. Studies have demonstrated that piRNAs play a significant role in germline cell growth by repressing transposable elements, especially in the regulation of DNA methylation. Recently increasing evidence revealed that piRNAs involved in the regulation of cell proliferation, apoptosis, and cycle; however, the mechanism of piRNAs is unclear. This review summarizes the research progress regarding the roles of piRNAs in the cell proliferation, apoptosis, and cycle. [ABSTRACT FROM AUTHOR]

Vascular calcification is associated with adverse cardiovascular events that increase the risk of cardiovascular death. Unfortunately, the pathogenesis of vascular calcification is complex and incompletely understood. As important intercellular signaling molecules, the role of extracellular vesicles (EVs) in vascular calcification has attracted wide attention in recent years. This review will briefly describe the role of EVs (mainly including exosomes and microvesicles) in the process of vascular wall calcification focusing on the specific mechanisms of smooth muscle cell (SMC) differentiation and calcium-phosphorus balance to illustrate the relationship between EVs and vascular calcification. It is likely that EVs may be prognostic markers in some cardiovascular diseases and have potential therapeutic potential. • Vascular calcification is an abnormal mineralization that occurs in the cardiovascular system. • Vascular calcification results in reduced elasticity of the vessel wall and impaired vascular structural integrity. • EVs promote vascular calcification through smooth muscle differentiation, calcium‑phosphorus balance and Other mechanisms. • EVs have Marking and therapeutic effects in vascular calcification. [ABSTRACT FROM AUTHOR]

Extracellular vesicles (EVs), which exist in human blood, are increased in some inflammation-related cardiovascular diseases. EVs are involved in inflammation, immunity, signal transduction, cell survival and apoptosis, angiogenesis, thrombosis, and autophagy, all of which are highly significant for maintaining homeostasis and disease progression. Therefore, EVs are also associated with key steps in atherosclerosis, including cellular lipid metabolism, endothelial dysfunction and vascular wall inflammation, ultimately resulting in vascular remodelling. In this review, we summarize recent studies on EV contents and biological function, focusing on their potential effect in atherosclerosis, including cholesterol metabolism, vascular inflammation, angiogenesis, coagulation and the development of atherosclerotic lesions. EVs may represent potential biomarkers and pharmacological targets for atherosclerotic diseases. • EVs involve in inflammation, immunity, signal transduction, cell apoptosis, angiogenesis, thrombosis, and autophagy. • EVs are associated with the key steps of atherosclerosis, and ultimately resulting in vascular remodelling. • EV may be as potential biomarkers and pharmacological targets for atherosclerotic diseases. [ABSTRACT FROM AUTHOR]

Farnesoid X receptor (FXR) is a transcription factor that can be activated by bile acid as well as influenced bile acid metabolism. β-cell bile acid metabolism is mediated by FXR and closely related to the regulation of blood glucose (BG). FXR can regulate BG through multiple pathways. This review summarises recent studies on FXR regulation of BG balance via bile acid regulation, lowering glucagon-like peptide-1 (GLP-1), inhibiting gluconeogenesis, increasing insulin secretion and enhancing insulin sensitivity. In addition, the current review provides additional insight into the relationship between FXR and BG which may provide a new theoretical basis for further study on the role of FXR. • Bile acid (BA) metabolism is closely related to the blood glucose, and BA metabolism in β-cell is mediated by FXR. • FXR can lowering Glucagon-Like Peptide-1(GLP-1) levels, inhibiting glyconeogenesis and affecting insulinfunction. • FXR has the potential to be a target for a diabetes treatment. [ABSTRACT FROM AUTHOR]

Diabetic cardiomyopathy (DCM) is a common heart disease in patients with diabetes mellitus (DM), and is sometimes its main cause of death. Among all the causes of DCM, myocardial cell death is considered to be the most basic pathological change. Furthermore, studies have shown that pyroptosis, the pro-inflammatory programmed cell death, contributes to the progress of DCM. MicroRNAs (miRNAs) also have been proved to take part in the formation of DCM. However, it is not clear whether and how miRNAs regulate myocardial cell pyroptosis in DCM development. In our study, the results showed that the expression of miR-223–3p was significantly increased in cardiomyocytes induced by high glucose, whereas the down-regulation of miR-223–3p weakened it. To understand the signal transduction mechanism of miR-223–3p leading to pyroptosis, we found inhibition of miR-223–3p expression down-regulated caspase-1, pro-inflammatory cytokines IL-1β and other pyroptosis-associated poteins. Moreover, miR-223–3p repressed SPI1 expression. Furthermore, we silenced SPI1 with siRNA to mimic the effect of miR-223–3p, up-regulating the expression of caspase-1 and resulting to pyroptosis. The above findings inspired us to propose a new signaling pathway to regulate scoria of cardiomyocytes under hyperglycemia: miR-223–3p↑→ SPI1↓→ caspase-1↑ → IL-1β and other pyroptosis-associated poteins↑→ pyroptosis↑. In summary, miR-223–3p could be a potential therapeutic target for DCM. • Diabetic cardiomyopathy(DCM) is a common cardiac condition in patients with diabetes mellitus. • Pyroptosis, the pro-inflammatory programmed cell death, contributes to the progress of DCM. • MiR-223–3p expression substantially increased in high glucose-induced cardiomyocytes. • We unraveled a new pathway composed of miR-223–3p and SPI1 that regulates myocardial pyroptosis. [ABSTRACT FROM AUTHOR]

Diabetes-related cardiovascular disease (CVD) is a global health issue that causes thousands of people's death around the world annually. Diabetes-related CVD is still prevailing despite the progression being made in its diagnosis and treatment. Therefore it is urgent to find therapeutic strategies. to prevent it. MicroRNA (miRNA) is a single-stranded non-coding RNA involved in the process of post-transcriptional control of gene expression in eukaryotes. A large number of literatures reveal that miRNAs are implicated in diabetes-related CVD. The increase of miRNAs in exosomes may promote the occurrence and development of diabetes-related cardiovascular complication. However, some other studies identify that miRNAs in exosomes are supposed to be involved in cardiac regeneration and confer cardiac protection effect. Therefore, targeting the miRNA in exosome is regarded as a potent therapeutic measure to alleviate diabetes-related CVD. In this article, we review current knowledge about the role of exosomal miRNAs in diabetes-related cardiovascular complication, such as coronary heart disease, Peripheral artery disease, stroke, diabetic cardiomyopathy, diabetic nephropathy and diabetic retinopathy. Exosomal miRNAs are considered to be central regulators of diabetes-Related CVD and provide a therapeutic tool for diagnosis and treatment of diabetes-related cardiovascular complication. [Display omitted] [ABSTRACT FROM AUTHOR]

Constitutive heat shock protein 70 (Hsc70) is a molecular chaperone that has been shown to protect cardiomyocytes against oxidative stress. However, the molecular mechanism responsible for this protection remains uncertain. To understand the mechanism associated with the myocardial protective role of Hsc70, we have embarked upon a systematic search for Hsc70-interacting proteins. Using adenosine diphosphate (ADP) affinity chromatography and mass spectrometry, we have identified α-enolase, a rate-limiting enzyme in glycolysis, as a novel Hsc70-interacting protein in the myocardium of both sham and myocardial ischemia-reperfused Sprague-Dawley rat hearts. This interaction was confirmed by co-immunoprecipitation (IP) assays in the myocardial tissues and H9c2 cardiomyocytes and protein overlay assay (POA). It was further shown that Hsc70-overexpression alleviated the H2O2-induced decrease of α-enolase activity and cell damage, and Hsc70 deficiency aggravated the decrease of α-enolase activity and cell damage in H2O2 treated H9c2 cells. Our research suggests that the protective effect of Hsc70 on the cardiomyocytes against oxidative stress is partly associated with its interaction with α-enolase. [ABSTRACT FROM AUTHOR]