Search

Circadian, infradian, and seasonal changes in steroid hormone secretion have been tied to changes in brain volume in several mammalian species. However, the relationship between circadian changes in steroid hormone production and rhythmic changes in brain morphology in humans is largely unknown. Here, we examined the relationship between diurnal fluctuations in steroid hormones and multiscale brain morphology in a precision imaging study of a male who completed 40 MRI and serological assessments at 7 A.M. and 8 P.M. over the course of a month, targeting hormone concentrations at their peak and nadir. Diurnal fluctuations in steroid hormones were tied to pronounced changes in global and regional brain morphology. From morning to evening, total brain volume, gray matter volume, and cortical thickness decreased, coincident with decreases in steroid hormone concentrations (testosterone, estradiol, and cortisol). In parallel, cerebrospinal fluid and ventricle size increased from A.M. to P.M. Global changes were driven by decreases within the occipital and parietal cortices. These findings highlight natural rhythms in brain morphology that keep time with the diurnal ebb and flow of steroid hormones.

Most of mammalian physiology is under the control of biological rhythms, including the endocrine system with time-varying hormone secretion. Precision neuroimaging studies provide unique insights into how the endocrine system dynamically regulates aspects of the human brain. Recently, we established estrogens ability to drive widespread patterns of connectivity and enhance the global efficiency of large-scale brain networks in a woman sampled every 24 h across 30 consecutive days, capturing a complete menstrual cycle. Steroid hormone production also follows a pronounced sinusoidal pattern, with a peak in testosterone between 6 and 7 A.M. and nadir between 7 and 8 P.M. To capture the brains response to diurnal changes in hormone production, we carried out a companion precision imaging study of a healthy adult man who completed MRI and venipuncture every 12-24 h across 30 consecutive days. Results confirmed robust diurnal fluctuations in testosterone, 17β-estradiol-the primary form of estrogen-and cortisol. Standardized regression analyses revealed widespread associations between testosterone, estradiol, and cortisol concentrations and whole-brain patterns of coherence. In particular, functional connectivity in the Dorsal Attention Network was coupled with diurnally fluctuating hormones. Further, comparing dense-sampling datasets between a man and a naturally cycling woman revealed that fluctuations in sex hormones are tied to patterns of whole-brain coherence in both sexes and to a heightened degree in the male. Together, these findings enhance our understanding of steroid hormones as rapid neuromodulators and provide evidence that diurnal changes in steroid hormones are associated with patterns of whole-brain functional connectivity.

Matrix effects pose a significant challenge in food analysis for the quantitative analysis of complex food samples. Herein, a novel magnetic covalent organic framework nanocomposite and the copper(I)-catalyzed azide–alkyne cycloaddition (CuAAC) click reaction-based stable isotope labeling (SIL) method were presented for highly selective and sensitive detection of steroid hormones in food samples using HPLC-MS/MS. The nanocomposite, Fe3O4@TAPB-COF, with a core–shell structure exhibited high adsorption capacities for steroid hormones. Combined with a SIL method based on the CuAAC click reaction, steroid hormones were accurately quantified in food samples with high sensitivity and selectivity. A pair of SIL agents, N-(2-azidoethyl)aniline (d0-NAEA) and d5-N-(2-azidoethyl)aniline (d5-NAEA), was synthesized to label steroid hormones in the samples and standard solutions, respectively. The labeling reaction is highly specific, and the formation of the derivatives is easily ionized by MS, thus overcoming matrix effects. More surprisingly, the ionization efficiency of steroid hormones increased by a factor of 4 to 56, with matrix effects ranging from 87.3 to 99.3%. Under optimal conditions, this method exhibited a low limit of detection (LOD) ranging from 0.1 to 2.6 μg L−1 and overcame the interference of matrix effects for trace-level steroid hormone analysis in foodstuffs. [ABSTRACT FROM AUTHOR]

Congenital adrenal hyperplasia (CAH) is a rare, inherited disorder of adrenal steroid synthesis. In many countries it is part of the neonatal screening program enabling early diagnosis and treatment. In case of an abnormal neonatal screening result or when other differences of sexual development (DSD) are suspected, measurement of serum steroid hormones using liquid chromatography coupled to mass spectrometry (LC-MS/MS) is needed for further diagnosis. However, reliable age- and sex-specific reference intervals (RIs) for serum steroid hormones during the neonatal period are missing. We therefore aimed to establish LC-MS/MS based RIs for serum steroid hormones in neonates. Serum was obtained from healthy term neonates at two time points: 130 samples at day 3–8 (T1, time of the neonatal screening) and 126 samples at day 13–15 (T2, two weeks old). Concentrations of cortisol, cortisone, corticosterone, 11-deoxycortisol, 21-deoxycortisol, 11-deoxycorticosterone, testosterone, androstenedione, and 17-hydroxyprogesterone (17-OHP) were measured using LC-MS/MS. RIs (in nmol/L) were established for T1 and T2: cortisone (19.3–215;18.0–212), cortisol (10.0–407;8.4–446), corticosterone (<31;<50), 11-deoxycortisol (0.73–4.6;0.70–3.6), 17-OHP (<4.9;<5.1), androstenedione (0.3–1.8;0.3–2.7), 11-deoxycorticosterone (<0.2;<0.2), and 21-deoxycortisol (<1;<1), respectively. Testosterone differed between boys and girls: RIs at T1 and T2 for boys were 0.27–4.3 and 0.63–13.9, and for girls<0.30 and <0.47, respectively. We established LC-MS/MS based RIs for cortisol, cortisone, corticosterone, 11-deoxycortisol, 21-deoxycortisol, 11-deoxycorticosterone, testosterone, androstenedione, and 17-OHP in neonates in the first and second week of life. [ABSTRACT FROM AUTHOR]

11α-Hydroxyandrost-4-ene-3,17-dione (11α-OH AD) is an essential steroid hormone drug intermediate that exhibits low biotransformation efficiency. In this study, a mixed-strain fermentation strategy was established for the efficient production of 11α-OH AD from phytosterols (PS). Initially, strains were screened for efficient transformation of AD to produce 11α-OH AD. Subsequently, a dual-strain mixed-culture fermentation technique was established, with Mycolicibacterium neoaurum CICC 21097 ΔksdD (MNR) showing highly effective results. Ultimately, a one-step conversion process for the production of 11α-OH AD was achieved at a molar yield of 76.5 % under optimal conditions using PS as a substrate, the highest reported yield to date. Additionally, studies revealed synergistic metabolic interactions between MNR and Aspergillus ochraceus in the mixed-culture system. These findings provide valuable insights for the industrial production of high-value products using mixed-strain fermentation. • A mixed-strain culture fermentation process for 11α-OH AD was established. • The production efficiency of 11α-OH AD was further improved through process optimization. • Strain synergy in PS mixed-strain fermentation was investigated. [ABSTRACT FROM AUTHOR]

Introduction: Steroid hormones are widely present in the environment and pose potential risks to organisms. Previous studies of steroid hormones have predominantly focused on terrestrial environments, with few studies conducted in marine environments. Methods: In this study, we analyzed the occurrence of 44 steroid hormones in seawater, sediment, and marine organisms collected from the coast of Guangdong, China. Results: Total concentration of steroid hormones ranged from 0.11 to 30.15 ng/L in seawater, ND to 8.58 ng/g (dw) in sediments, and ND to 80.52 ng/g (ww) in organisms. The highest average concentrations of steroid hormones detected in seawater, sediments, and marine organisms were progestins, estrogens, and glucocorticoids, respectively. Steroid hormone concentrations in seawater were significantly higher during the dry season than the rainy season. The concentrations of steroid hormones in Guanghai Bay, the Pearl River Estuary, Daya Bay, and Zhelin Bay were significantly higher than those in other bays. Discussion: Negative correlations were observed between steroid hormones and salinity, indicating a potential continental input. Risk assessment results indicated that 17α-ethinylestradiol in Zhelin Bay posed high risks. Nevertheless, the consumption of seafood does not pose a significant health risk to humans. To the best of our knowledge, this is the first study to concurrently analyze androgens, glucocorticoids, progestins, and estrogens in water, sediment, and organisms from diverse marine environments. [ABSTRACT FROM AUTHOR]

Introduction: Vulvovaginal atrophy (VVA) predominantly affects postmenopausal women due to hormonal decline but can also occur in premenopausal women with conditions such as primary ovarian insufficiency or exposure to anti-estrogen medications. Contributing factors include smoking and certain medical treatments. Symptoms like dyspareunia and loss of sexual function affect many women but are underreported due to stigma and lack of awareness. Current treatments range from over-the-counter lubricants to hormonal therapies like estrogen receptor agonists, which improve vaginal elasticity and moisture with minimal systemic absorption. Areas covered: This review evaluates current and emerging estrogen receptor agonists for VVA treatment. A comprehensive search was conducted using PubMed between August and September 2024, supplemented by snowball sampling from key references. Expert opinion: Despite its prevalence, VVA remains underdiagnosed, with increasing recognition due to longer lifespans and focus on quality of life. Diagnosis involves comprehensive symptom assessment, including sexual history, urinary tract infection frequency, and clinical exams, with vaginal pH measurements and smear microscopy to determine the condition's severity. Treatment usually involves estrogen, but not all women can safely use it, and preferences toward estrogen must be respected. Alternatives like selective estrogen receptor modulators (SERMs) such as prasterone and ospemifene show promise but need more long-term safety data. Emerging options like E3 and E4 demonstrate efficacy and safety in low doses. Future treatments will emphasize convenience and adherence, making timely diagnosis and management of VVA routine in women's health care. [ABSTRACT FROM AUTHOR]

Probiotics have attracted increasing attention due to their benefits in terms of relieving gastrointestinal ailments, including constipation. This study evaluated the potential of Weizmannia coagulans BC99 for clinical remission of constipation in adults. In this randomized, double-blind, and placebo-controlled trial, 90 individuals with constipation were divided between a BC99 and a placebo group for an 8-week intervention duration. The spontaneous bowel movement (SBM) frequency, patient assessment of constipation symptoms (PAC-SYM), patient assessment of constipation quality of life (PAC-QOL), inflammatory cytokines, neurotransmitters, and serum metabolites were investigated before and after the intervention. The results showed that BC99 intervention significantly improved constipation symptoms and quality of life in adults with constipation, as evidenced by an increased SBM score and decreased PAC-SYM and PAC-QOL scores. Additionally, BC99 supplementation increased the levels of neurotransmitters (5-HT, MTL, AChE, and BDNF) associated with intestinal motility and alleviated inflammation in participants with constipation, as supported by higher levels of anti-inflammatory factors (IL-4, IL-10) and lower levels of pro-inflammatory factors (IL-6, IFN-γ) in the BC99 group. Furthermore, BC99 altered the abundance of 93 metabolites and affected biological pathways correlated with gastrointestinal motility, including sphingolipid metabolism, steroid hormone biosynthesis, and glycerophospholipid metabolism. This study demonstrates the effectiveness of the W. coagulans BC99 strain in relieving constipation in adults, and reveals its potential mechanism of action. These findings provide a scientific basis for BC99 as an effective and safe probiotic for constipation treatment. [ABSTRACT FROM AUTHOR]

Context: As a novel SGLT1 inhibitor, SY-009 has been preliminarily confirmed in a phase Ib clinical study for its ability to reduce postprandial blood glucose in patients with type 2 diabetes mellitus (T2DM). However, the effects of SY-009 on human plasma metabolomics are still unknown. Objective: This study aimed to explore the effects of SY-009 on plasma metabolomics in patients with T2DM and the potential metabolic regulatory mechanism involved. Study design: In the phase Ib study, a total of 50 participants with T2DM were enrolled and randomly assigned to the 0.5 mg BID, 1 mg BID, 2 mg BID, 1 mg QD, and 2 mg QD dose groups, with a 4:1 random allocation within each group to receive either the SY-009 capsule or placebo. We conducted untargeted and targeted metabolomics analyses on plasma samples from the phase Ib clinical study. Results: Untargeted metabolomics revealed that, after SY009 treatment, there were differences in metabolic pathways, including primary bile acid biosynthesis; biosynthesis of unsaturated fatty acid; steroid hormone biosynthesis; purine metabolism; phenylalanine, tyrosine and tryptophan biosynthesis. In particular, the increase in bile acid-related metabolites in the 2 mg BID group was significantly greater than that in the placebo group, and unsaturated fatty acid-related metabolites decreased in both the 2 mg BID group and the placebo group, but there was no significant difference between the two groups. After comprehensive consideration, bile acids were taken as our target for accurate quantification via targeted metabolomics. Compared with those in the placebo group, the levels of several bile acids were significantly greater in the SY-009-treated groups. Moreover, the proportion of free bile acids decreased significantly, the proportion of glycine-conjugated bile acids increased significantly, the proportion of taurine-conjugated bile acids tended to be stable, and PBA/SBA significantly increased after SY-009 administration. Conclusions: SY-009 caused a series of postprandial plasma metabolite changes in patients with T2DM, especially significant changes in the bile acid profile, which provides a new perspective on the mechanism by which SY-009 lowers blood glucose. Clinical trial registration: https://www.clinicaltrials.gov , identifier NCT04345107. [ABSTRACT FROM AUTHOR]

Respiratory function is modulated by circulating steroid hormones. In female rats, steroid hormones fluctuate across the normal estrous cycle and decline with age, similar to human menopause. To determine the influence of steroid hormones, and mimic aspects of age-related reductions in hormones, the ovariectomy model is often employed. Ovariectomy (OVX) induces an immediate and persistent decrease in steroid hormones. The current study aimed to interrogate whether the OVX model of hormone reduction impacted specific aspects of respiratory function [chemosensitivity and the hypoxic ventilatory response (HVR)] in a manner consistent with natural age-related declines in hormones. Using barometric plethysmography, three experimental groups of female rats were assessed for HVR, chemosensitivity, and respiratory neural drive during progressive hypoxic challenges (FIO2: 0.15, 0.12, and 0.09): young (3–5 mos. old; in proestrus; n = 10), young OVX (3–5 mos. old; n = 10), and aged (>20 mos. old; n = 10). Our findings indicted that sex hormone loss did not appear to impact chemosensitivity or neural drive. Natural aging, but not OVX, resulted in decreased HVR as well as reduced magnitude in ventilatory output during stepwise hypoxia. Differences in metabolism were important to the interpretation of these results. Collectively, these data support the concept that aging impacts female respiratory function in complex and unique ways that differ from OVX. [ABSTRACT FROM AUTHOR]

Lipophagy is a way to degrade lipids; however, the molecular mechanisms are not fully understood. Using the holometabolous lepidopteran insect Helicoverpa armigera, cotton bollworm, as a model, we revealed that the larval fat body undergoes lipophagy during metamorphosis, and lipophagy is essential for metamorphosis. The steroid hormone 20-hydroxyecdysone (20E) induced lipophagy by promoting the expression of the peptide hormone adipokinetic hormone (AKH, the insect analog of glucagon) and the adipokinetic hormone receptor (AKHR). Akh was highly expressed in the brain and Akhr was expressed in various tissues. The 20E upregulated the expression of Akh and Akhr by its nuclear receptor EcR during metamorphosis. AKH and AKHR increased glucose levels via gluconeogenesis and promoted lipophagy. The high glucose level induced acetylation of FOXO and nuclear localization to promote the expression of lipases and autophagy genes. Thus, the steroid hormone 20E induced lipophagy via the brain-adipose tissue axis by promoting the AKH pathway, which presented nutrients and energy to pupal and adult development during insect metamorphosis after feeding stops. [ABSTRACT FROM AUTHOR]

Peripheral tissues such as skin and adipose tissue play a crucial role in the intracrine formation of sex steroid hormones, complementing the endocrine and paracrine systems. These mechanisms involve the conversion of dehydroepiandrosterone (DHEA) and its sulfated form—DHEAS—into potent androgenic and estrogenic hormones. In vitro studies using tissue-specific cell lines are essential for unraveling the complex intracrine synthesis of these hormones. This study examined the formation of DHEA, androstenedione (A4), testosterone (T), dihydrotestosterone (DHT), and estradiol (E2) from DHEAS in four cell lines: MCF-7 breast cancer cells, HaCaT keratinocytes, human dermal fibroblasts (HDF), and 3T3-L1 preadipocytes and mature adipocytes, using liquid chromatography–mass spectrometry (LC-MS/MS). MCF-7 cells converted DHEAS to DHEA, A4, T, E2, and DHT, while HaCaT cells produced all these steroids except DHT. Mature 3T3-L1 adipocytes produced DHEA, A4, T, and DHT. By contrast, HDF and 3T3-L1 preadipocytes converted DHEAS only to DHEA and A4. This study highlights the vital role of peripheral tissues, such as skin and adipose tissue, for the intracrine formation of sex hormones and underlines the crucial role of in vitro cell culture models to analyze such effects. The data shed light on the significant impact of androgen metabolism in skin and adipose tissue, which is of great relevance for aging, wound healing, obesity, and lipid metabolism. [ABSTRACT FROM AUTHOR]

Steroid hormones are powerful endocrine regulators, but little is known about how environmental conditions modulate steroidogenesis to reprogram developmental fates. Here, we use the Drosophila prothoracic gland (PG) to investigate how a nutrient restriction checkpoint (NRC) ensures or blocks developmental progression and sexual maturation via regulating steroidogenesis. Extensive transcriptome analysis of the PG reveals that pre-NRC starvation significantly downregulates mitochondria-associated genes. Pre-NRC starvation reduces prothoracicotropic neuropeptide hormone signaling, insulin signaling, and TORC1 activity in PG cells, which prevent mitochondrial fragmentation and import of Disembodied, a key steroidogenic enzyme. Ultimately, pre-NRC starvation causes severe mitophagy and proteasome dysfunction, blocking steroidogenesis and metamorphosis. By contrast, post-NRC starvation does not impair mitochondrial homeostasis in PG cells but reduces sit expression and induces moderate autophagy to promote steroidogenesis, leading to precocious metamorphosis. This study constitutes a paradigm for exploring how steroid hormone levels are controlled in response to environmental stress during developmental checkpoints. The prothoracic gland is the principal steroidogenic gland in Drosophila. Here Zhang et al. perform transcriptomic analysis and show that starvation prior to the nutrient restriction checkpoint alters mitochondrial homeostasis in the gland and blocks steroid hormone production. [ABSTRACT FROM AUTHOR]

Context Adiponectin is a potent uterine tocolytic that decreases with gestational age, suggesting it could be a maternal metabolic quiescence factor. Maternal stress can influence preterm birth risk, and adiponectin levels may be stress responsive. Objective We characterized associations between adiponectin and glucocorticoids with preterm birth and modeled their predictive utility. We hypothesized maternal plasma adiponectin and cortisol are inversely related and lower adiponectin and higher cortisol associate with preterm birth. Methods We performed a nested case–control study using biobanked fasting maternal plasma. We included low-risk singleton pregnancies, and matched 1:3 (16 preterm, 46 term). We quantified high molecular weight (HMW), low molecular weight (LMW), and total adiponectin using an enzyme-linked immunosorbent assay. We validated a high-performance liquid chromatography-tandem mass spectrometry serum assay for use in plasma, to simultaneously measure cortisol, cortisone, and 5 related steroid hormones. We used linear/logistic regression to compare group means and machine learning for predictive modeling. Results The preterm group had lower mean LMW adiponectin (3.07 μg/mL vs 3.81 μg/mL at 15 weeks (w) 0 days (d), P =.045) and higher mean cortisone (34.4 ng/mL vs 29.0 ng/mL at 15w0d, P =.031). The preterm group had lower cortisol to cortisone and lower LMW adiponectin to cortisol ratios. We found HMW adiponectin, cortisol to cortisone ratio, cortisone, maternal height, age, and prepregnancy body mass index most strongly predicted preterm birth (area under the receiver operator curve = 0.8167). In secondary analyses, we assessed biomarker associations with maternal self-reported psychosocial stress. Lower perceived stress was associated with a steeper change in cortisone in the term group. Conclusion Overall, metabolic and stress biomarkers are associated with preterm birth in this healthy cohort. We identify a possible mechanistic link between maternal stress and metabolism for pregnancy maintenance. [ABSTRACT FROM AUTHOR]

Background/Objectives: Irritable bowel syndrome (IBS) is a complex disorder affecting 10% of the global population, but the underlying mechanisms remain poorly understood. By integrating multifluid metabolomics, we aimed to identify metabolite markers of IBS in a large population-based cohort. Methods: We included individuals from TwinsUK with and without IBS, ascertained using the Rome III criteria, and analysed serum (232 cases, 1707 controls), urine (185 cases, 1341 controls), and stool (186 cases, 1284 controls) metabolites (Metabolon Inc.). Results: After adjusting for covariates, and multiple testing, 44 unique metabolites (25 novel) were associated with IBS, including lipids, amino acids, and xenobiotics. Androsterone sulphate, a sulfated steroid hormone precursor, was associated with lower odds of IBS in both urine (0.69 [95% confidence interval = 0.56–0.85], p = 2.34 × 10−4) and serum (0.75 [0.63–0.90], p = 1.54 × 10−3. Moreover, suberate (C8-DC) was associated with higher odds of IBS in serum (1.36 [1.15–1.61]; p = 1.84 × 10−4) and lower odds of IBS in stool (0.76 [0.63–0.91]; p = 2.30 × 10−3). On the contrary, 32 metabolites appeared to be fluid-specific, including indole, 13-HODE + 9-HODE, pterin, bilirubin (E,Z or Z,Z), and urolithin. The remaining 10 metabolites were associated with IBS in one fluid with suggestive evidence (p < 0.05) in another fluid. Finally, we identified androgenic signalling, dicarboxylates, haemoglobin, and porphyrin metabolism to be significantly over-represented in individuals with IBS compared to controls. Conclusions: Our results highlight the utility of a multi-fluid approach in IBS research, revealing distinct metabolic signatures across biofluids. [ABSTRACT FROM AUTHOR]

The steroid hormone progesterone (P4) regulates multiple aspects of reproductive and metabolic physiology. Classical P4 signaling operates through nuclear receptors that regulate transcription. In addition, P4 signals through membrane P4 receptors (mPRs) in a rapid nongenomic modality. Despite the established physiological importance of P4 nongenomic signaling, the details of its signal transduction cascade remain elusive. Here, using Xenopus oocyte maturation as a well-established physiological readout of nongenomic P4 signaling, we identify the lipid hydrolase ABHD2 (α/β hydrolase domain-containing protein 2) as an essential mPRβ co-receptor to trigger meiosis. We show using functional assays coupled to unbiased and targeted cell-based lipidomics that ABHD2 possesses a phospholipase A2 (PLA2) activity that requires mPRβ. This PLA2 activity bifurcates P4 signaling by inducing clathrin-dependent endocytosis of mPRβ, resulting in the production of lipid messengers that are G-protein coupled receptor agonists. Therefore, P4 drives meiosis by inducing an ABHD2 PLA2 activity that requires both mPRβ and ABHD2 as obligate co-receptors. [ABSTRACT FROM AUTHOR]

It is unclear how steroid hormones contribute to stroke, and conducting randomized controlled trials to obtain related evidence is challenging. Therefore, Mendelian randomization (MR) technique was employed in this study to examine this association. Through genome-wide association meta-analysis, the genetic variants of steroid hormones, including testosterone/17β-estradiol (T/E2) ratio, aldosterone, androstenedione, progesterone, and hydroxyprogesterone, were acquired as instrumental variables. Analysis was done on the impact of these steroid hormones on the risk of stroke subtypes. The T/E2 ratio was associated to an elevated risk of small vessel stroke (SVS) according to the inverse variance weighted approach which was the main MR analytic technique (OR, 1.23, 95% CI: 1.05–1.44, p = 0.009). These findings were solid since no heterogeneity nor horizontal pleiotropy were found. The causal association between T/E2 and SVS was also confirmed in the replication study (p = 0.009). Nevertheless, there was no proof that other steroid hormones increased the risk of stroke. According to this study, T/E2 ratio and SVS are causally related. However, strong evidence for the impact of other steroid hormones on stroke subtypes is still lacking. These findings may be beneficial for developing stroke prevention strategies from steroid hormones levels. [ABSTRACT FROM AUTHOR]

High concentrations of prolactin (PRL)-induced ovine ovarian granulosa cell (GCs) apoptosis and MAPK12 could aggravate the induced effect. However, the molecular mechanisms that MAPK12-induced GC apoptosis and repressed steroid hormone secretion remain unclear. In this study, GCs in the P group (GCs with high PRL concentration: 500 ng/mL PRL) and P-10 group (GCs with 500 ng/mL PRL infected by lentiviruses carrying overexpressed sequences of MAPK12) were collected for whole-transcriptome analysis. Then, we applied the miRNA mimics combined with a dual-luciferase reporter gene assay to explore the molecular mechanisms through which MAPK12 affected GC apoptosis and steroid hormones secretion. The whole-transcriptome analysis indicated that MAPK12 regulated high PRL concentration GC apoptosis and steroid hormone secretion mainly through novel 58. The expression of pro-apoptotic proteins Caspase 3 and Bax was increased, while the expression of anti-apoptotic protein BCL-2 declined by novel 58-5p in high PRL concentration GCs (p < 0.05); The secretion of steroid hormones and genes associated with steroid secretion (CYP11A1, 3β-HSD and CYP19A1) decreased (p < 0.05), while the protein expression of the target gene, SREBF1 of novel 58, was repressed by novel 58-5p in high PRL concentration GCs (p < 0.05). Dual-luciferase reporter gene analysis showed that SREBF1 was confirmed as a target gene of novel 58-5p and the negative feedback interaction was established between novel 58-5p and SREBF1. The ggccggctgggggattgccg sequence may be the target site of SREBF1, targeted by novel 58-5p. In addition, steroid hormone secretion was reduced and GC apoptosis was suppressed after the interference of SREBF1 in ovine ovarian GCs with high PRL concentration. In conclusion, novel 58-5p regulated ovine ovarian GC apoptosis and steroid hormone secretion by targeting SREBF1. [ABSTRACT FROM AUTHOR]

A colorimetric chemosensor array based on an indicator displacement assay has achieved not only visualization of differences in hormone structures but also quantitative detection of sex hormones in their mixtures. Furthermore, the chemosensor array has allowed the detection of a steroid hormone in diluted human saliva. [ABSTRACT FROM AUTHOR]

How divergence occurs between closely related organisms in the absence of geographic barriers to gene flow stands as one of the long‐standing questions in evolutionary biology. Previous studies suggested that the interplay between selection, gene flow and recombination strongly affected the process of divergence with gene flow. However, the extent to which these forces interact to drive divergence remains largely ambiguous. Guinan toad‐headed lizards (Phrynocephalus guinanensis) in the Mugetan Desert exhibit striking colour differences from lizards outside the desert and provide an excellent model to address this question. Through extensive sampling and whole genome sequencing, we obtained genotypes for 191 samples from 14 populations inside and outside the desert. Despite the colour differences, continuous and asymmetric gene flow was detected across the desert border. More importantly, 273 highly diverged regions (HDRs) were identified between them, accounting only for 0.47% of the genome but widely distributed across 20 (out of the total 24) chromosomes. Strong signatures of selection were identified in HDRs, and local recombination rates were repressed. Furthermore, five HDRs exhibited significantly higher divergence, which contained key genes associated with crucial functions in animal coloration, including pteridine and melanocyte pigmentation. Genes related to retinal cells and steroid hormones were identified in other HDRs, which might have also contributed to the formation of colour variation in the presence of gene flow. This study provided novel insights into the understanding of the evolutionary mechanisms of genetic divergence in the presence of gene flow. [ABSTRACT FROM AUTHOR]

Objective The renin-angiotensin-aldosterone system (RAAS) and glucocorticoids (GCs) are involved in vascular remodeling and fibrosis but have not been extensively studied in systemic sclerosis (SSc). Our aim was to investigate the RAAS and GC hormones in SSc patients. Methods Serum levels of renin (dosage and activity), aldosterone and its precursors (DOC, B, 18-OH-DOC, 18-OH-B), and GCs (cortisol, cortisone, 11-deoxycortisol, 18-OH-F) were assessed in 122 SSc patients and 52 healthy controls. After applying stringent inclusion criteria aimed at ensuring accurate hormone assessments (exclusion of interfering drugs, strict sampling conditions), we analysed RAAS hormones in 61 patients, and GCs in 96 patients. Hormone levels were compared between patients and controls; and associations with disease characteristics were assessed in patients. Results Regarding RAAS hormones, SSc patients displayed significantly lower aldosterone levels (although within normal range), similar renin levels, and higher B levels than controls. Abnormal RAAS hormone levels were associated with a more severe SSc phenotype (lung and skin fibrosis, heart and pulmonary vascular involvements, inflammation). Regarding GC hormones, SSc patients had higher levels of cortisol, 11-desoxycortisol (precursor) and 18-OH-F (metabolite) but lower levels of cortisone (inactive counterpart) than controls. RAAS hormone levels were assessed in five SSc patients before and during scleroderma renal crisis (SRC): concentrations varied considerably between patients, but consistently included normal/increased aldosterone levels and elevated renin levels. Conclusion RAAS and GC hormones are abnormally produced in SSc patients, especially in patients with severe SSc and during SRC. This could suggest a participation of these hormonal systems in SSc pathogenesis. [ABSTRACT FROM AUTHOR]

The ovarian steroid hormones, estrogen and progesterone, the levels of which fluctuate dynamically with the estrous cycle, alter circadian behavioral rhythms in mammals. However, it remains unclear whether the sleep–wake rhythm fluctuates with the menstrual cycle in humans. To ascertain the relationship between the menstrual cycle and sleep–wake rhythms, we evaluated the objective and long-term sleep–wake rhythms of ten healthy women using a recently developed wearable device. The results showed a strong negative correlation between the sleep midpoint and the quasi-peak value (an indicator of rhythm robustness), and a positive correlation between the length of the menstrual cycle (days) and social jetlag (hours). These results suggest that healthy women with late sleeping habits have a disturbed sleep–wake rhythm and that irregular habits prolong the menstrual cycle. The sleep midpoint and quasi-peak values showed variations during the menstrual cycle. The quasi-peak values in the follicular phase were significantly higher than those in the menstrual and luteal phases. In rodents, the phase of locomotor activity rhythm advances, and activity increases at night during proestrus. The increase in quasi-peak values during the follicular phase, when estrogen is relatively high, may be due to the increased activity caused by estrogen. These results suggest that ovarian steroid hormones influence sleep–wake rhythms in women. Verifying the results of this study under various conditions is necessary; however, accurately predicting the day of ovulation using only the acquisition of sleep–wake rhythms with wearable devices will be possible. [ABSTRACT FROM AUTHOR]

Polycystic ovary syndrome (PCOS) is a prevalent endocrine and metabolic disorder affecting 6-20% of women of childbearing age worldwide. Immune cell imbalance and dysregulation of inflammatory factors can lead to systematic low-grade chronic inflammation (SLCI), which plays a pivotal role in the pathogenesis of PCOS. A significant higher infiltration of immune cells such as macrophages and lymphocytes and pro-inflammatory factors IL-6 and TNF-α has been detected in PCOS organ systems, impacting not only the female reproductive system but also other organs such as the cardiovascular, intestine, liver, thyroid, brain and other organs. Obesity, insulin resistance (IR), steroid hormones imbalance and intestinal microecological imbalance, deficiencies in vitamin D and selenium, as well as hyperhomocysteinemia (HHcy) can induce systematic imbalance between pro-inflammatory and anti-inflammatory cells and molecules. The pro-inflammatory cells and cytokines also interact with obesity, steroid hormones imbalance and IR, leading to increased metabolic imbalance and reproductive-endocrine dysfunction in PCOS patients. This review aims to summarize the dysregulation of immune response in PCOS organ system and the intrinsic mechanisms affecting SLCI in PCOS to provide new insights for the systemic inflammatory treatment of PCOS in the future. [ABSTRACT FROM AUTHOR]

Specific temperature manipulation following the growth features of rotifer species was demonstrated to induce the transition of reproductive patterns. This study utilized diverse strains of Brachionus plicatilis Müller, 1786 rotifer with two distinct reproductive patterns at 25 °C (control): cyclical parthenogenesis (NH1L strain) and obligatory parthenogenesis (Amami and Obama strains). With these strains, we assessed the efficacy of low-temperature (15 °C) induction on rotifer sexual reproduction and associated molecular evidence. The three tested strains exhibited superior adaptability to low temperatures, maintained population growth at 15 °C, and rapidly expanded after being transferred to 25 °C. Moreover, exposure to 15 °C effectively induced mictic female occurrence in the Amami strain (mixis rate peaked at 41.4% on day 12) and enhanced mixis induction and resting egg production (sevenfold) in the NH1L strain. There was no sexual induction of the Obama strain under either temperature condition. Based on the molecular evidence, we hypothesized that temperature manipulation induces adaptive responses, such as activated oxidative defenses and energy metabolism, which then triggers steroid hormone signaling to initiate the sexual induction in the cyclical parthenogenesis strain. However, an obligate parthenogenic strain probably possesses greater tolerance or resilience, such as a high base level of hsp70, against environmental fluctuations, rendering it insensitive to sexual stimuli. [ABSTRACT FROM AUTHOR]

Abstract Background Nuptial pads, a typical sexually dimorphic trait in anurans, are located on the first digit of the male forelimb in Rana chensinensis and exhibit morphological changes synchronized with breeding cycles. However, the genetic mechanisms underlying its formation and seasonal changes remain poorly understood. Results To identify genes and biological processes associated with the development and seasonal variations of nuptial pads, we conducted a comprehensive transcriptome analysis on nuptial pads and hind toe skin across both sexes at different breeding periods in R. chensinensis. We identified numerous sexually and seasonally differential expression genes in nuptial pads. Notably, genes including KRT, TRY, HPDB, AKR1C1, and AKR1C3 were identified as potential key regulators of keratinization and coloration variation in nuptial pads. We further examined gene co-expression modules closely linked to nuptial pad development. These modules contained genes involved in signal transduction, substance transport, cytoskeletal structure, energy metabolism, and protein modification, suggesting that the development of nuptial pads is a complex multifaceted regulatory process. Furthermore, genes in modules associated with pad development during the breeding season were primarily involved in apoptosis, steroid hormone synthesis, autophagy, and cytochrome P450 pathways, suggesting their pivotal role in pad formation. Additionally, key regulators of the cell cycle, such as FOXO4, PIK3C2A, and GSPT2, were implicated in influencing nuptial pad development by modulating cell differentiation and proliferation. Conclusions Our study provides a valuable reference for investigating the molecular basis of sexual dimorphism in R. chensinensis and other amphibian species more broadly.

Background: Nuptial pads, a typical sexually dimorphic trait in anurans, are located on the first digit of the male forelimb in Rana chensinensis and exhibit morphological changes synchronized with breeding cycles. However, the genetic mechanisms underlying its formation and seasonal changes remain poorly understood. Results: To identify genes and biological processes associated with the development and seasonal variations of nuptial pads, we conducted a comprehensive transcriptome analysis on nuptial pads and hind toe skin across both sexes at different breeding periods in R. chensinensis. We identified numerous sexually and seasonally differential expression genes in nuptial pads. Notably, genes including KRT, TRY, HPDB, AKR1C1, and AKR1C3 were identified as potential key regulators of keratinization and coloration variation in nuptial pads. We further examined gene co-expression modules closely linked to nuptial pad development. These modules contained genes involved in signal transduction, substance transport, cytoskeletal structure, energy metabolism, and protein modification, suggesting that the development of nuptial pads is a complex multifaceted regulatory process. Furthermore, genes in modules associated with pad development during the breeding season were primarily involved in apoptosis, steroid hormone synthesis, autophagy, and cytochrome P450 pathways, suggesting their pivotal role in pad formation. Additionally, key regulators of the cell cycle, such as FOXO4, PIK3C2A, and GSPT2, were implicated in influencing nuptial pad development by modulating cell differentiation and proliferation. Conclusions: Our study provides a valuable reference for investigating the molecular basis of sexual dimorphism in R. chensinensis and other amphibian species more broadly. [ABSTRACT FROM AUTHOR]

Background: The ovary is a central organ in the reproductive system that produces oocytes and synthesizes and secretes steroid hormones. Healthy development and regular cyclical change in the ovary is crucial for regulating reproductive processes. However, the key genes and metabolites that regulate ovarian development and pregnancy have not been fully elucidated. This study conducted high-throughput RNA sequencing and untargeted metabolite profiling of the ovarian tissues from Chenghua pigs at four stages, including postnatal day 3 (D3), puberty at the age of about 125 days (Pub), sexual maturity at the age of about 365 days (Y1), and 105 days after pregnancy at the age of about 360 days (Pre). Results: A total of 9,264 and 1,593 differentially expressed genes (DEGs) were identified during ovarian development and pregnancy. Several key genes involved in ovarian development, including SQLE, HMGCS1, MSMO1, SCARB1, CYP11A1, HSD3B1, HSD17B1, and SERPINE1 were identified. Similarly, LUM, FN1, PLAUR, SELP, SDC1, and VCAN were considered to be associated with pregnancy maintenance. Overexpression of HSD17B1 in granulosa cells significantly upregulated estrogen synthesis-related genes (HSD3B1, CYP11A1, and STAR); meanwhile, overexpression of PLAUR promotes granulosa cell proliferation. Furthermore, 66, 24, 77, and 7 differentially expressed miRNAs (DEMis) were found, leading to the selection of key miRNAs such as ssc-miR-206, ssc-miR-107, ssc-miR-429, ssc-miR-210, and ssc-miR-133a-3p by differential miRNA-targeted mRNA interaction network; meanwhile, ssc-miR-133a-3p was validated to have a targeting relationship with KCNA1 by dual-luciferase reporter systems assay. At the metabolic levels, androstenedione, 17a-hydroxyprogesterone, dehydroepiandrosterone, and progesterone were identified, with their synthesis regulated by these DEGs in the ovarian steroidogenesis pathway. Furthermore, treatment of cells with androstenedione upregulated the expression of HSD3B1, CYP11A1, and STAR. Conclusions: This study revealed the dynamic changes in the transcriptome and metabolome of pig ovaries across developmental stages and gestation, indicating that it may provide new theoretical insights for improving sow fertility. [ABSTRACT FROM AUTHOR]

Breast cancer is one of the most diagnosed cancers worldwide. The insulin-like growth factor (IGF) system promotes proliferation and survival in breast cancer cells and is regulated by 6 insulin-like growth factor binding proteins (IGFBPs). The IGFBPs sequester IGFs to prolong their half-life and attenuate binding to insulin-like growth factor 1 receptor (IGF1R). While IGFBP-6 has been studied in some cancers it has not been studied extensively in hormone receptor positive breast cancer. Survival analysis using available databases indicated that high IGFBP-6 levels improve overall survival in progesterone receptor positive breast cancers. IGFBP-6 is transcriptionally induced by progesterone in T47D breast cancer cells resulting in increased intracellular and extracellular IGFBP-6 protein. Knockdown of IGFBP-6 resulted in reduced proliferative antagonism when estradiol stimulated T47D cells were cotreated with progesterone and protein levels of both progesterone receptor isoforms (PR-A and PR-B) were decreased following knockdown of IGFBP-6. P21(Cip1/Waf1), which is progesterone responsive, was not induced in response to progesterone following knockdown of IGFBP-6. Cyclin E2, a cell cycle regulator, is induced by progesterone only when IGFBP-6 is knocked down. Stable overexpression of IGFBP-6 in MCF-7 cells resulted in an increase in Epidermal Growth Factor Receptor (EGFR) and this expression was further enhanced when cells were cotreated with progesterone and estradiol. These results indicate that IGFBP-6 is a regulator of progesterone action, and that PR is required for the observed protective effects of IGFBP-6 in breast cancer. [ABSTRACT FROM AUTHOR]