Search

Tomato brown rugose fruit virus (ToBRFV) is a newly-emerging tobamovirus which was first reported on tomatoes in Israel and Jordan, and which has now spread rapidly in Asia, Europe, North America, and Africa. ToBRFV can overcome the resistance to other tobamoviruses conferred by tomato Tm-1, Tm-2, and Tm-22 genes, and it has seriously affected global crop production. The rapid and comprehensive transcription reprogramming of host plant cells is the key to resisting virus attack, but there have been no studies of the transcriptome changes induced by ToBRFV in tomatoes. Here, we made a comparative transcriptome analysis between tomato leaves infected with ToBRFV for 21 days and those mock-inoculated as controls. A total of 522 differentially expressed genes were identified after ToBRFV infection, of which 270 were up-regulated and 252 were down-regulated. Functional analysis showed that DEGs were involved in biological processes such as response to wounding, response to stress, protein folding, and defense response. Ten DEGs were selected and verified by qRT-PCR, confirming the reliability of the high-throughput sequencing data. These results provide candidate genes or signal pathways for the response of tomato leaves to ToBRFV infection. [ABSTRACT FROM AUTHOR]

Nanoviruses have multipartite, circular, single‐stranded DNA genomes and cause huge production losses in legumes and other crops. No viral suppressor of RNA silencing (VSR) has yet been reported from a member of the genus Nanovirus. Here, we demonstrate that the nanovirus U2 protein is a VSR. The U2 protein of milk vetch dwarf virus (MDV) suppressed the silencing of the green fluorescent protein (GFP) gene induced by single‐stranded and double‐stranded RNA, and the systemic spread of the GFP silencing signal. An electrophoretic mobility shift assay showed that the U2 protein was able to bind double‐stranded 21‐nucleotide small interfering RNA (siRNA). The cysteine residues at positions 43, 79 and 82 in the MDV U2 protein are critical to its nuclear localization, self‐interaction and siRNA‐binding ability, and were essential for its VSR activity. In addition, expression of the U2 protein via a potato virus X vector induced more severe necrosis symptoms in Nicotiana benthamiana leaves. The U2 proteins of other nanoviruses also acted as VSRs, and the three conserved cysteine residues were indispensable for their VSR activity. [ABSTRACT FROM AUTHOR]

The apoplast is the extracellular space for signalling, nutrient transport, and plant–microbe interactions, but little is known about how plant viruses use the foliar apoplast. Proteomic analysis of the apoplasts isolated from potato virus X (PVX)‐infected Nicotiana benthamiana plants showed that the coat protein (CP) is the dominant viral component. The presence of the CP in the apoplast was confirmed by western blot, viral nucleic acid was detected by reverse transcription‐PCR and northern blot, and viral particles were observed by transmission electron microscopy (TEM). The apoplast from infected leaves was infectious if rubbed onto healthy leaves but not when infiltrated into them. The exosomes were separated from the apoplast fluid by high‐speed centrifugation and TEM showed that PVX particles were not associated with the exosomes. These results suggest that PVX virions are released to the N. benthamiana apoplast in a one‐way manner and do not share the bidirectional transport of exosomes. [ABSTRACT FROM AUTHOR]

Plant stem cells are hypersensitive to environmental hazards throughout their life cycle, but the mechanism by which plants safeguard stem cell homeostasis in response to environmental hazards is largely unknown. The homeodomain transcription factor WUSCHEL (WUS) protein maintains the stem cell pool in the shoot apical meristem of A rabidopsis. Here, we demonstrate that the translation of WUS mRNA is directed by an internal ribosomal entry site (IRES) located in the 5′-untranslated region. The AtLa1 protein, an RNA-binding factor, binds to the 5′-untranslated region and initiates the IRES-dependent translation of WUS mRNA. Knockdown of AtLa 1 expression represses the WUS IRES-dependent translation and leads to the arrest of growth and development. The AtLa1 protein is mainly located in the nucleoplasm. However, environmental hazards promote the nuclear-to-cytoplasmic translocation of the AtLa1 protein, which further enhances the IRES-dependent translation of WUS mRNA. Genetic evidence indicates that the WUS protein increases the tolerance of the shoot apical meristem to environmental hazards. Based on these results, we conclude that the stem cell niche in A rabidopsis copes with environmental hazards by enhancing the IRES-dependent translation of WUS mRNA under the control of the AtLa1 protein. [ABSTRACT FROM AUTHOR]

Hyperosmolality and various other stimuli can trigger an increase in cytoplasmic-free calcium concentration ([Ca2+]cyt). Members of the Arabidopsis thaliana (L.) reduced hyperosmolality-gated calcium-permeable channels (OSCA) gene family are reported to be involved in sensing extracellular changes to trigger hyperosmolality-induced [Ca2+]cyt increases and controlling stomatal closure during immune signaling. Wheat (Triticum aestivum L.) is a very important food crop, but there are few studies of its OSCA gene family members. In this study, 42 OSCA members were identified in the wheat genome, and phylogenetic analysis can divide them into four clades. The members of each clade have similar gene structures, conserved motifs, and domains. TaOSCA genes were predicted to be regulated by cis-acting elements such as STRE, MBS, DRE1, ABRE, etc. Quantitative PCR results showed that they have different expression patterns in different tissues. The expression profiles of 15 selected TaOSCAs were examined after PEG (polyethylene glycol), NaCl, and ABA (abscisic acid) treatment. All 15 TaOSCA members responded to PEG treatment, while TaOSCA12/-39 responded simultaneously to PEG and ABA. This study informs research into the biological function and evolution of TaOSCA and lays the foundation for the breeding and genetic improvement of wheat. [ABSTRACT FROM AUTHOR]

Tomatoes ( Solanum lycopersicum L.), as a significant solanaceous crop, have attracted global research interest focused on elucidating its plant virus incidence, epidemiology, and pathogenicity, especially in field production (Li et al. 2021; Rivarez et al. 2023). Tobacco vein banding mosaic virus (TVBMV) is classified in the genus Potyvirus. Since its discovery, TVBMV has been documented to infect tobacco, potato, jimsonweed, wild eggplant under nature conditions (Wang et al. 2017). Also, TVBMV could be transmitted to tomatoes by aphids ( Myzus persicae ) in laboratory conditions (Bi et al. 2020). However, to date, there is no sequence representing TVBMV infecting tomato deposited in NCBI nucleotide database. In August 2023, about 30% of tomato planted in an open field showing typical viral disease symptoms (chlorosis, yellowing, mosaic, curling, and mottling) in Dali, Yunnan, China. To identify the potential pathogen, about 9 symptomatic leave from different plants were collected, pooled and sent for high-throughput sequencing. In summary, total RNA was extracted using TRIzol ® Reagent (Invitrogen, CA, USA). Subsequently, RNA sequencing libraries were constructed using the TruSeq RNA sample prep kit (Illumina, CA, USA), followed by RNA-Seq sequencing performed on an Illumina HiSeq4000 platform (LC Sciences, USA). A total of 71,368,934 raw reads (paired-end) of the length 150-bp were generated. After quality control, 69,746,872 reads were retained and subjected to de novo assembly using Trinity (version 2.8.5). The assembled contigs (ranging from 186 nt to 15,573 nt) were searched against the NCBI non-redundant protein (NR) to detect potential viral pathogens using BLASTx with a cutoff e-value of 10 -5 . As a result, 2 viral contigs were assigned to 2 known viruses: TVBMV (Depth: 1960X, BLASTn similarity: 95.26%) and chilli veinal mottle virus (ChiVMV) (Depth: 3581X, BLASTn similarity: 98.22%). No other viruses and viroids were detected. The presence of TVBMV and ChiVMV were tested positive in all of the 9 samples originally collected. Notably, the detection primer for TVBMV identified in tomato (TVBMV-tomato) was designed from the newly assembled TVBMV genome (Forward: 5'- CTCGGTGAGGAAGGTGACATAAGT'; Reverse: 5'- CTTTCAACACCAGGGAATCTAGTG -3'). The nearly complete genome sequence of TVBMV-tomato was validated by overlapping RT-PCR and submitted to NCBI nucleotide database (accession: PP848192). To assess TVBMV-tomato infectivity, symptomatic tomato leaf sap was mechanically inoculated onto 4 healthy tomatoes, with healthy tomato leaf sap serving as a control. After 3 weeks, plants inoculated with symptomatic sap showed leaf curling and stunting, while control plants remained unaffected. All symptomatic samples tested positive for TVBMV via RT-PCR (4/4). For comparison, TVBMV could not be detected in the control sample. Sanger sequencing verified the expected 986 bp amplicon sequences. However, ChiVMV was also detected in all symptomatic tomato samples, which makes it possible that the symptoms after inoculation were the result of the synergism of TVBMV and ChiVMV. Phylogenetic analysis based on complete coding sequence revealed that TVBMV-tomato was most closely related to TVBMV identified from Solanum lyratum . To our knowledge, this work represents the first report of natural occurrence of TVBMV in agroecosystem in Yunnan, China.

Potato virus H (PVH), belonging to the genus Carlavirus in the family Betaflexiviridae , was initially discovered in potato plants in Inner Mongolia, China (Li et al., 2013). Subsequently, it was documented to infect pepino, a perennial shrub of the Solanaceae family like potatoes (Abouelnasr et al., 2014). Tomato ( Solanum lycopersicum L.), a major global crop, faces threats from various plant viruses. In an open field survey in Yunnan, China during July 2023, tomatoes (cultivar: Liangsi) showed typical virus symptoms: leaf yellowing, curling, mottling, and fruit with abnormal shape and color. Eleven symptomatic tomato samples were collected for high-throughput sequencing to identify the potential pathogen. RNA sequencing libraries were prepared using the TruSeq RNA sample prep kit (Illumina, San Diego, CA, USA), followed by RNA-seq sequencing on an Illumina HiSeq4000 platform (LC Sciences, USA). Approximately 77,928,560 paired-end reads (150-bp each) were generated. After quality control, 75,808,296 reads were retained and subjected to de novo assembly using Trinity (version 2.8.5). The assembled contigs, ranging from 198 nt to 15865 nt, were used as queries to search against the NCBI non-redundant protein sequence database (NR) or nucleotide sequence database (NT) to detect the potential pathogens using BLASTx and BLASTn program with a cutoff e-value of 10-5. As a consequence, certain contigs were assigned to 3 plant viruses, including PVH (the highest RdRp blastx identity to UAD82396.1: 97.8%), Capsicum chlorosis virus (CaCV, the highest RdRp blastx identity to APQ31267.1: 98.4%), and southern tomato virus (STV, the highest CP-RdRp fusion protein blastx identity to QOW17541.1: 99.74%). The presence of the identified 3 viruses was subsequently screened in the 11 tomato samples originally collected from the corresponding field. Notably, the specific detection primers for the PVH genome was designed from the newly assembled PVH genome (Forward primer: 5'- ATAGTTGTGCACTGTGTGCCTG-3'; Reverse primer: 5'-GCTTAAGGTTCTTAGCGTATTC-3'), targeting ~1.1kb. Consequently, PVH was detected in 3 out of 11 samples: 2 leaf samples and 1 fruit sample, with one leaf sample showing a single infection. The complete genome sequence of PVH in tomatoes (PVH-tomato) was successfully obtained by assembling nine overlapping regions spanning the entire PVH-tomato genome, following the RT-PCR and the 5' RACE and 3' RACE approaches, and deposited in NCBI nucleotide database with accession number OR397130.1Phylogenetic analysis based on the full genome sequences of PVH-tomato and other publicly available PVH isolates revealed that PVH-tomato was closely related to a PVH isolate found in potatoes in Yunnan (blastn similarity: 97.76%) (Fig. S1A). To test PVH-tomato infectivity and pathogenicity, four healthy Nicotiana benthamiana and four healthy tomato plants were mechanically inoculated with PVH-infected leaf sap; controls used sap from healthy plants. Three weeks post-inoculation, all N. benthamiana (4/4) and three tomato plants (3/4) were PVH-positive by RT-PCR. Symptoms were milder in N. benthamiana , and only two tomato plants (2/4) showed leaf curling. No PVH was detected in control samples (Figure S1B, S1C). Sanger sequencing confirmed the amplicons' expected length of 1093 bp. Previously, PVH was documented only in potato and pepino. This is the first report of tomatoes as natural PVH hosts and PVH infecting N. benthamiana under lab conditions.

Emerging evidence indicates that fatty acid (FA) metabolic pathways regulate host immunity to vertebrate viruses. However, information on FA signaling in plant virus infection remains elusive. In this study, we demonstrate the importance of fatty acid desaturase (FAD), an enzyme that catalyzes the rate-limiting step in the conversion of saturated FAs into unsaturated FAs, during infection by a plant RNA virus. We previously found that the rare Kua-ubiquitin conjugating enzyme (Kua-UEV1) fusion protein FAD4 from Nicotiana benthamiana (NbFAD4) was down-regulated upon turnip mosaic virus (TuMV) infection. We now demonstrate that NbFAD4 is unstable and is degraded as TuMV infection progresses. NbFAD4 is required for TuMV replication, as it interacts with TuMV replication protein 6K2 and colocalizes with viral replication complexes. Moreover, NbFAD4 overexpression dampened the accumulation of immunity-related phytohormones and FA metabolites, and its catalytic activity appears to be crucial for TuMV infection. Finally, a yeast two-hybrid library screen identified the vacuolar H+-ATPase component ATP6V0C as involved in NbFAD4 degradation and further suppression of TuMV infection. This study reveals the intricate role of FAD4 in plant virus infection, and shed lights on a new mechanism by which a V-ATPase is involved in plant antiviral defense., (© The Author(s) 2024. Published by Oxford University Press on behalf of American Society of Plant Biologists. All rights reserved. For commercial re-use, please contact reprints@oup.com for reprints and translation rights for reprints. All other permissions can be obtained through our RightsLink service via the Permissions link on the article page on our site—for further information please contact journals.permissions@oup.com.)