Search

RNA interference, particularly siRNA induced gene silencing is becoming an important avenue of modern therapeutics. The siRNA is delivered to the cells as short double helical RNA which becomes single stranded for forming the RISC complex. Significant experimental evidence is available for most of the steps except the process of the separation of the two strands. We have attempted to understand the pathway for double stranded siRNA (dsRNA) to single stranded (ssRNA) molecules using steered molecular dynamics simulations. As the process is completely unexplored we have applied force from all possible directions restraining all possible residues to convert dsRNA to ssRNA. We found pulling one strand along helical axis direction restraining far end of the other strand demands excessive force for ssRNA formation. Pulling a central residue of one strand, in a direction perpendicular to the helix axis, while keeping the base paired residue fixed requires intermediate force for strand separation. Moreover we found that in this process the force requirement is quite high for the first bubble formation (nucleation energy) and the bubble propagation energies are quite small. We hypothesize this could be the mode of action adopted by the proteins in the cells., Comment: 25 pages, 7 figures

Tobacco use is a serious concern in India since it is one of the largest producers and consumers of tobacco in the world. With growing evidence of health hazards caused by tobacco, Government of India had enacted various tobacco control legislations. This article provides a critical review of such government interventions. It traces tobacco practices and production trends in India, and proceeds further to provide a detailed account of the history of such interventions to understand the effectiveness of such policies, and stresses on the role of tobacco companies to weaken tobacco control policies in India. This article concludes that though tobacco control has taken a long leap forward with the introduction of various legislative steps to prohibit tobacco use across the country, review of these policies shows their inadequacy not only in enforcement but also in issues related to (a) the interference of the tobacco industry, (b) issues with tobacco taxation and (c) the failure of government to rehabilitate people involved with cultivation, production and distribution of tobacco products.

Cytosolic delivery of functional siRNA remains the major challenge to develop siRNA-based therapeutics. Designing clinically safe and effective siRNA transporter to deliver functional siRNA across the plasma and endosomal membrane remains a key hurdle. With the aim of improving endosomal release, we have designed cyclic and linear peptide-based transporters having an Arg-DHis-Arg template. Computational studies show that the Arg-DHis-Arg template is also stabilized by the Arg-His side-chain hydrogen bonding interaction at physiological pH, which dissociates at lower pH. The overall atomistic interactions were examined by molecular dynamics simulations, which indicate that the extent of peptide_siRNA assembly formation depends greatly on physicochemical properties of the peptides. Our designed peptides having the Arg-DHis-Arg template and two lipidic moieties facilitate high yield of intracellular delivery of siRNA. Additionally, unsaturated lipid, linoleic acid moieties were introduced to promote fusogenicity and facilitate endosomal release and cytosolic delivery. Interestingly, such protease-resistant peptides provide serum stability to siRNA and exhibit high efficacy of erk1 and erk2 gene silencing in the triple negative breast cancer (TNBC) cell line. The peptide having two linoleyl moieties demonstrated comparable efficacy with commercial transfection reagent HiPerFect, as evidenced by the erk1 and erk2 gene knockdown experiment. Additionally, our study shows that ERK1/2 silencing siRNA and doxorubicin-loaded gramicidin-mediated combination therapy is more effective than siRNA-mediated gene silencing-based monotherapy for TNBC treatment.

Energy demand post independence has faced a consistent pace with the growth of Indian economy. To maintain the national energy balance with sustainable development, it is time for various alternative energy resources with advanced devices like smart meters, smart grid model, etc., are implemented through different pilot projects only while the household is often underestimated it. India has aim to produce 175 GW energy through renewable energy power mix to reach the electricity to the all households at cheaper cost, and decentralization of smart grid-based system is needed to implement nationwide. This article represents a comprehensive study of present energy scenario in India, different energy policies which are associated with electricity generation, prospect of nationwide smart grid development.

This working paper has been removed at the request of the authors. A new version is WP 20-33.

Electronic structure calculations of all 10 unique base pair (bp) steps have been calculated to study the interaction energies of the bp steps, density of states (DOS), projected density of states (pDOS) using the density functional theory (DFT). Plane wave basis with ultrasoft pseudo-potential method has been used within the local density approximation (LDA) for the exchange correlation functional. Electron densities of the bp steps corresponding to HOMO and LUMO level have been calculated to understand the difference in stacking energies of the bp steps. The variation of HOMO–LUMO gap (g) of all possible bp steps on twist angle has been studied. We have observed that out of the 10 bp steps, 4 purine–purine bp steps (d(AA), d(GG), d(AG) and d(GA)), show significant variation of [Formula: see text] on twist angle. The observed variation on twist angle of d(AA) bp step has been explained by the calculated DOS and electron densities.

Promoter binding specificity is one of the important characteristics of transcription by Mycobacterium tuberculosis (Mtb) sigma (σ) factors, which remains unexplored due to limited structural evidence. Our previous study on the structural features of Mtb-SigH, consisting of three alpha helices, and its interaction with core RNA polymerase has been extended herein to determine the little known DNA sequence recognition pattern involving its cognate promoters. Herein, high resolution X-ray crystallographic structures of the protein-DNA complexes were inspected to determine the tentative DNA-binding helix of the σ factor. The binding interface in the available crystal structures is found to be populated mainly with specific residues such as Arg, Asn, Lys, Gln, and Ser. We uncovered the helix 3 of Mtb-SigH containing most of these amino acids, which ranged from Arg 64 to Arg 75, forming the predicted active site. The complex of Mtb-SigH:DNA is modelled with 20 promoter sequences. The binding affinity is predicted by scoring these protein-DNA complexes through proximity and interaction parameters obtained by molecular dynamics simulations. The promoters are ranked considering hydrogen bonding, energy of interaction, buried surface area, and distance between centers of masses in interaction with the protein. The ranking is validated through in vitro transcription assays. The trends of these selected promoter interactions have shown variations parallel to the experimental evaluation, emphasizing the success of the active site determination along with screening of the promoter strength. The promoter interaction of Mtb-SigH can be highly beneficial for understanding the regulation of gene expression of a pathogen and also extends a solid platform to predict promoters for other bacterial σ factors.

The first hydration shell of a protein exhibits heterogeneous behavior owing to several attributes, majorly local polarity and structural flexibility as revealed by solvation dynamics of secondary structural elements. We attempt to recognize the change in complex water counteraction generated due to substantial alteration in flexibility during protein complex formation. The investigation is carried out with the signaling lymphocytic activation molecule (SLAM) family of receptors, expressed by an array of immune cells, and interacting with SLAM-associated protein (SAP), composed of one SH2 domain. All atom molecular dynamics simulations are employed to the aqueous solutions of free SAP and SLAM-peptide bound SAP. We observed that water dynamics around different secondary structural elements became highly affected as well as nicely correlated with the SLAM-peptide induced change in structural rigidity obtained by thermodynamic quantification. A few instances of contradictory dynamic features of water to the change in structural flexibility are explained by means of occluded polar residues by the peptide. For βD, EFloop, and BGloop, both structural flexibility and solvent accessibility of the residues confirm the obvious contribution. Most importantly, we have quantified enhanced restriction in water dynamics around the second Fyn-binding site of the SAP due to SAP-SLAM complexation, even prior to the presence of Fyn. This observation leads to a novel argument that SLAM induced more restricted water molecules could offer more water entropic contribution during the subsequent Fyn binding and provide enhanced stability to the SAP-Fyn complex in the signaling cascade. Finally, SLAM induced water counteraction around the second binding site of the SAP sheds light on the allosteric property of the SAP, which becomes an integral part of the underlying signal transduction mechanism.

Emergence of thousands of crystal structures of noncoding RNA molecules indicates its structural and functional diversity. RNA function is based upon a large variety of structural elements which are specifically assembled in the folded molecules. Along with the canonical Watson-Crick base pairs, different orientations of the bases to form hydrogen-bonded non-canonical base pairs have also been observed in the available RNA structures. Frequencies of occurrences of different non-canonical base pairs in RNA indicate their important role to maintain overall structure and functions of RNA. There are several reports on geometry and energetic stabilities of these non-canonical base pairs. However, their stacking geometry and stacking stability with the neighboring base pairs are not well studied. Among the different non-canonical base pairs, the G:U wobble base pair (G:U W:WC) is most frequently observed in the RNA double helices. Using quantum chemical method and available experimental data set we have studied the stacking geometry of G:U W:WC base pair containing dinucleotide sequences in roll-slide parameters hyperspace for different values of twist. This study indicates that the G:U W:WC base pair can stack well with the canonical base pairs giving rise to large interaction energy. The overall preferred stacking geometry in terms of roll, twist and slide for the eleven possible dinucleotide sequences is seen to be quite dependent on their sequences. © 2015 Wiley Periodicals, Inc. Biopolymers 103: 328–338, 2015.

Designing biologically inspired nanoscale molecular assembly with desired functionality is a challenging endeavour. Here we report the designing of fibrin-inspired nanostructured peptide based sealants which facilitate remarkably fast entrapping of blood corpuscles (~28 seconds) in contrast to fibrin (~56 seconds). Our engineered sealants are stabilized by lysine-aspartate ionic interactions and also by Nε(γ-glutamyl) lysine isopeptide bond mediated covalent interaction. Each sealant is formed by two peptides having complementary charges to promote lysine-aspartate ionic interactions and designed isopeptide bond mediated interactions. Computational analysis reveals the isopeptide bond mediated energetically favourable peptide assemblies in sealants 1–3. Our designed sealants 2 and 3 mimic fibrin-mediated clot formation mechanism in presence of transglutaminase enzyme and blood corpuscles. These fibrin-inspired peptides assemble to form sealants having superior hemostatic activities than fibrin. Designed sealants feature mechanical properties, biocompatibility, biodegradability and high adhesive strength. Such nature-inspired robust sealants might be potentially translated into clinics for facilitating efficient blood clotting to handle traumatic coagulopathy and impaired blood clotting.

The signalling lymphocytic activation molecule (SLAM) family of receptors, expressed by an array of immune cells, associate with SLAM-associated protein (SAP)-related molecules, composed of single SH2 domain architecture. SAP activates Src-family kinase Fyn after SLAM ligation, resulting in a SLAM-SAP-Fyn complex, where, SAP binds the Fyn SH3 domain that does not involve canonical SH3 or SH2 interactions. This demands insight into this SAP mediated signalling cascade. Thermodynamics of the conformational changes are extracted from the histograms of dihedral angles obtained from the all-atom molecular dynamics simulations of this structurally well characterized SAP-SLAM complex. The results incorporate the binding induced thermodynamic changes of individual amino acid as well as the secondary structural elements of the protein and the solvent. Stabilization of the peptide partially comes through a strong hydrogen bonding network with the protein, while hydrophobic interactions also play a significant role where the peptide inserts itself into a hydrophobic cavity of the protein. SLAM binding widens SAP's second binding site for Fyn, which is the next step in the signal transduction cascade. The higher stabilization and less fluctuation of specific residues of SAP in the Fyn binding site, induced by SAP-SLAM complexation, emerge as the key structural elements to trigger the recognition of SAP by the SH3 domain of Fyn. The thermodynamic quantification of the protein due to complexation not only throws deeper understanding in the established mode of SAP-SLAM interaction but also assists in the recognition of the relevant residues of the protein responsible for alterations in its activity.

Understanding dinucleotide sequence directed structures of nuleic acids and their variability from experimental observation remained ineffective due to unavailability of statistically meaningful data. We have attempted to understand this from energy scan along twist, roll, and slide degrees of freedom which are mostly dependent on dinucleotide sequence using ab initio density functional theory. We have carried out stacking energy analysis in these dinucleotide parameter phase space for all ten unique dinucleotide steps in DNA and RNA using DFT-D by B97X-D/6-31G(2d,2p), which appears to satisfactorily explain conformational preferences for AU/AU step in our recent study. We show that values of roll, slide, and twist of most of the dinucleotide sequences in crystal structures fall in the low energy region. The minimum energy regions with large twist values are associated with the roll and slide values of B-DNA, whereas, smaller twist values correspond to higher stability to RNA and A-DNA like conformations. Incorporation of solvent effect by CPCM method could explain the preference shown by some sequences to occur in B-DNA or A-DNA conformations. Conformational preference of BII sub-state in B-DNA is preferentially displayed mainly by pyrimidine-purine steps and partly by purine-purine steps. The purine-pyrimidine steps show largest effect of 5-methyl group of thymine in stacking energy and the introduction of solvent reduces this effect significantly. These predicted structures and variabilities can explain the effect of sequence on DNA and RNA functionality. (c) 2014 Wiley Periodicals, Inc. Biopolymers 103: 134-147, 2015.

In this article, we empirically examine the operation of the traditional Keynesian interest rate channel of the monetary policy transmission mechanism in five emerging economies in the Middle East and North Africa (MENA) region and compare it with 14 inflation targeting (IT) emerging market economies (EMEs) using dynamic panel data analysis. Contrary to some existing studies, our empirical results provide no support for the argument that the traditional Keynesian interest rate channel is weak or does not operate effectively in the MENA region: both private consumption and investment in the MENA EMEs are sensitive to movements in real interest rates (although, in the case of private consumption, not independently of the level of financial development). We also find that interest rate elasticities of private consumption and private investment vary significantly with the level of development of the domestic financial market in the MENA EMES comparable to that in IT countries. Finally, our findings suggest that liberalization of the capital account has a significantly positive impact on private sector demand in MENA EMEs similar to that in the IT EMEs.

Double helical structures of DNA and RNA are mostly determined by base pair stacking interactions, which give them the base sequence-directed features, such as small roll values for the purine-pyrimidine steps. Earlier attempts to characterize stacking interactions were mostly restricted to calculations on fiber diffraction geometries or optimized structure using ab initio calculations lacking variation in geometry to comment on rather unusual large roll values observed in AU/AU base pair step in crystal structures of RNA double helices. We have generated stacking energy hyperspace by modeling geometries with variations along the important degrees of freedom, roll, and slide, which were chosen via statistical analysis as maximally sequence dependent. Corresponding energy contours were constructed by several quantum chemical methods including dispersion corrections. This analysis established the most suitable methods for stacked base pair systems despite the limitation imparted by number of atom in a base pair step to employ very high level of theory. All the methods predict negative roll value and near-zero slide to be most favorable for the purine-pyrimidine steps, in agreement with Calladine's steric clash based rule. Successive base pairs in RNA are always linked by sugar-phosphate backbone with C3-endo sugars and this demands C1-C1 distance of about 5.4 angstrom along the chains. Consideration of an energy penalty term for deviation of C1-C1 distance from the mean value, to the recent DFT-D functionals, specifically B97X-D appears to predict reliable energy contour for AU/AU step. Such distance-based penalty improves energy contours for the other purine-pyrimidine sequences also. (c) 2013 Wiley Periodicals, Inc. Biopolymers 101: 107-120, 2014.

This article explores the hypothesis that the propensity to consume out of income varies in a nonlinear fashion with fiscal variables, and in particular with government debt per capita. Using panel data from 18 Organization for Economic Cooperation and Development (OECD) countries, we examine whether there is any empirical evidence to support the hypothesis that households move from non-Ricardian to Ricardian behaviour as government debt reaches high levels and as uncertainty about future taxes increases. Our results provide support for this hypothesis, and also suggest that private and government consumption are complements in the household utility function.

A large amount of experimental evidence is available on the effect of magnesium ions on the structure and stability of DNA double helix. Less is known, however, on how these ions affect the stability and dynamics of the molecule. The static time average pictures from X-ray structures or the quantum chemical energy minimized structures lack understanding of the dynamic DNA–ion interaction. The present work addresses these questions by molecular dynamics simulation studies on two DNA duplexes and their interaction with magnesium ions. Results show typical B-DNA character with occasional excursions to deviated states. We detected expected stability of the duplexes in terms of backbone conformations and base pair parameter by the CHARMM-27 force field. Ion environment analysis shows that Mg2+ retains the coordination sphere throughout the simulation with a preference for major groove over minor. An extensive analysis of the influence of the Mg2+ ion shows no evidence of the popular predictions of groove width narrowing by dipositive metal ion. The major groove atoms show higher occupancy and residence time compared to minor groove for magnesium, where no such distinction is found for the charge neutralizing Na+ ions. The determining factor of Mg2+ ion’s choice in DNA binding site evolves as the steric hindrance faced by the bulky hexahydrated cation where wider major groove gets the preference. We have shown that in case of binding of Mg2+ to DNA non electrostatic contributions play a major role. An animated Interactive 3D Complement (I3DC) is available in Proteopedia at http://proteopedia.org/w/Journal:JBSD:5

Rab7 belongs to the Ras superfamily of small GTPases and is a master regulator of early to late endocytic membrane transport. Four missense mutations in the late endosomal Rab7 GTPase (L129F, K157N, N161T, and V162M) cause the autosomal dominant peripheral neuropathy Charcot-Marie-Tooth type 2B (CMT2B) disease. As yet, the pathological mechanisms connecting mutant Rab7 protein expression to altered neuronal function are undefined. Here, we analyze the effects of Rab7 CMT2B mutants on epidermal growth factor (EGF)-dependent intracellular signaling and trafficking. Three different cell lines expressing Rab7 CMT2B mutants and stimulated with EGF exhibited delayed trafficking of EGF to LAMP1-positive late endosomes and lysosomes and slowed EGF receptor (EGFR) degradation. Expression of all Rab7 CMT2B mutants altered the Rab7 activation cycle, leading to enhanced and prolonged EGFR signaling as well as variable increases in p38 and ERK1/2 activation. However, due to reduced nuclear translocation of p38 and ERK1/2, the downstream nuclear activation of Elk-1 was decreased along with the expression of immediate early genes like c-fos and Egr-1 by the disease mutants. In conclusion, our results demonstrate that Rab7 CMT2B mutants impair growth factor receptor trafficking and, in turn, alter p38 and ERK1/2 signaling from perinuclear, clustered signaling endosomes. The resulting down-regulation of EGFR-dependent nuclear transcription that is crucial for normal axon outgrowth and peripheral innervation offers a crucial new mechanistic insight into disease pathogenesis that is relevant to other neurodegenerative diseases.

Genomic DNA of higher organisms exists as extremely long polymers, while in bacteria and other lower organisms it is circular with no terminal base pairs. Temperature-induced melting of the DNA double helix by localized strand separation has been unattainable by molecular dynamic simulations due to more rapid fraying of the terminal base pairs in oligomeric DNA. However, local-sequence-dependent unfolding of the DNA double helix is extremely important for understanding various biochemical phenomena, and can be addressed by simulating a model polymeric DNA duplex. Here, we present simulations of polymeric B-DNA of sequence d(CGCGCGCGAATTCGCGCGCG)2 at elevated temperatures, along with its equivalent oligomeric constructs for comparison. Initiation of temperature-induced DNA melting was observed with higher fluctuations of the central d(AATT) region only in the model polymer. The polymeric construct shows a definite melting start site at the weaker A/T stretch, which propagates slowly through the CG rich regions. The melting is reflected in the hydrogen bond breaking, i.e. basepair opening, and by disruption of stacking interaction between successive basepairs. Melting at higher temperature of the oligomer, however, was only through terminal fraying, as also reported earlier.

In this study the structural features of dinucleotide sequences are quantitatively described in terms of the important orientation parameters of the bases and Watson-Crick base pairs using quantum chemical calculations. Variation of twist parameter in DNA and canonical RNA reveals the most probable value for each sequence. However, all the dinucleotide steps do not show the minima corresponding to specific twist value. All the quantum chemical calculations are done using DFT-D with ωB97X-D functional and 6-31G (2d,2p) basis set. In order to completely understand behavior of the base paired dinucleotide step, we have adopted Metropolis Monte Carlo simulation in 18 dimensional phase space using classical force-field. The results agree in general with the results obtained from DFT-D studies as well as experimental observations. We believe that Monte Carlo simulation with energy from DFT-D would better predict structural features of non-canonical base pairs, which appear frequently in RNA and lacks experimental details.

Quantitative-structure-toxicity-relationship (QSTR) models are developed for predicting the toxicity (pIGC50) of 252 aliphatic compounds on Tetrahymena pyriformis. The single parameter models with a simple molecular descriptor, the number of atoms in the molecule, provide reasonable results. Better QSTR models with two parameters result when global electrophilicity is used as the second descriptor. In order to tackle both charge-and frontier-controlled reactions the importance of the local electro (nucleo) philicities and atomic charges is also analysed.

DNA within the living cells experiences a diverse range of temperature, ranging from freezing condition to hot spring water. How the structure, the mechanical properties of DNA, and the solvation dynamics around DNA changes with the temperature is important to understand the functionality of DNA under those acute temperature conditions. In that notion, we have carried out molecular dynamics simulations of a DNA oligomer, containing TATA-box sequence for three different temperatures (250 K, 300 K and 350 K). We observed that the structure of the DNA, in terms of backbone torsion angles, sugar pucker, base pair parameters, and base pair step parameters, did not show any unusual properties within the studied range of temperatures, but significant structural alteration was noticed between BI and BII forms at higher temperature. As expected, the flexibility of the DNA, in terms of the torsional rigidity and the bending rigidity is highly temperature dependent, confirming that flexibility increases with increase in temperature. Additionally, the groove widths of the studied DNA showed temperature sensitivity, specifically, the major groove width decreases and the minor groove width increases, respectively, with the increase in temperature. We observed that at higher temperature, water around both the major and the minor groove of the DNA is less structured. However, the water dynamics around the minor groove of the DNA is more restricted as compared to the water around the major groove throughout the studied range of temperatures, without any anomalous behavior.

Yeast Nhx1 [Na+(K+)/H+ exchanger 1] is an intracellular Na+(K+)/H+ exchanger, localizing to the late endosome where it is important for ion homoeostasis and vesicle trafficking. Phylogenetic analysis of NHE (Na+/H+ exchanger) sequences has ident-ified orthologous proteins, including HsNHE6 (human NHE6), HsNHE7 and HsNHE9 of unknown physiological role. These appear distinct from well-studied mammalian plasma membrane isoforms (NHE1–NHE5). To explore the differences between plasma membrane and intracellular NHEs and understand the link between ion homoeostasis and vesicle trafficking, we examined the consequence of replacing residues in the intramembranous H10 loop of Nhx1 between transmembrane segments 9 and 10. The critical role for the carboxy group of Glu355 in ion transport is consistent with the invariance of this residue in all NHEs. Surprisingly, residues specifically conserved in the intracellular isoforms (such as Phe357 and Tyr361) could not be replaced with closely similar residues (leucine and phenylalanine) found in the plasma membrane isoforms without loss of function, revealing unexpected side chain specificity. The trafficking phenotypes of all Nhx1 mutants, including hygromycin-sensitivity and missorting of carboxypeptidase Y, were found to directly correlate with pH homoeostasis defects and could be proportionately corrected by titration with weak base. The present study demonstrates the importance of the H10 loop of the NHE family, highlights the differences between plasma membrane and intracellular isoforms and shows that trafficking defects are tightly coupled with pH homoeostasis.

Endosomal Na+/H+ exchangers are important for salt and osmotolerance, vacuolar pH regulation, and endosomal trafficking. We show that the C terminus of yeast Nhx1 interacts with Gyp6, a GTPase-activating protein for the Ypt/Rab family of GTPases, and that Gyp6 colocalizes with Nhx1 in the endosomal/prevacuolar compartment (PVC). The gyp6 null mutant exhibits novel phenotypes consistent with loss of negative regulation of Nhx1, including increased tolerance to hygromycin, increased vacuolar pH, and decreased plasma membrane potential. In contrast, overexpression of Gyp6 increases sensitivity to hygromycin, decreases vacuolar pH, and results in a slight missorting of vacuolar carboxypeptidase Y to the cell surface. We conclude that Gyp6 is a negative regulator of Nhx1-dependent trafficking out of the PVC. Taken together with its GTPase-activating protein-dependent role as a negative regulator of Ypt6-mediated retrograde traffic to the Golgi, we propose that Gyp6 coordinates upstream and downstream events in the PVC to Golgi pathway. Our findings provide a possible molecular link between intraendosomal pH and regulation of vesicular trafficking.

Deformation of DNA takes place quite often due to binding of small molecules or proteins with DNA. Such deformation is significant due to minor groove binding and, besides electrostatic interactions, other non-covalent interactions may also play an important role in generating such deformation. TATA-box binding protein (TBP) binds to the minor groove of DNA at the TATA box sequence, producing a large-scale deformation in DNA and initiating transcription. In order to observe the interactions of protein residues with DNA in the minor groove that produce the deformation in the DNA structure, we carried out molecular dynamics simulations of the TBP-DNA system. The results reveal consistent partial intercalation of two Phe residues, distorting stacking interactions at two dinucleotide step sites. We carried out calculations based on dispersion-corrected density functional theory to understand the source of such stabilization. We observed favorable interaction energies between the Phe residues and the base pairs with which they interact. We suggest that salt-bridge interactions between the phosphate groups and Lys or Arg residues, along with the intercalation of Phe residues between two base pair stacks, stabilize the kinked and opened-up DNA conformation.

Emergence of thousands of crystal structures of noncoding RNA molecules indicates its structural and functional diversity. RNA function is based upon a large variety of structural elements which are specifically assembled in the folded molecules. Along with the canonical Watson-Crick base pairs, different orientations of the bases to form hydrogen-bonded non-canonical base pairs have also been observed in the available RNA structures. Frequencies of occurrences of different non-canonical base pairs in RNA indicate their important role to maintain overall structure and functions of RNA. There are several reports on geometry and energetic stabilities of these non-canonical base pairs. However, their stacking geometry and stacking stability with the neighboring base pairs are not well studied. Among the different non-canonical base pairs, the G:U wobble base pair (G:U W:WC) is most frequently observed in the RNA double helices. Using quantum chemical method and available experimental data set we have studied the stacking geometry of G:U W:WC base pair containing dinucleotide sequences in roll-slide parameters hyperspace for different values of twist. This study indicates that the G:U W:WC base pair can stack well with the canonical base pairs giving rise to large interaction energy. The overall preferred stacking geometry in terms of roll, twist and slide for the eleven possible dinucleotide sequences is seen to be quite dependent on their sequences.

Understanding dinucleotide sequence directed structures of nuleic acids and their variability from experimental observation remained ineffective due to unavailability of statistically meaningful data. We have attempted to understand this from energy scan along twist, roll, and slide degrees of freedom which are mostly dependent on dinucleotide sequence using ab initio density functional theory. We have carried out stacking energy analysis in these dinucleotide parameter phase space for all ten unique dinucleotide steps in DNA and RNA using DFT-D by ωB97X-D/6-31G(2d,2p), which appears to satisfactorily explain conformational preferences for AU/AU step in our recent study. We show that values of roll, slide, and twist of most of the dinucleotide sequences in crystal structures fall in the low energy region. The minimum energy regions with large twist values are associated with the roll and slide values of B-DNA, whereas, smaller twist values correspond to higher stability to RNA and A-DNA like conformations. Incorporation of solvent effect by CPCM method could explain the preference shown by some sequences to occur in B-DNA or A-DNA conformations. Conformational preference of BII sub-state in B-DNA is preferentially displayed mainly by pyrimidine-purine steps and partly by purine-purine steps. The purine-pyrimidine steps show largest effect of 5-methyl group of thymine in stacking energy and the introduction of solvent reduces this effect significantly. These predicted structures and variabilities can explain the effect of sequence on DNA and RNA functionality.

Understanding unwinding and melting of double helical DNA is very important to characterize role of DNA in replication, transcription, translation etc. Sequence dependent melting thermodynamics is used extensively for detecting promoter regions but melting studies are generally done for short oligonucleotides. This study reports several molecular dynamics (MD) simulations of homopolymeric poly(dA).poly(dT) as regular oligonucleotide fragments as well as its corresponding polymeric constructs with water and charge-neutralizing counterions at different temperatures ranging from 300 to 400 K. We have eliminated the end-effect or terminal peeling propensity by employing MD simulation of DNA oligonucleotides in such a manner that gives rise to properties of polymeric DNA of infinite length. The dynamic properties such as basepairing and stacking geometry, groove width, backbone conformational parameters, bending, distribution of counter ions and number of hydrogen bonds of oligomeric and polymeric constructs of poly(dA).poly(dT) have been analyzed. The oligomer shows terminal fraying or peeling effect at temperatures above 340 K. The polymer shows partial melting at elevated temperatures although complete denaturations of basepairs do not take place. The analysis of cross strand hydrogen bonds shows that the number of N–H···O hydrogen bonds increases with increase in temperature while C–H···O hydrogen bond frequencies decrease with temperature. Restructuring of counterions in the minor groove with temperature appear as initiation of melting in duplex structures.

Double helical structures of DNA and RNA are mostly determined by base pair stacking interactions, which give them the base sequence-directed features, such as small roll values for the purine-pyrimidine steps. Earlier attempts to characterize stacking interactions were mostly restricted to calculations on fiber diffraction geometries or optimized structure using ab initio calculations lacking variation in geometry to comment on rather unusual large roll values observed in AU/AU base pair step in crystal structures of RNA double helices. We have generated stacking energy hyperspace by modeling geometries with variations along the important degrees of freedom, roll, and slide, which were chosen via statistical analysis as maximally sequence dependent. Corresponding energy contours were constructed by several quantum chemical methods including dispersion corrections. This analysis established the most suitable methods for stacked base pair systems despite the limitation imparted by number of atom in a base pair step to employ very high level of theory. All the methods predict negative roll value and near-zero slide to be most favorable for the purine-pyrimidine steps, in agreement with Calladine's steric clash based rule. Successive base pairs in RNA are always linked by sugar-phosphate backbone with C3'-endo sugars and this demands C1'-C1' distance of about 5.4 Å along the chains. Consideration of an energy penalty term for deviation of C1'-C1' distance from the mean value, to the recent DFT-D functionals, specifically ωB97X-D appears to predict reliable energy contour for AU/AU step. Such distance-based penalty improves energy contours for the other purine-pyrimidine sequences also. © 2013 Wiley Periodicals, Inc. Biopolymers 101: 107-120, 2014.

Using IV-GMM techniques and real-time data, we estimate a forward looking, Taylor-type reaction function incorporating dummy variables for even-keel operations and a variable for foreign official pressures on the U.S. gold stock during the Great Inflation.We show that when the Federal Reserve undertook even-keel operations to assist U.S. Treasury security sales, the FOMC tended to delay monetary-policy adjustments and to inject small amounts of reserves into the banking system.The operations, however, did not contribute significantly to the Great Inflation, because they occurred during periods of both monetary ease and monetary tightness, at least in the FOMC’s view.Consequently, the average federal funds rate during months containing even-keel events was no different than the average federal funds rate in other months, suggesting that even keel had no effect on the thrust of monetary policy.We also show that prospective gold losses had no effect on the FOMC’s monetary-policy decisions in the 1960s and early 1970s.

The three-dimensional structure of DNA contains various sequence-dependent structural information, which control many cellular processes in life, such as replication, transcription, DNA repair, etc. For the above functions, DNA double helices need to unwind or melt locally, which is different from terminal melting, as often seen in molecular dynamics (MD) simulations or even in many DNA crystal structures. We have carried out detailed MD simulations of DNA double helices of regular oligonucleotide fragments as well as in polymeric constructs with water and charge-neutralizing counter-ions at several different temperatures. We wanted to eliminate the end-effect or terminal melting propensity by employing MD simulation of DNA oligonucleotides in such a manner that gives rise to properties of polymeric DNA of infinite length. The polymeric construct is expected to allow us to see local melting at elevated temperatures. Comparative structural analysis of oligonucleotides and its corresponding virtual polymer at various temperatures ranging from 300 K to 400 K is discussed. The general behaviour, such as volume expansion coefficients of both the simulations show high similarity, indicating polymeric construct, does not give many artificial constraints. Local melting of a polymer, even at elevated temperature, may need a high nucleation energy that was not available in the short (7 ns) simulations. We expected to observe such nucleation followed by cooperative melting of the polymers in longer MD runs. Such simulations of different polymeric sequences would facilitate us to predict probable melting origins in a polymeric DNA.

This paper continues a study of one- and two-variable function space models of irreducible representations of q-analogs of Lie enveloping algebras, motivated by recurrence relations satisfied by q-hypergeometric functions. The algebra considered is the Lie algebra $m(2)$ of the group of plane motions. It is shown that various q-analogs of the exponential function can be used to mimic the exponential mapping from a Lie algebra to its Lie group, and the corresponding matrix elements of the group operators are computed on these representation spaces. This local approach applies to more general families of special functions, e.g., those with complex arguments and parameters, than does the quantum group approach. A simple one-variable model of the infinite-dimensional irreducible representations is used to compute the Clebsch–Gordan coefficients for $m(2)$ considered as a true quantum algebra. The authors derive a generalization of Koelink’s addition formula for Hahn–Exton q-Bessel functions. It is interpreted...

In this paper we empirically examine the operation of the traditional Keynesian interest rate channel of the monetary policy transmission mechanism in five potential inflation targeting economies in the MENA region and compare it with fourteen inflation targeting (IT) emerging market economies (EMEs) using panel data analysis. Contrary to some existing studies, our empirical results suggest that private consumption and investment in both groups of countries are sensitive to movements in real interest rates. Moreover, we find that the adoption of IT did not significantly alter the operation of the interest rate channel in IT EMEs. Also, the interest rate elasticities of private consumption and private investment vary with the level of development of the domestic financial market. Finally, capital account liberalization have opposite effects on private consumption and private investment in the two groups of countries.

This article continues a study of function space models of irreducible representations of q analogs of Lie enveloping algebras, motivated by recurrence relations satisfied by q‐hypergeometric functions. Here a q analog of the oscillator algebra (not a quantum algebra) is considered. It is shown that various q analogs of the exponential function can be used to mimic the exponential mapping from a Lie algebra to its Lie group and the corresponding matrix elements of the ‘‘group operators’’ on these representation spaces are computed. This ‘‘local’’ approach applies to more general families of special functions, e.g., with complex arguments and parameters, than does the quantum group approach. It is shown that the matrix elements themselves transform irreducibly under the action of the algebra. q analogs of a formula are found for the product of two hypergeometric functions 1F1 and the product of a 1F1 and a Bessel function. They are interpreted here as expansions of the matrix elements of a ‘‘group operator...

Missense mutants in the late endosomal Rab7 GTPase cause the autosomal dominant peripheral neuropathy Charcot-Marie-Tooth disease type 2B (CMT2B). As yet, the pathological mechanisms connecting mutant Rab7 protein expression to altered neuronal function are undefined. Here, we analyze the effects Rab7 CMT2B mutants on nerve growth factor (NGF) dependent intracellular signaling in PC12 cells. The nerve growth factor receptor TrkA interacted similarly with Rab7 wild-type and CMT2B mutant proteins, but the mutant proteins significantly enhanced TrkA phosphorylation in response to brief NGF stimulation. Two downstream signaling pathways (Erk1/2 and Akt) that are directly activated in response to phospho-TrkA were differentially affected. Akt signaling, arising in response to activated TrkA at the plasma membrane was unaffected. However Erk1/2 phosphorylation, triggered on signaling endosomes, was increased. Cytoplasmic phospho-Erk1/2 persisted at elevated levels relative to control samples for up to 24 h following NGF stimulation. Nuclear shuttling of phospho Erk1/2, which is required to induce MAPK phosphatase expression and down regulate signaling, was greatly reduced by the Rab7 CMT2B mutants and explains the previously reported inhibition in PC12 neurite outgrowth. In conclusion, the data demonstrate a mechanistic link between Rab7 CMT2B mutants and altered TrkA and Erk1/2 signaling from endosomes.

This paper explores the hypothesis that the propensity to consume out of income varies in a non-linear fashion with fiscal variables, and in particular with government debt per capita. Using data from eighteen OECD countries the paper examines whether there is any empirical evidence to support the hypothesis that households move from non-Ricardian to Ricardian behavior as government debt reaches high levels and as uncertainty about future taxes increases. Our results provide support for this hypothesis, and also suggest that private and government consumption are substitutes in the household utility function.

This paper analyzes the impact of capital market openness on exchange rate pass-through and subsequently on the social loss function in an inflation-targeting small open economy under a pure commitment policy. Applying the intuition behind the macroeconomic trilemma, the author examines whether a more open capital market in an inflation-targeting country improves the credibility of the central bank and consequently reduces exchange rate pass-through. First, the effect of capital openness on exchange rate pass-through is empirically examined using a new Keynesian Phillips curve. The empirical investigation reveals that limited capital openness leads to greater pass-through from the exchange rate to domestic inflation, which raises the marginal cost of deviation from the inflation target. This subsequently worsens the inflation output-gap trade-off and increases the social loss of the inflation targeting central bank under pure commitment. However, the calibration results suggest that the inflation output-gap trade-off improves and the social loss decreases even in the presence of larger exchange rate pass-through if the capital controls are effective at insulating the exchange rate from interest rate and risk-premia shocks.

Receptor tyrosine kinases (RTKs) play a pivotal role in the development and function of the cardiovascular system. Ligand-activated RTKs promote numerous downstream signal transduction pathways that lead to vascular permeability, as well as proliferation, migration, and differentiation of vascular endothelia and smooth muscle cells. Ligand binding also promotes internalization of the activated receptors either to downregulate the signaling via degradation of the ligand/receptor complex or to signal from endosomes. However, the outcomes of receptor internalization via clathrin-dependent or caveolar pathways and trafficking mechanisms are incompletely clarified in vascular systems. Activity modulation through endocytosis and vesicular trafficking significantly impacts downstream targets of RTKs such as endothelial nitric oxide synthase (eNOS) and VE-cadherin. RTKs and their associated targets are also transported to the nucleus, where they may directly impact nuclear signaling. Although the nuclear transport pathways are just beginning to be unraveled, it appears that endocytosis and vesicular trafficking are involved. In this review, we discuss the mechanisms by which activated RTKs and the downstream targets eNOS and VE-cadherin may be internalized and transported to various intracellular compartments. How localization and interacting proteins impact protein function and influence signaling is an important theme, as is the potential for modulating signaling through therapeutic targeting of activated receptors and components of the endocytic machinery.