Search

Banana bract mosaic virus (BBrMV), belongs to the genus Potyvirus and it is an important viral pathogen of bananas and plantains. The eukaryotic translation initiation factor, eIF4E, and its isoform play key roles during the virus infection in plants, particularly Potyvirus. The present study was undertaken to determine the role of BBrMV-viral protein genome-linked (VPg) in virus infectivity by analyzing the interaction with the eukaryotic translation initiation factor eIF4E through yeast two-hybrid system. The results suggest that plantain cv. Nendran eIF4E plays an essential role in the initiation of the translation of capped mRNAs and its association with VPg would point to a role of the viral protein in the translation of the virus and may potentially contribute to BBrMV resistance. ELECTRONIC SUPPLEMENTARY MATERIAL: The online version of this article (10.1007/s13337-021-00672-9) contains supplementary material, which is available to authorized users.

The online version contains supplementary material available at 10.1007/s13337-022-00788-6.

Mungbean yellow mosaic India virus (MYMIV) is a representative of the genus begomovirus/Begomoviridae, which is prevalent in the northern part of Indian subcontinent causing yellow mosaic disease (YMD). This virus is rapidly evolving and breaking the resistance in the advanced lines causing huge economic losses in the pulse production. In this context, the present investigation on characterization of the causal organism of YMD was undertaken METHODS AND RESULTS: A novel recombinant isolate (YMV-BG-BPT) causing YMD was identified from blackgram in Andhra Pradesh, southern peninsular region of India. The association of a bipartite begomovirus with the disease was done by sequence analyses of the cloned full-length genome. The full length genome sequences were submitted in NCBI GenBank with accession numbers MZ235792 (DNA-A) and MZ356197 (DNA-B). The sequence analysis of DNA-A of YMV-BG-BPT showed maximum of 99.12% similarity at nucleotide level with Mungbean yellow mosaic India virus (MYMIV) isolate reported from Tamil Nadu (KC911719), India which is also confirmed by clustering pattern in phylogenic analysis and DNA-B showed 95.79% with Mungbean yellow mosaic virus (MYMV) isolate reported from Tamil Nadu (KP319016) and 95.05% with MYMIV isolate reported from Karnataka (MT027037). The huge variation in DNA-B lead us to suspect a recombination in DNA-B, where a recombination event in the CR, region coding for nuclear shuttle protein and movement protein of DNA B was detected in which MYMV-BG-AP-IND (KF928962) and MYMIV-GG-CH-IND (MN020536) have been identified as major and minor parents, respectively.Overall, the present study revealed occurrence of MYMIV with recombinant DNA B component in southern peneinsular India.

In the present study, BiYO3/RGO composite, is successfully synthesized by simple calcination method without the aid of any surfactants. The morphology, structural, and optical properties of the composite are examined by XRD, FTIR, XPS, SEM, and TEM analyses. The electrochemical properties of BiYO3 incorporated RGO showed higher surface area, good electrical conductivity, and lower resistivity than the pure BiYO3. It is revealed that the RGO facilitated faster ion diffusion pathway for the improved redox activity in the BiYO3/RGO composite. Furthermore, the BiYO3/RGO composite possesses higher specific capacitance of 725 Fg-1 at a current density of 2 Ag-1.

Banana bract mosaic virus (BBrMV) is a serious constraint in Musa spp. and Musa textilis causing enormous economic losses to growers. The distribution of the virus in various parts of the seeds, flower and leaf tissues of seedlings from banana plants of a synthetic diploid, H-201, naturally infected in the field was determined by Plate-trapped antigen coating enzyme-linked immunosorbent assay (PTA-ELISA), reverse transcriptase (RT) polymerase chain reaction (RT-PCR), quantitative RT-PCR (qRT-PCR) analysis and sequencing. RT-PCR and qRT-PCR results revealed the presence of BBrMV in embryo, endosperm and seed coat of seeds from infected plants. Nucleotide sequencing of the RT-PCR amplicons confirmed the BBrMV infection in seed. Quantification of BBrMV in various parts of seed by qRT-PCR using SYBR Green chemistry revealed that the viral load was maximal in the endosperm followed by seed coat and embryo. In a seed growth test, thirteen seedlings, that were raised from embryos of infected seeds in vitro and twenty seedlings raised from infected seeds in pots, expressed typical symptoms of bract mosaic virus disease and were confirmed RT-PCR positive for the virus. This finding will have significant implications in banana breeding programmes.

The purpose of the present study attempt to investigate the antioxidant and antimicrobial activities of isolated bioactive compound from ethanolic extract of Euclea crispa (E. crispa) leaves. Column chromatography method was used to isolate the bioactive compound from the plant leaves followed by UV-Spectroscopy. FT-IR, 1H and 13C NMR analyses were used to identify the structure of the isolated compound. Subsequently, the antioxidant activity was demonstrated by 2, 2-diphenyl-1-picryl-hydrazyl (DPPH) radical scavenging assay, reducing power assay, ferric reducing antioxidant power (FRAP) assay, hydroxyl scavenging assay and nitric oxide scavenging assay while disc-diffusion assay was used to analyze the antimicrobial activity. The NMR and other spectral data confirmed that the isolated compound was (6E, 10E)-2, 6, 24-trimethylpentacosa-2, 6, 10-triene (compound-1). The DPPH radical scavenging (116.1 ± 0.9 μg/ml), hydroxyl scavenging (118.9 ± 1.0 μg/ml) and nitric oxide scavenging (124.3 ± 0.2 μg/ml) showed the significant half maximal inhibitory concentration (IC50) values on compound-1 suggesting good antioxidative potential. Additionally, it exhibited considerable activity in reducing power and FRAP (the maximum absorption of 0.41 ± 0.02 and 0.54 ± 0.02 at 500 μg/ml, respectively) when compared with standard drug. Furthermore, compound-1 showed maximum antimicrobial activity with inhibition zone against the tested microorganism of Staphylococcus aureus, Streptococcus aureus, Escherichia coli, Klebsiella pneumonia, Aspergillus niger and Aspergillus terreus. Conclusively, the isolated bioactive compound-1 from E. crispa leaves could be a new source of natural antioxidative and antimicrobial agents with potential value.

Mungbean yellow mosaic India virus (MYMIV) is one of the most serious commonly occurring yellow mosaic virus (YMV’s) group in majority of the pulses especially black gram and green gram in southern India compared to previously reported mungbean yellow mosaic virus. In January 2020 Desmodium laxiflorum and Abelmoscus moschatus showing mosaic symptoms and vein yellowing were collected from Guntur and Prakasam districts respectively in Andhra Pradesh. PCR analysis using MYMIV and betasatellite specific primers gave desired expected amplification from the infected samples of A. moschatus (YMV-ABEL) whereas only MYMIV specific amplification was obtained in D. laxiflorum (YMV-DES). However, no PCR amplification was obtained in respective healthy leaf samples of both plants. Sequence analysis showed that the CP sequence of YMV-ABEL and YMV-DES showed a similarity of 99.19% with MYMIV (KP677496) and 99.75% with MYMIV (JN181003) respectively. The full-length betasatellite (1356 bp) showed highest identity of 90% with bhendi yellow vein mosaic betasatellite (BYVMB) (GU111977). Phylogenetic analysis clustered the test isolates with south Indian isolates of MYMIV whereas the betasatellite sequence clustered with various isolates of BYVMB, tomato leaf curl New Delhi virus betasatellite and okra leaf curl betasatellite reported from India and Pakistan. To the best of our knowledge, this is the first report of a MYMIV in D. laxiflorum and A. moschatus and MYMIV betasatellite complex in A. moschatus.

Rhizome rot or soft rot disease is one of the major problems in banana (Musa spp.) cultivation, as it causes germination failure and death of early stage plants. A roving survey conducted during 2017 to 2019 in the major banana growing states of India indicated a 5-30% incidence of rhizome rot in commercial cultivars. The symptoms observed were yellowing of leaves, necrotic drying with or without heart rot, and yellow or brown water soaked spots with dark brown margins in the rhizomes. Decay of tissues, cavity formation and brown ooze with foul smell, and toppling were also observed. To isolate bacteria, dissected diseased tissues were surface sterilized and plated on Crystal Violet Pectate (CVP) medium. Of 60 samples plated on CVP medium, three samples collected from cvs. NeyPoovan-AB (Karur, Tamil Nadu, 10°56'36.8"N;78°24'12.5"E), Grand Naine-AAA (Tiruchirappalli, Tamil Nadu, 10°47'26.1"N;78°34'14.8"E) and Thellachakkarakeli-AAA (East-Godavari, Andhra Pradesh, 16°51'32.1"N;81°46'08.4"E), did not yield any bacteria; however, when plated on nutrient agar, they produced whitish to dull white, mucoid, raised, round and translucent colonies, and three isolates were named as NPK-3-48, GTC-5 and 1-1B-3, respectively. Because these colonies were distinct from colonies obtained on CVP medium (which were analyzed and confirmed separately as Pectobaterium sp.) (Gokul et al. 2019), they were further characterized. Amplification of 16S rDNA genes of NPK-3-48, GTC-5 and 1-1B-3 isolates using universal primers (27F 5' - AGAGTTTGATCCTGGCTCAG - 3'; 1492 R 5' - GGTTACCTTGTTACGACTT - 3') and rpoB gene (Rosenblueth et al. 2004) was carried; the amplicons were sequenced and deposited in NCBI (Accessions MW036529-MW036531; MW497572-MW497574). Phylogenetic analysis of rpoB clearly showed that the isolates NPK-3-48, GTC-5, 1-1B-3 are Klebsiella variicola (Rosenblueth et al. 2004) Besides, biochemical tests also indicated that all three isolates were Gram negative, catalase positive, oxidase negative and able to utilize glucose, maltose and citrate (Ajayasree and Borkar 2018). Therefore, the above said morphological, molecular and biochemical analyses carried out indicated that NPK-3-48, GTC-5, 1-1B-3 are of K. variicola. Earlier, K. variicola causing soft rot has been reported on banana in China (Fan et al. 2016), plantain soft rot in Haiti (Fulton et al. 2020) and carrot soft rot in India (Chandrashekar et al. 2018). For pathogenicity tests, these three isolates were grown in nutrient broth for 48 h at 37±1°C and the cells were harvested by centrifugation. Five milliliters of the culture suspension (2×108 CFUmL-1) taken in a syringe was injected into rhizomes of three month old tissue cultured Grand Naine plants. Each bacterial isolate was injected into eight banana plants at soil level. Appropriate controls were maintained. Inoculated plants were maintained in a glasshouse at 32±2°C and after 30-35 days, rhizome rot symptoms appeared in all the three bacterial isolates inoculated plants but in none of the control plants. The Koch's postulates were proved by re-isolation and identification.To the best of our knowledge, this is the first report of K. variicola causing rhizome rot disease of banana in India.

Floriculture flourished as an important fast-emerging sector of horticulture in the last few decades and is being viewed as a high growth industry in the world. Rapid urbanization, increased income levels, changes in lifestyles and social values resulted in increase in domestic and world market for flower crops significantly. Flower crops are propagated using various seed materials and modern methods, and the crops like gladiolus, tuberose and lily are mainly propagated by bulbs. Viruses are the major limiting factor and a major concern in the production of bulbous ornamentals. Bulbs, the propagating material usually harbour many viruses and act as the primary source of inoculum to cause diseases in the main crop. The viruses present in the bulbs infect the main crop, spread to healthy plants secondarily through various sap feeding insect vectors, such as aphids. Among the plant viruses, the single stranded RNA genome viruses like CMV, BYMV, TuMMoV, LSV, LMoV, TBV, TNV, TRV are considered as major constraints of bulbous ornamental flower production of the bulbous flower crops. Various methods such as electron microscopy, ELISA and PCR based technologies have been successfully developed and are being employed in the diagnosis and detection of the important viruses infecting bulbous ornamental crops. Management of these economically important viruses is successful when integration of multiple methods such as use of virus free certified planting materials and timely management of vectors in the field. In this chapter, we described the symptoms, transmission, characterization, diagnosis, and the management aspects of various taxonomic groups of viruses infecting above mentioned ornamentals.

The families of viruses possessing single-stranded (ss) circular genome employ a dedicated replication initiator protein (Rep) for making copies of their genome through the process of rolling circle replication. The replication begins at conserved nonanucleotide sequence at the intergenic region. The Rep protein seems to be the most conserved amongst the available proteins of the nanovirids and comprises of the N-terminal endonuclease domain and the C-terminal helicase domain. The structural studies of Faba bean necrotic yellows virus endonuclease domain suggests a α + β fold comprising of central β sheet built from five antiparallel β strands surrounded by outer short α helices. The catalysis is mediated by a conserved Tyr residue and employs divalent metal ions (Mn2+). On one hand, the Reps associate with each other and oligomerize and on the other hand interact with varied host and vector associated proteins for successful infection. The sequence analysis of Reps from previously known nanovirids and the newly found ones from metagenomics data shed light on the evolutionary pattern of nanovirids in comparison to other plant infecting ssDNA viruses.

Rhizospheric and endophytic bacteria isolated from the roots and corms of banana were tested to find out their efficiency in controlling against banana bunchy top virus (BBTV). Bioformulations of m...

We determined the complete genome sequence of a sacbrood virus (SBV) infecting Indian honey bee (Apis cerana indica) from Tamil Nadu, India named as AcSBV-IndTN1. The genome of AcSBV-IndTN1 comprised of 8740 nucleotides, encoding a single large ORF containing 2849 amino acids flanked by 5′ and 3′ untranslated regions. Results of phylogenetic tree analysis based on complete genomes of SBV isolates indicated that the virus isolates from India isolated from the Asiatic honey bee A. cerana (AcSBVs) formed a separate group along with six Vietnam isolates and three Chinese isolates. The AcSBV-IndTN1 isolate showed closer genetic relationship with other isolates from India. The second major group had both AcSBVs and AmSBVs (virus isolated from European honey bee, Apis mellifera SBV) of Korea, China and Vietnam. The third and a distantly related group had AmSBVs of Australia, UK, USA and Korea. The results obtained from phylogenetic analysis were further supported with evolutionary distance analysis. AcSBV-IndTN1 isolate open reading frame had 95–99% amino acid sequence similarity with other Indian isolates and 92–96% with AcSBVs and AmSBVs of other geographical locations. In addition, sequence difference count matrix ranged from 154 to 907 nt among all the SBV isolates. This suggests that the virus isolates have evolved significantly in different geographical locations but isolates on different hosts in a given location/country are closely related. The high similarity in the genome among the AcSBV and AmSBV isolates indicate possible cross-infections and recombination of SBV isolates in Asian continent where both the honey bee species are reared in close proximity. Gene flow between SBV population indicating that an infrequent gene flow occur between them. The pattern of molecular diversity in SBV population revealed that the occurrence of recent population expansion of SBV. To the best of our knowledge this is the first report of the complete nucleotide sequence of AcSBV from Tamil Nadu, India. This study provided an opportunity to establish the molecular evolution of SBV isolates and shall be useful in the development of diagnostics and effective disease control strategies. ELECTRONIC SUPPLEMENTARY MATERIAL: The online version of this article (10.1007/s13337-018-0490-0) contains supplementary material, which is available to authorized users.

Banana bract mosaic virus (BBrMV), a member of the genus Potyvirus, family Potyviridae, is an important viral pathogen affecting banana and plantains in India. The present study was undertaken to determine the genetic variation and molecular evolution of BBrMV infecting different cultivars of banana and plantain in the Indian subcontinent, based on the viral genome-linked protein (VPg) gene. Sequence identity of this gene from 29 BBrMV isolates showed a range of nucleotide (nt) and amino acid (aa) identity of 75–100% and 95–100%, respectively. Phylogenetic analysis based on nt revealed that except for two isolates (TN1 and TN2), all the other Indian isolates clustered together. Different functional motifs of the VPg gene previously reported were found to be conserved. A single possible recombination event was detected using a recombination detection programme. A codon-based selection analysis revealed that most of the codons in the VPg gene were under purifying selection except for those at position 46, 47, 71, 107, 149, 153, 156, 175, 176, and 178, which were under positive selection. Gene flow between different Indian populations of BBrMV from banana was relatively low. This is the first report on genetic diversity and evolution of the VPg gene of BBrMV. Since VPg is identified as a virulence determinant in resistance mediated by the eukariotic intiation factor 4E (eIF4E) in several plant-potyvirus interactions, any mutation in the VPg interacting domain may abolish the interaction with eIF4E or its isoforms in vitro and prevent viral infection in planta. Therefore, understanding the population structure of BBrMV based on VPg would potentially provide insight into the diversification and infection cycle of this virus.

Objective: The purpose of the study was to examine the substantivity of a new disinfectant against biofilm formation in the dental unit waterlines. Materials and Methods: Twenty dental units were selected for the study and divided into two groups: Group A (dental unit waterlines treated with the disinfectant) and Group B (untreated dental unit waterlines). Biofilm formation was monitored in both groups by removing the one dental unit waterline from each group for the period of 10 days. One inch of the dental unit waterline tube was cut at random site, and the inner lumen of the cut sections was analyzed using the scanning electron microscope (SEM) (TESCAN VEGA3 SBU). Results: On examination, SEM images showed that there was no slime layer or bacterial cells seen in cut section for the period of 7 days in the treated dental waterlines, which means that there is no evident of biofilm formation. In the untreated dental unit waterline cut section, slime layer was observed from day 1. Conclusion: Disinfectant solution was proved to be effective for 7 days against biofilm formation. This technique could be used as a valid method for disinfection of dental unit waterlines.

Banana streak MY virus (BSMYV) is the causal agent of viral leaf streak disease of banana, which leads to considerable losses in banana production in most of the banana-growing regions worldwide. Developing high-throughput virus detection system is essential for managing viral diseases especially in vegetatively propagated crops like banana. In this study, viral-associated protein (VAP) coded by ORF II of BSMYV was expressed in Escherichia coli, and polyclonal antibodies were raised against purified recombinant VAP (rVAP) fusion protein in rabbits. Specificity and sensitivity of resulting antibodies were tested in Western blot, immunosorbent electron microscopy (ISEM) and enzyme-linked immunosorbent assays (ELISAs). In direct antigen-coated (DAC)-ELISA, antibodies reacted specifically to BSMYV in crude sap, up to 1 : 8000 dilutions, but not to healthy leaf extracts. Using this antiserum, an immunocapture polymerase chain reaction (IC-PCR) assay was developed and compared with DAC-ELISA. VAP antibody-based IC-PCR is highly specific and could differentiate episomal virus infection from the integrated endogenous BSV (eBSV) sequences. The recombinant antibodies were validated by testing with a large number of banana germplasm conserved in the field gene bank. Field samples collected during surveys and mother cultures used in tissue culture propagation suggest that antibodies generated against rVAP are sensitive and useful for large-scale detection of BSMYV. To the best of our knowledge, this is the first report on the production of polyclonal antiserum against recombinant VAP of BSMYV and its suitability for serology-based testing by ELISA and IC-PCR. This VAP-based immunodiagnosis can be applied in quarantine, germplasm exchange and certification programmes.

Coconut palm (Cocos nucifera L.), a versatile tree crop with multifarious uses, is important for the livelihood security of millions of people in India. Root (wilt) disease (RWD) is a major production constraint causing an estimated yield loss of 968 million nuts in southern India. Affected palms show bending of leaflets (flaccidity), foliar yellowing, and marginal necrosis. Phytoplasmas have been observed to be associated with this disease by electron microscopy (EM) and transmission (3) but not characterized. Attempts made in the past decade to detect a phytoplasma associated with RWD through PCR using universal primers had inconsistent results so we designed two primer sets (1F7 [AGTGCTTAACACTGTCCTGCTA]/7R3 [TTGTAGCCCAGATCATAAGGGGCA], 3Fwd [ACCTGCCTTTAAGACGAGGA]/3Rev [AAAGGAGGTGATCCATCCCCACCT]) and seminested primer pair 1F7/7R2 (GACAAGGGTTGCGCTCGTTTT), 3Fwd/5Rev (ACCCCGAGAACGTATTCACCGCGA) from sequencing of a 1.8-kb fragment (GenBank No. FJ794816) amplified by primers P1/P7 from a diseased sample. These new primer pairs were used for the detection of phytoplasma from five symptomatic and five asymptomatic palms from Kasaragod (where disease is not endemic), 14 symptomatic palms from Kayamkulam (endemic area), and 10 palms from disease-free areas (Kidu, Karnataka) using PCR. DNA was extracted from 3 g of spindle leaf (two to three leaflets) midrib tissues using a modified phytoplasma enrichment protocol in which an addition of 5% polyvinylpolypyrrolidone (MW of 40,000) during tissue grinding was essential. PCR was performed for 35 cycles with an annealing temperature of 63°C to avoid nonspecific amplification. A 1.3-kb amplicon was seen in two of the five samples and the positive control sample (sugarcane grassy shoot DNA) using the seminested primer pair 3Fwd/3Rev–3Fwd/5Rev. The amplicons were cloned and sequenced and a representative sequence was deposited in GenBank (GQ850122). With the 1F7/7R3-1F7/7R2 seminested primers, a 493-bp product was obtained from 13 of 14 palms from Kayamkulam and all five diseased palms from Kasaragod. No amplification was seen from healthy palms. A BLAST search showed that the RWD phytoplasma 16S rRNA gene sequence has >96% nt identity with 16SrXI and 16SrXIV group phytoplasmas and 99% identity with sugarcane white leaf phytoplasma (AB052874), On the basis of the identity of the 16Sr RNA gene 3Fwd/5Rev region, RWD phytoplasma belongs to the 16SrXI group. A phylogenetic tree (neighbor-joining method) also revealed clustering of the coconut phytoplasma with the 16SrXI group phytoplasmas and virtual restriction fragment length polymorphism analysis (4) also placed it into group 16SrXI. Other phytoplasmas infecting coconut are found in groups 16SrIV (1) and 16SrXIV (2). Our RWD phytoplasma sequence does not match an earlier reported Kerala (wilt) coconut phytoplasma sequence (AY158660) and the latter sequence does not have similarity with any known phytoplasma sequences in the database. To our knowledge, this is first report of the association of 16SrXI group phytoplasma with the root wilt disease of coconut in India. These findings could be used for the early detection of root wilt disease phytoplasma in breeding materials and to develop a DNA-based diagnostic kit. References: (1) N. A. Harrison et al. Ann. Appl. Biol. 153:85, 2008. (2) N. Nejat et al. Am. J. Appl. Sci. 6:1331, 2009. (3) M. Sasikala et al. Eur. J. Plant Pathol. 94:191, 2005. (4) Y. Zhao et al. Int. J. Syst. Evol. Microbiol. 59:2582, 2007.

Banana bunchy top disease (BBTD) caused by banana bunchy top virus (BBTV) is one of the most serious viral diseases of banana and plantains. BBTV is transmitted by Pentalonia nigronervosa (Hemiptera, Aphididae) in a persistent circulative manner. Better knowledge of vector–virus–host relationship and the mechanism of transmission is essential for developing an effective control strategy. In this study, the viral copies in single to group of aphids with different acquisition access period (AAP) were quantified using SYBR green-based quantitative polymerase chain reaction (qPCR). The result indicated that a single aphid was able to acquire 861.04 copies of the virus after 24 h of AAP from the infected banana plant and transmitted the virus to 16.6% tissue culture plants, whereas 50 viruliferous aphids (15,066.94 viral copies) were necessary to achieve 100% transmission in a shortest time of 21.6 days. The number of viral copies acquired by the aphids were gradually increased with increased AAP. Hundred percent transmission was observed with 20 aphids in 48 h of AAP or 30–50 aphids in 24 h of AAP. The inoculated plants expressed typical bunchy top symptoms quickly when higher number of aphids (30 and above) were used with 24 h of AAP. Further, we report that the tissue culture banana plants are highly prone or vulnerable to BBTV infection compared to sucker grown plants. We conclude that higher the number of viral copies in the vector, higher the percent transmission and quicker the symptom expression and the results will contribute to a better understanding of vector–BBTV interactions and useful for epidemiological studies.

Banana bract mosaic virus (BBrMV) is a serious pathogen threatening the cultivation of banana and plantain worldwide. This study reports the development of a practical, rapid, sensitive, specific and user-friendly lateral flow immunoassay (LFIA) test for the on-site detection of BBrMV. The BBrMV coat protein (CP) was expressed in Escherichia coli and purified and used to immunize rabbits to produce a polyclonal antiserum (anti-BBrMVCP). The test was based on a double-antibody sandwich format. Protein-A affinity column-purified anti-BBrMVCP Immunoglobulins (IgG) (16 μg/mL), conjugated to ∼30 nm gold nanoparticles, was applied onto the conjugate pad. The anti-BBrMVCP IgG and goat anti-rabbit IgG were printed on the surface of a nitrocellulose filter membrane as the test line and control line, respectively. A positive result could be confirmed visually by the presence of a pink band that developed on the LFIA strip within 5−10 min. The detection limit of the test was 10 ng of the expressed recombinant BBrMV CP (rBBrMVCP), and a 1:20 dilution of the BBrMV-infected crude extract. This LFIA test was validated using 114 banana leaf samples randomly collected from the field and the results indicated a very high diagnostic sensitivity (99.04 %) and specificity (100 %) for the test. A Cohen's kappa coefficient of 0.861 obtained also indicated a very good agreement between the LFIA developed in this study and ELISA. This assay could be adopted by farmers, tissue culture industries and quarantine departments for surveys and surveillance. This is the first report on the development of a LFIA-based test for BBrMV detection.

The families of viruses possessing single-stranded (ss) circular genome employ a dedicated replication initiator protein (Rep) for making copies of their genome through the process of rolling circle replication. The replication begins at conserved nonanucleotide sequence at the intergenic region. The Rep protein seems to be the most conserved amongst the available proteins of the nanovirids and comprises of the N-terminal endonuclease domain and the C-terminal helicase domain. The structural studies of Faba bean necrotic yellows virus endonuclease domain suggests a α + β fold comprising of central β sheet built from five antiparallel β strands surrounded by outer short α helices. The catalysis is mediated by a conserved Tyr residue and employs divalent metal ions (Mn(2+)). On one hand, the Reps associate with each other and oligomerize and on the other hand interact with varied host and vector associated proteins for successful infection. The sequence analysis of Reps from previously known nanovirids and the newly found ones from metagenomics data shed light on the evolutionary pattern of nanovirids in comparison to other plant infecting ssDNA viruses. ELECTRONIC SUPPLEMENTARY MATERIAL: The online version of this article (doi:10.1007/s13337-019-00514-9) contains supplementary material, which is available to authorized users.

Banana bunchy top virus (BBTV), a type member of the genus Babuvirus of the family Nanoviridae, is a multicomponent single-stranded DNA virus which infects banana and plantain in most parts of the world where it is grown, leading to serious losses in production. It was reported as early as in 1880 in Fiji and later it spread to all the continents except the Americas. Banana bract mosaic virus (BBrMV), a species in the genus Potyvirus (family Potyviridae), is of recent origin in banana. It causes serious losses to the banana in the Philippines and India. It was authentically reported from the Philippines in 1989 and later from India and Sri Lanka. The genetic diversity and population structure of the viruses is very important to develop strategies to design better management options. In cases of multicomponent viruses like BBTV, reassortment, recombination, and mutations are the main mechanisms of genetic changes and evolution, whereas recombination is more common in BBrMV. RNA viruses are known to evolve very quickly owing to their high replication rate, short generation times, and error-prone RNA polymerases which lead to mutations. These genetic variabilities occurring in viruses will be fixed if they are advantageous for the virus to survive and adapt to various conditions. The selection pressure determines the fixation of mutation, recombination, and reassortment in a population. Many systematic studies have been performed on diversity and population structure of BBTV, whereas work on the BBrMV is limited. Based on the studies, the movement of BBTV appears to be neither consistent with the movement of banana across the globe nor with the human-mediated transcontinental spread, but it is relatively through infrequent movement events over the past 300 years from its centers of diversity in India and Southeast Asia (SEA). In this chapter, the genetic diversity of two banana viruses having DNA and RNA genomes—BBTV and BBrMV, respectively—are dealt with in detail. The causes of genetic diversity such as reassortment, recombination, and mutations are discussed for developing effective future management strategies for viruses.

Banana is known to have high content of polyphenols, polysaccharides and tannins which inhibits polymerase chain reaction (PCR) while detecting the viral pathogens. Multiple-step nucleic acid (NA) extraction protocols are common, but more expensive, time consuming, laborious, and may lead to cross contamination. A simple extraction protocol (SEP) for preparing viral NA from leaves and aphids for detection of BBTV by PCR was developed. Inclusion of sodium sulphite and polyvinylpyrrolidone in the extraction buffer minimized the interferences due to polyphenols and polysaccharides, and an homogenization step has increased the percent detection from plants exhibiting various types of symptoms over virus release protocols reported previously. The detection efficacy for the template obtained in this SEP was comparable with that of templates obtained with a CTAB method and a commercial DNA extraction kit for NA extract preparation. The sensitivity test in PCR showed that this assay could detect 0.1 pg/μl plasmid DNA which is equivalent to 1 × 104 copies. Virus could be detected using SEP from freeze dried as well as CaCl2 dried samples of BBTV infected banana leaves. This methodology provides quality PCR product for direct sequencing suitable for identification and characterization of BBTV. The NA extract prepared by SEP is suitable for BBTV detection in quantitative PCR using SYBR Green chemistry and loop-mediated isothermal amplification assay. This protocol is sensitive, rapid, less prone to contamination, economical, and has potential for large-scale application in surveys, surveillance, quarantine, and certification programmes.

Banana and plantain are important fruit crops grown in the tropical and subtropical regions of the world. Millions of resource-poor people depend on them for their livelihood and food security. These fruit crops are destroyed by several viral diseases causing serious economic losses wherever the crops are cultivated. Here, recent developments on the spread, distribution, biology, diversity, recombination, host range, cutting-edge techniques in diagnostics and comprehensive management of important banana viruses, i.e., banana bunchy top virus (BBTV), banana streak viruses, banana bract mosaic virus and cucumber mosaic virus, as well as minor viruses such as banana mild mosaic virus, are exhaustively reviewed. Due to its high destructive potential, BBTV is regarded as a quarantine pest of very high importance in the banana exporting countries of South and Central America. Using tissue culture technology, it is now possible to control the viruses of banana by adopting virus-free certification programmes in conjunction with exclusion, eradication and adoption of quarantine measures.

Bud necrosis and chlorotic spots causing virus affecting chilli crop in Tamil Nadu (India) was identified as Capsicum chlorosis virus (CaCV). Specific primers were used for amplification and sequencing of the nucleocapsid protein (NP) gene. Polyclonal antibody against the bacterially expressed NP from the CaCV-TN-CBE isolate was produced using recombinant DNA technology. NP gene was subcloned into the pET-28a (+) vector and expressed by transformation in BL21 (DE3) pLysS. The expressed protein was about ∼34 kDa and was confirmed through western blot analysis using Groundnut bud necrosis virus (GBNV) polyclonal antiserum from ICRISAT, India. The purified recombinant protein was used to immunize rabbits to generate CaCV-specific polyclonal antiserum. The sensitivity levels of polyclonal antiserum thus raised was assayed through indirect ELISA or direct antigen coating (DAC)-ELISA using the recombinant protein as antigen. The recombinant antiserum produced in this study successfully detected the natural infection of CaCV on chilli plants collected from the field as well as on cowpea plants artificially inoculated with CaCV by using DAC-ELISA, DIBA and western blotting.

The genus, Babuvirus of the family Nanoviridae contains three virus species, Abaca bunchy top virus (ABTV), Banana bunchy top virus (BBTV) and Cardamom bushy dwarf virus (CBDV). In India, only two babuviruses, BBTV and CBDV are known to affect banana and large cardamom, respectively. BBTV, which causes bunchy top disease in banana, is a nationally important virus as it is widely prevalent in all the banana growing states including North-East region. Whereas, CBDV, which causes foorkey disease of large cardamom, is of regional importance as it is restricted only in the North-Eastern sub-Himalayan mountains. Early infection of these babuviruses cause 100% yield loss. Bunchy top of banana and foorkey disease of large cardamom are known in India for a long time and considerable information has been generated. This chapter summarises the biological and molecular properties of both the babuviruses occurring in India.

Badnaviruses (Family: Caulimoviridae; Genus: Badnavirus) are non-enveloped bacilliform DNA viruses with a monopartite genome containing about 7.2 to 9.2 kb of dsDNA with three to seven open reading frames. They are transmitted by mealybugs and a few species by aphids in a semi-persistent manner. They are one of the most important plant virus groups and have emerged as serious pathogens affecting the cultivation of several horticultural crops in the tropics, especially banana, black pepper, cocoa, citrus, sugarcane, taro, and yam. Some badnaviruses are also known as endogenous viruses integrated into their host genomes and a few such endogenous viruses can be awakened, e.g., through abiotic stress, giving rise to infective episomal forms. The presence of endogenous badnaviruses poses a new challenge for the fool-proof diagnosis, taxonomy, and management of the diseases. The present review aims to highlight emerging disease problems, virus characteristics, transmission, and diagnosis of badnaviruses.

One of the most severe viral diseases of hill banana is caused by banana bunchy top virus (BBTV), a nanovirus transmitted by the aphid Pentalonia nigronervosa. In this study, we reported the Agrobacterium-mediated transformation on a highly valued hill banana cultivar Virupakshi (AAB) for resistance to BBTV disease. The target of the RNA interference (RNAi) is the rep gene, encoded by the BBTV-DNA1. In order to develop RNAi construct targeting the BBTV rep gene, the full-length rep gene of 870 bp was polymerase chain reaction amplified from BBTV infected hill banana sample DNA, cloned and confirmed by DNA sequencing. The partial rep gene fragment was cloned in sense and anti sense orientation in the RNAi intermediate vector, pSTARLING-A. After cloning in pSTARLING-A, the cloned RNAi gene cassette was released by NotI enzyme digestion and cloned into the NotI site of binary vector, pART27. Two different explants, embryogenic cells and embryogenic cell suspension derived microcalli were used for co-cultivation. Selection was done in presence of 100 mg/L kanamycin. In total, 143 putative transgenic hill banana lines were generated and established in green house condition. The presence of the transgenes was confirmed in the selected putative transgenic hill banana lines by PCR and reverse transcription PCR analyses. Transgenic hill banana plants expressing RNAi-BBTV rep were obtained and shown to resist infection by BBTV. The transformed plants are symptomless, and the replication of challenge BBTV almost completely suppressed. Hence, the RNAi mediating resistances were shown to be effective management of BBTV in hill banana.

The first complete genome sequence of an Indian isolate (TRY) of Banana bract mosaic virus (BBrMV) was determined following virus RNA extraction from the French plantain cv. Nendran (AAB). The complete genome was 9711 nucleotides excluding the poly(A) tail and had a genome organization similar to that of a Philippine (PHI) isolate characterized earlier. When compared to BBrMV-PHI, the complete genome sequence of BBrMV-TRY was 94% identical at the nucleotide level and its ten mature proteins had amino acid sequence identities ranging from 88 to 98%. Phylogenetic analysis suggests that the BBrMV-TRY isolate is closely related to the BBrMV-PHI isolate.

Banana and plantain (Musa spp.) are the most important fruit crop in India and play a major role in the livelihood of millions of resource-poor small farmers. Use of quality planting material is very important for increasing productivity. Though conventional suckers are still the primary planting material, use of tissue-culture plants has increased because of their advantages, like more uniform bunches with even maturity and increased yield. However, banana viral pathogens, which are economically important in India, can be inadvertently spread through tissue-culture plants. In order to control the spread of the viruses, virus-indexing techniques were developed at the National Research Centre for Banana, Tiruchirapalli for early detection in mother plants and tissue-culture plants used for mass propagation. Polymerase chain reaction (PCR), reverse transcriptase PCR (RT-PCR), non-radioactive probe-based nucleic acid spot hybridisation (NASH) and enzyme-linked immune-sorbent assay (ELISA) based techniques were developed and validated for routine testing. PCR and NASH tests are being done for detection of Banana bunchy top virus (BBTV) and Banana streak Mysore virus (BSMysV). RT-PCR and ELISA tests are being done for the detection of Banana bract mosaic virus (BBrMV) and Cucumber mosaic virus (CMV). Based on the work done at the centre, the Department of Biotechnology (DBT), Government of India, has accredited the Molecular Virology lab for testing for banana viruses in the country. In total, 15,850 tissue-culture and mother-plant samples were tested against viruses. The percentage of positive plants for BBTV, BSMysV, CMV and BBrMV were 3.83, 2.85, 17.3 and 0.95% respectively. Indexing was done mostly for the cultivars ‘Grande Naine’ (AAA, Cavendish subgroup), ‘Robusta’ (AAA, Cavendish subgroup) and ‘Hill Banana’ (syn. ‘Virupakshi’, AAB, Pome subgroup). Around 25 tissue-culture banana commercial laboratories are undertaking the services of virus testing. Our laboratory has also developed polyclonal antisera for CMV and BBrMV through recombinant DNA technology, which is currently being validated for ELISA-based testing.

Sac brood virus (SBV) also called AcSBV that infects Apis cerana indica, the Indian honey bee, is an important and serious virus disease in honey bee colonies causing losses upto 80% in South India. The methods currently employed to diagnose the bee virus, require sophisticated equipments, have low specificity and sensitivity and are also costly. Hence, there is a need to develop a simple and cheap method for the detection of SBV. In this research work, Reverse Transcriptase loop-mediated isothermal amplification (RT-LAMP) assay which is a newer method that is relatively simpler and cheaper than the conventional RT-PCR was tested. The RT-PCR and RT-LAMP methods were compared for their efficiencies to diagnose the AcSBV. The cDNA isolated from 11 virus infected honey bee samples were used for the study. The detection rate of RT-PCR and RT-LAMP was 10/11(91%) and 3/11(27%) for the field samples, respectively. The RT-LAMP assay was more specific than RT-PCR for the detection of SBV and more primer sets from conserved regions of the genome have to be designed and used in detection to reduce the chances of missing positive samples. The results demonstrate clearly that this LAMP-based assay is quick, cheap, rapid and easier to detect the target gene, within 2 hrs and just a standard laboratory water bath or heat block is a useful tool for the rapid and sensitive diagnosis of SBV infection of bees.

Banana bunchy top disease (BBTD) caused by Banana bunchy top virus (BBTV) is one of the most devastating diseases of banana and poses a serious threat for cultivars like Hill Banana (Syn: Virupakshi) and Grand Naine in India. In this study, we have cloned and sequenced the complete genome comprised of six DNA components of BBTV infecting Hill Banana grown in lower Pulney hills, Tamil Nadu State, India. The complete genome sequence of this hill banana isolate showed high degree of similarity with the corresponding sequences of BBTV isolates originating from Lucknow, Uttar Pradesh State, India, and from Fiji, Egypt, Pakistan, and Australia. In addition, sixteen coat protein (CP) and thirteen replicase genes (Rep) sequences of BBTV isolates collected from different banana growing states of India were cloned and sequenced. The replicase sequences of 13 isolates showed high degree of similarity with that of South Pacific group of BBTV isolates. However, the CP gene of BBTV isolates from Shervroy and Kodaikanal hills of Tamil Nadu showed higher amino acid sequence variability compared to other isolates. Another hill banana isolate from Meghalaya state had 23 nucleotide substitutions in the CP gene but the amino acid sequence was conserved. This is the first report of the characterization of a complete genome of BBTV occurring in the high altitudes of India. Our study revealed that the Indian BBTV isolates with distinct geographical origins belongs to the South Pacific group, except Shervroy and Kodaikanal hill isolates which neither belong to the South Pacific nor the Asian group.

Mealybugs are well-known sap-sucking insects which transmit plant viruses. They are omnipresent, polyphagous, can cause more damage as pests and are less uncommon as virus vectors. The feeding behavior of these vectors has profound ecological and evolutionary implications for the viruses they transmit, as the acquisition and inoculation of viruses occurs during vector feeding. In most cases, there is an intimate relationship between the virus and its vector, and no transmissions occur without the insects feeding in a specific manner. This feeding behavior often causes considerable economic loss to agriculture through direct damage to crops and via virus transmission. They are considered pests as they feed on the plant juices of economically important crop plants, and also act as vectors for several plant viral diseases. The transmission of the plant virus species belonging to Caulimoviridae and Closteroviridae by different species of mealybugs is furnished in detail in this chapter.

Plant virus diseases cause enormous loss which is estimated to be US$60 billion in crop yields worldwide each year. Seed is a propagating material in most of the crop plants, whereas most of the horticultural crops are vegetatively propagated. Horticultural crops like banana, bamboo, citrus, and grapes; commercial crops like sugarcane, black pepper, cardamom, orchids, and bulbous ornamentals; and tuber crops like potato, cassava, yam, etc., have been known to be infected by a range of viruses that belong to different genera and families. In these crops, the primary mode of transmission of viruses is through the use of infected plant propagule like corms, tubers, cutting, grafts, etc. An effective virus management strategy requires an accurate, rapid, and sensitive diagnosis for which understanding the disease cycle of etiological agents and its molecular nature, genome sequence and structure, coat protein information and sequences, etc. should be known in advance to design a detection strategy. Enzyme-linked immunosorbent assay (ELISA) or polymerase chain reaction (PCR) has been widely used for detection of plant viruses. These methods are time-consuming and laborious and require special skills such as in prior information on taxonomy to detect the pathogen responsible for the disease. On-site or point-of-care methods of detection are not new but limited to clinical use for human diseases. But recently this lateral flow devices (LFDs) are being made available for a number of viruses infecting plants. However, the widespread usage of this technology is delayed probably due to its limitation on robustness and lack of high-throughput nature. In this chapter, we have reviewed the recent developments on the early diagnosis using cutting-edge technologies like on-the-spot diagnostic tool lateral flow immunoassay (LFIA), loop-mediated isothermal amplification (LAMP), and multiplex technologies like microarray, microsphere immunoassay, etc. LAMP method is highly specific and requires less time to complete the indexing; however, this technique is yet to replace ELISA and PCR completely in agriculture possibly due to its specificity and viral variants that might escape from detection, and other possible reasons may be that the researchers and policy makers have not yet been convinced. Recent technologies such as rolling circle amplification which is dependent on a circular DNA genome and random hexamers do not require sequence data of the target, and similarly the next-generation sequencing also does not require a priori knowledge on the sequence of the causal agents. Principles and application of these cutting-edge technologies are reviewed in this chapter. The objective of the present chapter is not to cover all the details of diagnostics but to highlight the current status of various cutting-edge diagnostic techniques that can be applied for the biosecurity, by the quarantine departments, international exchange of germplasm, and on-site field detection by farmers, and use in the certification programs.

Infection control plays a major role in health care, including dentistry. Microbial contaminations in dental unit waterlines (DUWLs) are very common. In the present study, the formation and characterization of biofilm in the inner lumen of the dental unit waterlines (DUWLs) was examined using scanning electron microscopy (SEM). Four dental chairs were selected in the department and new dental unit waterline tubes were installed. A new tube was taken as control. The conservative and endodontic procedure was carried out in the dental chair. The tubes were removed from the dental chairs at different intervals- 7 th day, 10 th day, 13 th day and 16 th day. The biofilms in the inner lumen of the tube is analyzed for the presence of biofilm using scanning electron microscopy. SEM showed the progressive development of biofilms in the dental unit waterlines. The density of the biofilm increased as the duration of installation of tube increased. Biofilm formation was detected in all the tubes except the control. Detection of biofilm in the dental unit waterlines within a week emphasis the need for reliable and effective disinfection protocols in the dental office to eliminates the biofilm within the dental unit waterlines.

Sixteen collections of the wild Musa species, Musa balbisiana Colla collected from different regions of India were studied for their intraspecific relationships using random amplified polymorphic DNA (RAPD) markers. Out of 80 primers screened, 34 primers produced reproducible bands and four primers among them showing polymorphic bands were used. In all, 43 DNA fragments were amplified averaging 10.75 per primer. Of these, 31 amplified fragments showed polymorphism (averaging of 7.75 per primer). The extent of polymorphism (74.6%) has indicated the existence of considerable variation at the DNA level within the species. The 16 accessions were clustered into four as against seven clusters obtained through morphotaxonomic characterization. The inter relationships based on geographical origin in comparison with molecular characterization have been discussed.

SummaryMusa balbisiana is one of the progenitors of present-day bananas. The B genome from M. balbisiana has been a rich source of genes conferring resistance to various biotic and abiotic stresses, yet studies on this species are very limited. The present study analysed 29 pure M. balbisiana types (BB), collected from the Indian mainland and from the Andaman and Nicobar Islands, using RAPD markers. The total number of amplified fragments was 48, of which 39 showed polymorphism. A tree matrix based on these DNA markers was constructed using NTSYS software. The results clearly distinguished two clusters, one containing accessions from the Indian sub-continent, and the other, accessions from the Andaman and Nicobar Islands. The dissimilarity between these two clusters was more than 65%. From the results, we propose that M. balbisiana originated from one location, North Eastern India, but now has three distinguishable areas of diversity including the Andaman and Nicobar Islands.

SummaryNatural transgression between Musa acuminata and Musa balbisiana, the well accepted progenitors of Musa spp., has led to the evolution of modern bananas and plantains with various ploidy levels and genomic constitutions. Silk is an important group of triploid, dessert bananas of bispecific origin (AAB). Though it has wide geographic distribution across the globe, the variability seems to be very limited. This study was undertaken with 25 Silk group representatives of both indigenous and exotic origins. The genetic variation and phylogenetic relationships were analysed using Random Amplified Polymorphic DNA (RAPD) markers. Out of the 80 primers screened, 34 primers produced reproducible bands and only four primers were selected for the polymorphic study. A total of 35 DNA fragments across all materials were amplified with four random primers, averaging 8.75 per primer. Within the amplified fragments, 18 showed polymorphism with an average of 4.5 per primer. The average polymorphism among the amplifi...

Banana and plantain (Musa spp.), produced in 10.3 million ha in the tropics, are among the world's top 10 food crops. They are vegetatively propagated using suckers or tissue culture plants and grown almost as perennial plantations. These are prone to the accumulation of pests and pathogens, especially viruses which contribute to yield reduction and are also barriers to the international exchange of germplasm. The most economically important viruses of banana and plantain are Banana bunchy top virus (BBTV), a complex of banana streak viruses (BSVs) and Banana bract mosaic virus (BBrMV). BBTV is known to cause the most serious economic losses in the "Old World," contributing to a yield reduction of up to 100% and responsible for a dramatic reduction in cropping area. The BSVs exist as episomal and endogenous forms are known to be worldwide in distribution. In India and the Philippines, BBrMV is known to be economically important but recently the virus was discovered in Colombia and Costa Rica, thus signaling its spread into the "New World." Banana and plantain are also known to be susceptible to five other viruses of minor significance, such as Abaca mosaic virus, Abaca bunchy top virus, Banana mild mosaic virus, Banana virus X, and Cucumber mosaic virus. Studies over the past 100 years have contributed to important knowledge on disease biology, distribution, and spread. Research during the last 25 years have led to a better understanding of the virus-vector-host interactions, virus diversity, disease etiology, and epidemiology. In addition, new diagnostic tools were developed which were used for surveillance and the certification of planting material. Due to a lack of durable host resistance in the Musa spp., phytosanitary measures and the use of virus-free planting material are the major methods of virus control. The state of knowledge on BBTV, BBrMV, and BSVs, and other minor viruses, disease spread, and control are summarized in this review.