Search

This collaborative work by over 180 researchers from 40+ countries addresses the challenges posed by "phantom agents"-putative pathogenic agents named in literature without supporting data on their existence. Those agents remain on regulatory lists, creating barriers in trade and plant certification. Historically identified based solely on symptoms, these agents lack isolates or sequence data, making reliable detection or risk assessment impossible. After reviewing over 120 such agents across 10 key plant genera, we recommend their removal from regulatory lists and call for revised standards aligned with modern diagnostics. This effort seeks to streamline germplasm exchange, benefiting global agriculture by removing the constraints imposed by phantoms., Competing Interests: The author(s) declare no conflict of interest.

Studies of the virome of olive trees with symptoms of leaf mottling by high-throughput sequencing (HTS) revealed the presence of a new virus. Full coding genome sequences of two isolates were determined and consisted of a single RNA segment of 16,516 nt and 16,489, respectively. The genomic organization contained 10 open reading frames (ORFs) from 5' to 3': ORF1a, ORF1b (RdRp), ORF2 (p22), ORF3 (p7), ORF4 (HSP70h), ORF5 (HSP90h), ORF6 (CP), ORF7 (p19), ORF8 (p12), ORF9 (p23) and ORF10 (p9). Phylogenetic analyses clustered this virus in the genus Olivavirus , family Closteroviridae, with the closest species being Olivavirus flaviolae , commonly named olive leaf yellowing-associated virus (OLYaV). However, amino acid sequences of all taxonomically relevant proteins showed, in all cases, a divergence higher than 25% between OLYaV and the new virus, indicating that it represents a new species in the genus Olivavirus for which the common name of olive leaf mottling virus (OLMV) is proposed. This study represents an advance in the genus Olivavirus and provides new insights into the olive virome.

In this study, we identified Plasmopara-viticola-lesion-associated mononegaambi virus 3 (recently classified as Penicillimonavirus gammaplasmoparae ), a fungi-associated mymonavirus, in grapevine plants showing an unusual upward curling symptomatology on the leaves and premature decline. Mymonaviridae is a family comprising nine genera of negative-sense single-stranded RNA viruses infecting filamentous fungi, although few of them have been associated with oomycetes, plants, and insects. Although the first mymonavirus genome description was reported a decade ago, the genome organization of several genera in the family, including the genus Penicillimonavirus, has remained unclear to date. We have determined the complete genome of P. gammaplasmoparae, which represents the first complete genomic sequence for this genus. Moreover, we provide strong evidence that P. gammaplasmoparae genome is bipartite and comprises two RNA molecules of around 6150 and 4560 nt. Our results indicate that the grapevine powdery mildew pathogen, Erysiphe necator, was also present in the analyzed plants and suggest P. gammaplasmoparae could be infecting this fungus. However, whether the fungus and/or the mycovirus are associated with the symptomatology that initially prompted these efforts remains to be determined.

Peach latent mosaic viroid (PLMVd) is an important pathogen that causes disease in peaches. Control of this viroid remains problematic because most PLMVd variants are symptomless, and although there are many detection tests in use, the reliability of PCR-based methods is compromised by the complex, branched secondary RNA structure of the viroid and its genetic diversity. In this study, a duplex RT-qPCR method was developed and validated against two previously published single RT-qPCRs, which were potentially able to detect all known PLMVd variants when used in tandem. In addition, in order to simplify the sample preparation, rapid-extraction protocols based on the use of crude sap or tissue printing were compared with commercially available RNA purification kits. The performance of the new procedure was evaluated in a test performance study involving five participant laboratories. The new method, in combination with rapid-sample-preparation approaches, was demonstrated to be feasible and reliable, with the advantage of detecting all different PLMVd isolates/variants assayed in a single reaction, reducing costs for routine diagnosis.

Grapevine ( Vitis vinifera L.) is one of the most important crops in the world due to its economic and social impact. Like many other crops, grapevine is susceptible to different types of diseases caused by pathogenic microorganisms. Grapevine leafroll-associated virus 1 (GLRaV-1) is a virus associated with grapevine leafroll disease and it is considered at the national and European level as a pathogen that must be absent in propagative plant material. For this reason, the availability of specific, sensitive and reliable detection techniques to ascertain the sanitary status of the plants is of great importance. The objective of this research was the development of a new GLRaV-1 detection method based on a TaqMan quantitative real-time RT-PCR targeted to the coat protein genomic region and including a host internal control in a duplex reaction. To this end, three new GLRaV-1 full genomes were recovered by HTS and aligned with all sequences available in the databases. The method has been validated following EPPO standards and applied for the diagnosis of field plant material and transmission vectors. The new protocol designed has turned out to be highly sensitive as well as much more specific than the current available methods for the detection and absolute quantitation of GLRaV-1 viral titer.

The analysis by high throughput sequencing (HTS) and RT-PCR of Spanish pomegranate fruits showing yellow rings revealed the presence of viroid isolates closely related to fig isolates of apple dimple fruit viroid (ADFVd). The analysis of pomegranate public RNASeq data (Sequence Reads Archives, SRAs) from Israel provided evidence for the presence of similar ADFVd isolates in pomegranate trees in this country. In addition, reads or contigs of plum viroid I (PVd-I) isolates were also identified in two of the analyzed SRA datasets from Israel, suggesting the presence of this second viroid in pomegranate. Full length ADFVd genomic sequences have been recovered, increasing knowledge on the diversity of this viroid and on the pomegranate virome in which only four viruses and one viroid had previously been reported.

Cucumber mosaic virus (CMV; Cucumovirus, Bromoviridae ) is an omnipresent virus characterized by a large host range and high genetic variability. Using high-throughput sequencing, we have characterized near complete genomes of 14 Slovak CMV variants from different plant hosts. Of these, three variants originated from the Papaveraceae species (oilseed poppy, common poppy and great celandine), previously poorly described as CMV natural hosts. Based on a BLAST search and phylogenetic analysis, the Slovak CMV isolates can be divided into two genetically different Groups, Ia and II, respectively. The SL50V variant, characterized by a divergent RNA2 sequence, potentially represents a reassortant variant. In four samples (T101, SL50V, CP2, MVU2-21), the presence of satellite CMV RNA was identified along with CMV. Although mechanically transmitted to experimental cucumber plants, the role of satellite RNA in the symptomatology observed could not be established due to a complex infection of original hosts with different viruses.

The use of high throughput sequencing (HTS) for the analysis of Spanish olive trees showing leaf yellowing discoloration, defoliation, and/or decline has provided new insights into the olive viruses present in Spain and has opened discussions about the pros and cons of these technologies for diagnostic purposes. In this study, we report for the first time in Spanish orchards the presence of olive leaf yellowing-associated virus (OLYaV), for which the second full coding sequence has been determined. This virus has also been detected in a putative vector, the psyllid Euphyllura olivina . In addition, the presence in Spain of Olea europaea geminivirus (OEGV), recently reported in Italy, has been confirmed, and the full-length sequence of two isolates was obtained by HTS and Sanger sequencing. These results, as well as the detection of other viral sequences related to olive latent virus 3 (OLV-3) and olive viral satellite RNA, raises questions on the biological significance of the findings, about the requirement of standardization on the interpretation of HTS results, and the necessity of additional tests to confirm the relevance of the HTS detection of viral sequences.

Loquat ( Eriobotrya japonica ) is an important crop in Spain. To date, only one viral species, apple stem pitting virus (ASPV), has been detected in Spanish loquat orchards. In this study, the presence of additional viruses infecting this crop in Spain was investigated. RT-PCR and high-throughput sequencing (HTS) of symptomatic loquat plants led to first-time detection and characterization of apple stem grooving virus (ASGV), also known as citrus tatter leaf virus (CTLV), and apple chlorotic leaf spot virus (ACLSV) from Spain with description of nearly complete genomic sequences. The frequency of ACLSV infection was the highest, with over 30% of the samples testing positive and were also detected as coinfections with ASGV and ASPV, although most of the samples infected were symptomless. Studies on all the full-length sequences available in the databases were performed in order to establish the phylogenetic relationships of the Spanish isolates of these two viral species. Moreover, apple hammerhead viroid (AHVd) was also detected to infect loquat, the first host different from apple reported for this viroid to date.

A significant number of new members of the genus Vitivirus have been identified recently, mainly due to the advent of high-throughput sequencing (HTS). Grapevine virus I (GVI), which was identified in New Zealand in 2018, is one of these viruses. RNAseq HTS analysis of a Greek grapevine (cv. Daphnia), revealed the presence of a GVI-like isolate (D2-1/19). Sequence analysis confirmed the classification of D2-1/19 as GVI. However, both sequence and phylogenetic data exhibited high levels of variability between D2-1/19 and the previously characterized GVI isolates. This study provides the full-length sequence of a divergent GVI isolate, adding knowledge to the limited information available about this recently identified virus.

Loquat ( Eriobotrya japonica ) is a minor but important woody crop cultivated in Asia and Europe. High-throughput sequencing (HTS) analysis of an asymptomatic loquat plant using RNAseq Illumina technology has allowed the detection for the first time of apple stem pitting virus (ASPV), the type species of the genus Foveavirus in the family Betaflexiviridae , infecting this crop. A nearly complete genome of 9303 nts (ASPV-SL61) reconstructed bioinformatically shows the typical genomic structure of this viral species and a highest nucleotide identity (85.9%) with the Chinese ASPV isolate YLX from pear. A close phylogenetic relationship between ASPV-SL61 and ASPV-YLX has been confirmed by the sequence analysis of full-length ASPV genomic sequences available in the databases. In fact, a phylogenetic study based on a partial CP N-terminal sequence previously proposed to be involved in host adaptation has shown that ASPV-SL61 loquat isolate is more closely related to ASPV pear isolates. The presence of ASPV in loquat has been further confirmed by RT-PCR and Sanger sequencing and DAS-ELISA. An incidence of 15% was determined in one of the loquat Spanish growing areas. The sequence analysis of the partial CP sequences amplified by RT-PCR has shown a high level of variability between loquat isolates. To our knowledge, this is the first record of loquat as a natural host of ASPV.

Genome organization and phylogenetic relationships of olive leaf yellowing-associated virus (OLYaV) with other members of the Closteroviridae family were determined. The complete coding sequence of OLYaV was obtained by high throughput sequencing of total RNA from a 35-year-old olive tree (cv. Zarzaleña) from Brazil, showing olive leaf yellowing disease and deformations in the wood. This represents the first report of OLYaV in this country. A genomic sequence of 16,700 nt containing 11 open reading frames (ORFs) was recovered, representing the complete virus coding capacity. The knowledge of the nucleotide sequence of the genome including the gene that codes the coat protein will facilitate the development of diagnostic tests, which are limited so far to PCR-based methods targeting the HSP70h gene. Interestingly, a thaumatin-like protein (ORF2), previously reported in other unassigned viruses in the Closteroviridae family, persimmon virus B and actidinia virus 1, was identified in the OLYaV genome. Phylogenetic analysis of shared proteins (ORF1a, ORF1b, HSP70h, HSP90h and CP) with all members of the Closteroviridae family provides new insight into the taxonomic position of these three closteroviruses and suggests they could represent a new genus in the family.

Grapevine asteroid mosaic associated virus (GAMaV) is a member of the genus Marafivirus, family Tymoviridae. GAMaV was initially found to infect grapevine (Vitis vinifera) in California and was also reported in Japan, Canada, Uruguay, France, Hungary and Italy (Nakaune et al. 2008; Vargas-Asencio et al. 2017; Candresse et al. 2017; Porceddu et al. 2018). In July 2019 a grapevine sample from cv. Tempranillo (TS1), collected in a random survey from a vineyard in a Spanish grapevine growing area (D.O. Utiel-Requena), showing chlorotic mottling and leaf deformations, was analyzed by high throughput sequencing (HTS). Total RNA extracted from leaves was sequenced after ribo-depletion (Ribo-Zero Plant kit, Illumina) using TrueSeq Illumina technology (150 nt pair-end reads). Data analysis was performed by CLC Genomics Workbench 10.1.1. After quality control and host genome subtraction 2,410,654 reads were used for de novo assembly. BLAST analysis of the 13,303 contigs obtained revealed the presence of four contigs (2736, 1448, 1285 and 954 nt in size) related to GAMaV, indicating the presence of this virus in TS1 sample. Contigs related to other viruses/viroids were also found, in particular Grapevine rupestris stem pitting-associated virus, Grapevine leafroll-associated virus 3, Grapevine virus A, Grapevine fleck virus, Grapevine red globe virus, Grapevine rupestris vein feathering virus and Hop stunt viroid. For the assembly of the full-length GAMaV genome, contigs were extended by mapping the reads against the contigs using Geneious Prime 2020 software. This mapping step allowed the recovery of the GAMaV genomic sequence (635 reads, average coverage per nucleotide 10.0) with the exception of a small gap of 147 nt in the helicase region of the polyprotein. The gap in the genomic region was covered by RT-PCR using two newly designed primers overlapping the flanking regions (GAMaV-3755-F, 5'ATCCTCACCAACTCCC3' and GAMaV-3985-R, 5'GTTGGAAGTGGTGTG3'). Nearly complete sequence of the isolate TS1 (6,692 nt, MT459830) showed 87.7% nucleotide identity with the isolate 16GVP031 (MK253012) from France. The phylogenetic analysis performed on the available GAMaV full-length genomes showed that the Spanish isolate was positioned in a distinct clade (Supp. Fig. 1). The presence of GAMaV in Spain was further evaluated by reverse transcription-polymerase chain reaction (RT-PCR). Specific GAMaV primers, GAMaV-F3 and GAMaV-R3 previously reported by Candresse et al. (2017) were used without any success, due to primer mismatching. Based on TS1 sequence, two primers (GAMaV-6010F, 5'CCCTCCTCCTAGCGACGACC3' and GAMaV-6426R, 5'GGGTTGAGACGGCGGAGATC3') were designed and used to amplify a fragment of 417 nt in the CP region. Sanger sequencing of the obtained RT-PCR product confirmed the HTS recovered sequence. A total of 52 randomly collected samples from the same grapevine growing area were analyzed by RT-PCR using the newly designed primers. One sample bearing similar symptoms, TS7 (MT770919, cv. Tempranillo), and eight symptomless samples, MS1, MS2 and MS3 (MT770911, MT770917 and MT770918, cv. Macabeo), and TS2, TS3, TS4, TS5 and TS6 (MT770912, MT770913, MT770914, MT770915 and MT770916, cv. Tempranillo), tested positive for GAMaV, thus confirming its presence in Spanish vineyards. The nucleotide identity between these partial sequences and the homologous region of TS1 ranged from 94.7% to 98.8%, 0.04 being the mean diversity among isolates at the CP genomic region estimated by MEGA X software. To our knowledge, this is the first report of GAMaV in grapevine in Spain. The presence of other viruses/viroids in TS1 sample and the finding of asymptomatic GAMaV infected plants make difficult to associate this virus to the observed symptomatology. Other latent or semilatent GAMaV infections have been previously reported (Martelli 2014; Candresse et al. 2017).

Grapevine Roditis leaf discoloration-associated virus (GRLDaV) is an emerging grapevine pathogen included in the European and Mediterranean Plant Protection Organization (EPPO) alert list due to its ability to damage grapevine crops and cause production losses. This work aimed to develop a specific and reliable diagnostic tool that would contribute to preventing the spread of this pathogen. Therefore, a TaqMan real-time quantitative PCR was developed. The method was validated according to EPPO guidelines showing a high degree of analytical sensitivity, analytical specificity, selectivity, and repeatability and reproducibility. The sensitivity of this method is much higher than the sensitivity reached by previously reported methods even when tested in crude extracts, which could allow rapid testing by avoiding nucleic acid extraction steps. The method was also able to detect GRLDaV isolates from all the geographic origins reported so far, despite their high degree of genetic diversity. In addition, this new technique has been successfully applied for the quantitative detection of GRLDaV in plant material and two mealybug species, Planococcus citri and Pseudococcus viburni . In conclusion, the methodology developed herein represents a significant contribution to the diagnosis and control of this emerging pathogen in grapevine.

Recent developments in high-throughput sequencing (HTS), also called next-generation sequencing (NGS), technologies and bioinformatics have drastically changed research on viral pathogens and spurred growing interest in the field of virus diagnostics. However, the reliability of HTS-based virus detection protocols must be evaluated before adopting them for diagnostics. Many different bioinformatics algorithms aimed at detecting viruses in HTS data have been reported but little attention has been paid thus far to their sensitivity and reliability for diagnostic purposes. Therefore, we compared the ability of 21 plant virology laboratories, each employing a different bioinformatics pipeline, to detect 12 plant viruses through a double-blind large-scale performance test using 10 datasets of 21- to 24-nucleotide small RNA (sRNA) sequences from three different infected plants. The sensitivity of virus detection ranged between 35 and 100% among participants, with a marked negative effect when sequence depth decreased. The false-positive detection rate was very low and mainly related to the identification of host genome-integrated viral sequences or misinterpretation of the results. Reproducibility was high (91.6%). This work revealed the key influence of bioinformatics strategies for the sensitive detection of viruses in HTS sRNA datasets and, more specifically (i) the difficulty in detecting viral agents when they are novel or their sRNA abundance is low, (ii) the influence of key parameters at both assembly and annotation steps, (iii) the importance of completeness of reference sequence databases, and (iv) the significant level of scientific expertise needed when interpreting pipeline results. Overall, this work underlines key parameters and proposes recommendations for reliable sRNA-based detection of known and unknown viruses.

High-throughput sequencing (HTS) is a powerful tool employed by plant virologists for the detection of viruses, the characterization of virus genomes and the study of host-pathogen interactions. Virus detection has been an important application of this technology, which has resulted in the discovery of novel viruses or viral strains as well as for the detection of known viruses in a plant sample. Here we describe the entire process that needs to be considered for the genome analysis of Citrus tristeza virus (CTV) by HTS, including the experimental design, sample preparation, nucleic acid purification, HTS library construction, and bioinformatic analysis.

A recently described putative foveavirus, grapevine virus T (GVT), was detected in a Slovak grapevine accession (SK704) using high-throughput sequencing, prompting further studies. Full-length genome sequence of isolate GVT-SK704 was determined. Analyses revealed 86.1% nucleotide identity with the Italian GVT isolate, currently the only available nearly complete sequence of GVT in GenBank. A virus-specific RT-PCR assay was developed, which enabled a survey of GVT incidence in grapevine samples from Slovakia and Czech Republic. Unexpectedly, GVT was present in ~ 30% of tested samples. Analysis of complete CP gene sequences of 20 Slovak and Czech GVT isolates detected in the survey revealed relatively high intra-species variability (up to 11.2% nucleotide divergence), suggesting multiple introductions from different sources, possibly over an extended period of time.

Perennial crops, such as fruit trees, are infected by many viruses, which are transmitted through vegetative propagation and grafting of infected plant material. Some of these pathogens cause severe crop losses and often reduce the productive life of the orchards. Detection and characterization of these agents in fruit trees is challenging, however, during the last years, the wide application of high-throughput sequencing (HTS) technologies has significantly facilitated this task. In this review, we present recent advances in the discovery, detection, and characterization of fruit tree viruses and virus-like agents accomplished by HTS approaches. A high number of new viruses have been described in the last 5 years, some of them exhibiting novel genomic features that have led to the proposal of the creation of new genera, and the revision of the current virus taxonomy status. Interestingly, several of the newly identified viruses belong to virus genera previously unknown to infect fruit tree species (e.g., Fabavirus , Luteovirus ) a fact that challenges our perspective of plant viruses in general. Finally, applied methodologies, including the use of different molecules as templates, as well as advantages and disadvantages and future directions of HTS in fruit tree virology are discussed.

Little cherry virus 1 (LChV1, Velarivirus , Closteroviridae ) is a widespread pathogen of sweet or sour cherry and other Prunus species, which exhibits high genetic diversity and lacks a putative efficient transmission vector. Thus far, four distinct phylogenetic clusters of LChV1 have been described, including isolates from different Prunus species. The recent application of high throughput sequencing (HTS) technologies in fruit tree virology has facilitated the acquisition of new viral genomes and the study of virus diversity. In the present work, several new LChV1 isolates from different countries were fully sequenced using different HTS approaches. Our results reveal the presence of further genetic diversity within the LChV1 species. Interestingly, mixed infections of the same sweet cherry tree with different LChV1 variants were identified for the first time. Taken together, the high intra-host and intra-species diversities of LChV1 might affect its pathogenicity and have clear implications for its accurate diagnostics.

Grapevine Pinot gris virus (GPGV) is a widely distributed grapevine pathogen that has been associated to the grapevine leaf mottling and deformation disease. With the aim of better understanding the disease epidemiology and providing efficient control strategies a specific and quantitative duplex TaqMan real-time RT-PCR assay has been developed. This method has allowed reliable quantitation of the GPGV titer ranging from 30 up to 3 x 108 transcript copies, with a detection limit of 70 viral copies in plant material. The assay targets a grapevine internal control that reduces the occurrence of false negative results, thus increasing the diagnostic sensitivity of the technique. Viral isolates both associated and non-associated to symptoms from Greece, Slovakia and Spain have been successfully detected. The method has also been applied to the absolute quantitation of GPGV in its putative transmission vector Colomerus vitis. Moreover, the viral titer present in single mites has been determined. In addition, in the current study a new polymorphism in the GPGV genome responsible for a shorter movement protein has been found. A phylogenetic study based on this genomic region has shown a high variability among Spanish isolates and points to a different evolutionary origin of this new polymorphism. The methodology here developed opens new possibilities for basic and epidemiological studies as well as for the establishment of efficient control strategies.

Grapevine leafroll-associated virus 3 (GLRaV-3) has a worldwide distribution and is the most economically important virus that causes grapevine leafroll disease. Reliable, sensitive, and specific methods are required for the detection of the pathogen in order to assure the production of healthy plant material and control of the disease. Although different serological and nucleic acid-based methods have been developed for the detection of GLRaV-3, diagnostic parameters have not been established, and there is no gold standard method. Therefore, the main aim of this work was to determine the sensitivity, specificity, and likelihood ratios of three commonly used methods, including one serological test (double-antibody sandwich enzyme-linked immunosorbent assay [DAS-ELISA]) and two nucleic acid-based techniques (spot and conventional real-time reverse transcription-polymerase chain reaction [RT-PCR]). Latent class models using a Bayesian approach have been applied to determine diagnostic test parameters and to facilitate decision-making regarding diagnostic test selection. Statistical analysis has been based on the results of a total of 281 samples, which were collected during the dormant period from three different populations. The best-fit model out of the 49 implemented models revealed that DAS-ELISA was the most specific method (value = 0.99) and provided the highest degree of confidence in positive results. Conversely, conventional real-time RT-PCR was the most sensitive method (value = 0.98) and produced the highest degree of confidence in negative results. Furthermore, the estimation of likelihood ratios showed that in populations with low GLRaV-3 prevalence the most appropriate method could be DAS-ELISA, while conventional real-time RT-PCR could be the most appropriate method in medium or high prevalence populations. Combining both techniques significantly increases detection accuracy. The flexibility and power of Bayesian latent class models open new possibilities for the evaluation of diagnostic tests for plant viruses.

Background: Specific histone modifications can perform several cellular functions, for example, as signals to recruit trans-acting factors and as modulators of chromatin structure. Acetylation of Lys14 of histone H3 is the main target of many histone acetyltransferases in vitro and may play a central role in the stability of the nucleosome. This study is focused on the genome-wide binding of Saccharomyces cerevisiae histone acetyltransferases that are specific for Lys14 of histone H3., Results: We have used a variation of the genome-wide location analysis method, based on a macroarray platform, to identify binding sites of yeast histone acetyltransferase catalytic subunits and to correlate their positions with acetylation of Lys14 of histone H3. Our results revealed that the histone acetyltransferases Sas3p and Gcn5p are recruited to a pool of intensely transcribed genes and that there is considerable overlap between the two cohorts of Sas3p and Gcn5p bound gene pools. We also demonstrate a positive correlation between binding sites of both proteins and the acetylation state of Lys14 of histone H3. Finally, a positive correlation between the decrease of H3 Lys14 acetylation in a GCN5 deleted strain and the Gcn5p genome occupancy is shown., Conclusion: Our data support a model in which both Gcn5p and Sas3p act as general activators of an overlapping pool of intensely transcribed genes. Since both proteins preferentially acetylate Lys14 of histone H3, our data support the hypothesis that acetylation of this specific residue facilitates the action of the transcriptional apparatus.

HAT-B is a yeast histone acetyltransferase composed of Hat1, Hat2 and Hif1 proteins. We demonstrate that a hat2 mutant or a hat1hat2 double mutant, but not a hat1 mutant, have an extended life-span. Transcriptome analysis shows that the single hat mutants are not very different from wild type. However, the comparison of the hat1 and hat2 transcriptomes shows that they are different. The hat1hat2 double mutant shows a transcriptional phenotype similar to that of the hat1 mutant but strongly enhanced. These results indicate that Hat2p could have additional functions in the cell to those of Hat1p.

Gcn5p is the catalytic subunit of several type A histone acetyltransferases (HATs). Previous studies performed under a limited range of solution conditions have found that nucleosome core particles and nucleosomal arrays can be acetylated by Gcn5p only when it is complexed with other proteins, e.g. Gcn5-Ada, HAT-A2, and SAGA. Here we demonstrate that when assayed in buffer containing optimum concentrations of either NaCl or MgCl2, purified yeast recombinant Gcn5p (rGcn5p) efficiently acetylates both nucleosome core particles and nucleosomal arrays. Furthermore, under conditions where nucleosomal arrays are extensively folded, rGcn5p acetylates folded arrays approximately 40% faster than nucleosome core particles. Finally, rGcn5p polyacetylates the N termini of free histone H3 but only monoacetylates H3 in nucleosomes and nucleosomal arrays. These results demonstrate both that rGcn5p in and of itself is catalytically active when assayed under optimal solution conditions and that this enzyme prefers folded nucleosomal arrays as a substrate. They further suggest that the structure of the histone H3 N terminus, and concomitantly the accessibility of the H3 acetylation sites, changes upon assembly into nucleosomes and nucleosomal arrays.

We have analyzed the histone acetyltransferase enzymes obtained from a series of yeast hat1, hat2, and gcn5 single mutants and hat1,hat2 and hat1,gcn5 double mutants. Extracts prepared from both hat1 and hat2 mutant strains specifically lack the following two histone acetyltransferase activities: the well known cytoplasmic type B enzyme and a free histone H4-specific histone acetyltransferase located in the nucleus. The catalytic subunits of both cytoplasmic and nuclear enzymes have identical molecular masses (42 kDa), the same as that of HAT1. However, the cytoplasmic complex has a molecular mass (150 kDa) greater than that of the nuclear complex (110 kDa). The possible functions of HAT1 and HAT2 in the yeast nucleus are discussed. In addition, we have detected a yeast histone acetyltransferase not previously described, designated HAT-A4. This enzyme is located in the nucleus and is able to acetylate free and nucleosome-bound histones H3 and H4. Finally, we show that the hat1, gcn5 double mutant is viable and does not exhibit a new phenotype, thus suggesting the existence of several histone acetyltransferases with overlapping functions.

Enzymatic extracts from a gcn5 mutant and wild-type strains of Saccharomyces cerevisiae were chromatographically fractionated and the histone acetyltransferase activities compared. When free histones were used as substrate, extracts from wild-type cells showed two peaks of activity on histone H3 but extracts from gcn5 mutant cells showed only one. With nucleosomes as substrate, the histone acetyltransferase activities present in extracts from the gcn5 mutant strain were not able to modify H3 whereas wild-type cell extracts acetylated intensely this histone. The activity that acetylated nucleosome-bound H3 behaved as a 170-kDa complex. We suggest that Gcn5p represents a catalytic subunit within a multiprotein complex containing proteins that confer on it the ability to acetylate H3 in nucleosomes.