Search

Diaphanosoma turkanae sp. nov. (Figs. 2���3) Etymology. The species name is derived from the name of lake in which the species is found. Type locality. Lake Turkana, Kenya. Type material. Holotype: a female preserved in 4 % buffered formalin deposited in Zoological Museum of Moscow State University (Ml 154). Paratypes: four females preserved in 4 % buffered formalin deposited in the same Museum (Ml 155). Description. Parthenogenetic female. Body measurements of specimens are presented in Table 1. Habitus. Body rectangular-elongated, head of moderate size (length is 38���41 % of body length), with more or less developed dorsal part, the shape of which varies to some degree (Fig. 2 A���D). Eye of medium size (5.7���7.7 % of body length) and situated close to antero-ventral corner of head. Antennule small and situated ventrally, with nine aesthetascs and rather long sensory seta (Fig. 2 E). Swimming antennae comparatively short (62.0���68.8 % of body length), with upper branch not far from reaching the posterior valve margin (Fig. 2 A). Basipodite massive, with a small, sharp spine on the outer side of its apical end close to the base of the lower branch (Fig. 2 F). Proximal segment of upper two-segmented antennal branch (exopodite) (12.6���15.6 % of body length) with small apical spine (Fig. 2 G), while that of the distal segment of the branch (15.8���19.2 % of body length) is somewhat larger (Fig. 2 H). Proximal segment of upper antennal branch always bearing three swimming setae, while the distal one has six or seven setae (of six specimens examined, two had six setae and four had seven setae) (Fig. 2 I, 2J). All antennal setae are uniformly armed by rough setulae of the ���swimming��� type. Formula for antennal setae: 3���(6���7) / 0���1���4. Shell with slightly arched dorsal side and inconspicuous or conspicuous dorso-posterior angle (Fig. 2 A, 2L, 2M). Dorsally, it has a structure consisting of more or less pronounced longitudinal ribs (Fig. 2 K). Valves with posterior margin of moderate length smoothly connected with ventral margin (Fig. 2 L) and forming a comparatively narrow, short inflexion shifted anteriorly and bearing 5���6 long, finely setulated setae, the proximal one somewhat diminished and implanted slightly submarginally; thin marginal setulae sometimes present between these setae (Fig. 3 D). Postero-ventral valve margin armed with a row of 11���19 uniform small denticles with thin setulae between each two to five of them (Fig. 2 L, 2M, 2N, 2O, 2P). A few similar setulae and rows of marginal and submarginal spinulae along posterior valve margin (Fig. 2 L, 2M). Six pairs of thoracic limbs (tl I���tl VI), all with epipodites. Structure and armament of limbs are schematically summarized in Table 2. Exopodite of tl I is comparatively narrow at its end (Fig. 3 E, 3F), while the exopodite widens terminally in limbs tl II���tl VI (Fig. 3 G, 3H). Those of tl I���tl V bear 5���6 terminal and 3���5 lateral, unsegmented, thick and long, densely setulated setae. Endopodites of tl I���tl V are inconspicuously subdivided into four segments and bear 22���38 long, two-segmented, setulated filtering setae and one (tl I) or two (tl II���tl V) outer setae, similar to those of the exopodite (Fig. 3 E, 3G: arrow). Among the latter, the subterminal one is conspicuously shorter than the other (Fig. 3 G). Small, thorn-like, naked seta on the end of proximal segment above the row of filtering setae of tl I (Fig. 3 E: ns). Gnathobase of tl I with a row of seven two-segmented, distally finely setulated setae, six of which inclined down to the food groove and one inclined in opposite direction; a group of small, curved spines near its base (Fig. 3 E). Gnathobases of tl II���tl V are larger, bearing 16���26 filtering setae, one naked seta (p) proximally and one long, two-segmented seta (I) distally with rough setulae (Fig. 3 G); an additional modified naked, hooked seta (J) with few lateral denticles near the previous one is also present in tl III��� tl V. Tl VI is small and strongly modified (Fig. 3 H, 3I); its exopodite is reduced up to terminal plate and is armed with six terminal and one lateral setae; endopodite with seven similar setae and rounded outgrowth; gnathobase with two long setae and two thorns of different sizes. Postabdomen cone-shaped with rather long postabdominal setae (43���56 % of body length), groups of spinulae on its lateral and dorsal sides, terminal claws with three basal spines, the distal one longest (Fig. 3 A, 3B). Groups and short rows of spinulae are situated above the basal spines and distally along the outer lateral side of claws. Size. Body length: 0.62���0.80 mm. Gamogenetic females and males unknown. Differential diagnosis. The new species markedly differs from all known Diaphanosoma species in presence of a low number of swimming setae on both segments of upper two-segmented antennal branch (Fig. 2 I, 2J). In most other features, this species is most similar to D. orghidani, especially to its subspecies D. orghidani orghidani, having similar body structure and armament, and in particular the shell valve margins. D. turkanae sp. nov. differs from the latter species in armament of swimming antennae, lower number of marginal setae on the ventral valve inflexion (Fig. 3 D), and presence of smaller and thinner denticles on postero-ventral valve margins (Fig. 2 N, 2O, 2P)., Published as part of Korovchinsky, Nikolai M., Walsh, Elizabeth J. & Smolak, Radoslav, 2017, Diaphanosoma Fischer, 1850 (Crustacea: Cladocera: Sididae) of Lake Turkana (East Africa), with the description of a new species of the genus, pp. 77-89 in Zootaxa 4250 (1) on pages 80-84, DOI: 10.11646/zootaxa.4250.1.6, http://zenodo.org/record/439812

Diaphanosoma lacustris Kořinek, 1981 (Fig. 4) Kořinek, 1981: 1119, Fig. 12���18 (D. birgei lacustris, partim); Korovchinsky, 1987: 741���747, Pl. V���IX; 1992: 39, figs. 185��� 190; 2004: 297, Fig. 107. Diagnosis. Parthenogenetic female. Body conically-rectangular, head comparatively small (34.5���38.8 % of body length), with a protruding dorsal part (Fig. 4 A) which is sometimes deformed (Fig. 4 B). Eye (5.2���6.8 % of body length) situated near antero-ventral or ventral head margin. Antennules small of regular type. Swimming antennae comparatively short (60.0���73.8 % of body length), with the upper antennal branch not reaching the posterior valve margin (Fig. 4 A). The proximal segment of the branch has a conspicuous apical denticle (Fig. 4 C). Shell comparatively high; valves with more or less high posterior margin bearing a small inner thorn (Fig. 4 D, 4H). The ventral valve margin has a comparatively narrow, long inflexion with 9���11 long marginal feathered setae without marginal setulae between them, proximal ones implanted submarginally. Postero-ventral valve margins bear 18���37 small, thin, densely situated denticles with thin setulae between every two to six of them (Fig. 4 F, 4G). Postabdominal claws with three basal spines, proximal one conspicuously smaller than others (Fig. 4 I). Body length: 0.78���0.98 mm. Remarks. Specimens from Lake Turkana resemble D. mongolianum in having small number of denticles on postero-ventral valve margins yet all other features (comparatively small head and eye, short swimming antenna, high posterior valve margin) unequivocally characterize them as D. lacustris. The small number of denticles on postero-ventral valve margins may be a result of inter-population morphological variability, particularly due to the small size of individuals. Similar features were found in the specimens from Lake Kinneret (Israel) and from a Bulgarian reservoir (see Korovchinsky 1987)., Published as part of Korovchinsky, Nikolai M., Walsh, Elizabeth J. & Smolak, Radoslav, 2017, Diaphanosoma Fischer, 1850 (Crustacea: Cladocera: Sididae) of Lake Turkana (East Africa), with the description of a new species of the genus, pp. 77-89 in Zootaxa 4250 (1) on page 84, DOI: 10.11646/zootaxa.4250.1.6, http://zenodo.org/record/439812, {"references":["Korinek, V. (1981) Diaphanosoma birgei n. sp. (Crustacea, Cladocera). A new species from America and its widely distributed subspecies Diaphanosoma birgei ssp. lacustris n. ssp. Canadian Journal of Zoology, 59, 1115 - 1121. https: // doi. org / 10.1139 / z 81 - 155","Korovchinsky, N. M. (1987) A study of Diaphanosoma species (Crustacea: Cladocera) of the \" mongolianum \" group. Internationale Revue der gesamten Hydrobioligie, 72 (6), 727 - 758."]}

Diaphanosoma excisum Sars, 1885 (Fig. 5) Sars, 1885: 13���18, Pl. 2, Figs. 1���3; Brehm, 1933b: 656���658, Fig. 3, Taf. 80, Figs. 17���19 (D. paucispinosum); Korovchinsky, 1992: 47, Figs. 225���235; 2004: 312, Figs 117, 118, 1, 2; Kořinek, 1984: 36���38, Pl. I���IV. Diagnosis. Parthenogenetic female. Body conically-rectangular, head of medium size (35.3���38.9 % of body length), rectangular (or may be slightly roundish anteriorly), with a developed dorsal part (Fig. 5 A, 5B). Eye comparatively large (7.1���8.9 % of body length) and situated close to ventral or antero-ventral head margin. Antennules of regular type. Swimming antennae comparatively long (65.0���81.8 %) but their upper branch not reaching the posterior valve margin. Shell is rectangular with high posterior margin (Fig. 5 A, 5D), provided with two inner spines of different size (the larger setulated) near it (Fig. 5 E, 5F). Ventral valve margin with rather wide inflexion joining with postero-ventral margin without a cut and bearing 14���15 long, marginal, feathered setae, proximal of which is smaller and sit submarginally (Fig. 5 C). Postero-ventral valve margins with 3���12 rather large denticles, numbers of which can vary considerably even between valves of the same individual (Fig. 5 D, 5G, 5H, 5I, 5J). Basal denticles of postabdominal claws, especially two distal of them, are of almost similar size (Fig. 5 K). Body length: 0.79���0.90 mm. Remarks. African representatives of this species have been described only with respect to few features: length of swimming antennae and armament of postabdomen and postero-ventral valve margin (e.g., Weltner 1896; Daday 1910; Brehm 1913; Werestschagin 1915; Delachaux 1917). More recently, comparatively more detailed descriptions have been provided by Kořinek (1984) and Guo & Dumont (2014). The specimens from Lake Turkana referred here are characterized by a moderate body size, relatively large eye, and long swimming antennae (Table 1, Fig. 5) though the latter not reaching the posterior valve margin. Generally, their morphological variability falls within the range known for the species., Published as part of Korovchinsky, Nikolai M., Walsh, Elizabeth J. & Smolak, Radoslav, 2017, Diaphanosoma Fischer, 1850 (Crustacea: Cladocera: Sididae) of Lake Turkana (East Africa), with the description of a new species of the genus, pp. 77-89 in Zootaxa 4250 (1) on pages 84-86, DOI: 10.11646/zootaxa.4250.1.6, http://zenodo.org/record/439812, {"references":["Sars, G. O. (1885) On some Australian Cladocera raised from dried mud. Forhandlingar Fidensk Selskabet Kristiania Aar 1885, 1885, 1 - 46.","Brehm, V. (1933 b) Die Cladoceren der Deutschen Limnologischen Sunda-Expedition. Archiv fur Hydrobiologie und Hydrographie, 11 (Supplement), Tropische Binnengewasser 3, 631 - 771.","Korovchinsky, N. M. (1992) Sididae & Holopediidae. Guides to the identification of the microinvertebrates of the continental waters of the world 3. SPB Academic Publishers, The Hague, 82 pp.","Korinek, V. (1984) Cladocera. In: Symoens, J. - J. (Ed.), Hydrobiological Survey of the Lake Bangweulu Luapula River basin. 13 (2). Cercle Hydrobiologique de Bruxelles, Bruxelles, pp. 1 - 117.","Weltner, W. (1896) Die Cladoceren Ost-Africas. Deutsch-Ost-Africa, 4, 1 - 14.","Daday, E. von (1910) Untersuchungen uber die Susswasser-Microfauna Deutsch Ost-Africa. Zoologica, 59 (1 - 5), 1 - 316.","Brehm, V. (1913) Cladoceren. Wissenschaftlishe Ergebnisse der zweiten deutschen Zentral-Afrika-Expedition 1910 - 1911 unter Fuhrung Adolf Friedrichs, Herzog zu Mecklenburg, 1, 35 - 40.","Werestschagin, G. Yu. (1915) Some data on Entomostraca of Central Africa. Scientific results of Zoological expedition by Professors F. A. Dogel and I. I. Sokolov in British East Africa and Uganda in 1914, 1 (5), 3 - 26 [in Russian]","Delachaux, T. (1917) Cladoceres de la region du lac Victoria Nyanza. Revue Suisse de zoologie, 25 (3), 77 - 93.","Guo, F. - F. & Dumont, H. J. (2014) Relict populations of Diaphanosoma (Cladocera: Ctenopoda) in the Chadian Sahara, with the description of a new species. Zootaxa, 3856 (1), 135 - 142."]}

Macrobiotus paulinae sp. nov. (Tables 4���5, Figs 1���45) Material examined. 173 animals and 2 eggs isolated directly from the moss sample and 14 animals and 12 eggs obtained from the in vitro culture. Specimens mounted on microscope slides in Hoyer���s medium, fixed on SEM stubs and processed for DNA sequencing. Description of the new species. Animals (measurements and statistics in Table 4): Body from white in juveniles to light yellow in adults, transparent after fixation in Hoyer���s medium (Fig. 1). In older, live animals the portion of the body posterior to legs III is swollen (Fig. 2). Eyes present (also in mounted specimens). Cuticle covered with pores and faint granulation (Figs 3���12). Small oval and round pores, 0.3���0.5 ��m in diameter (Figs 4���6), are scattered randomly on the entire cuticle, although they are larger on dorso-lateral parts of the body, including the outer surface of legs (Fig. 9). A ring of pores is present around the mouth opening, below the peribuccal sensory lobes (Fig. 12, empty arrow). Due to the small size of pores, they are difficult to observe under light microscopy (LM) (see Fig. 6, asterisks). Granulation is arranged in patches on the dorso-lateral and caudo-dorsal cuticle (body granulation) as well as on the outer surface of all legs (leg granulation) (Figs 3, 6��� 11). There are seven dorso-lateral patches of sparse granulation arranged symmetrically on both sides of the body. The patches are spaced regularly, with patches I, III and V being placed slightly anteriorly to legs I, II and III, respectively and with patches II, IV and VI being placed slightly posteriorly to legs I, II and III, respectively. Patch VII is placed between legs III and IV, at the level of the cloaca (Fig. 3). All body patches are arranged around cribriform areas (circled in Fig. 7). Rarely, and only in some of larger animals, the dorso-lateral patches may extend to the dorsum and join to form seven transverse stripes of granulation, narrow dorsally and wide laterally. The granulation on all legs is arranged into two distinct patches: a small area of fine and dense granulation just above claws (distal patch) and a larger area of more robust and sparse granulation located in the middle of each leg (proximal patch) (Figs 8���11, in all figures the distal patch is outlined with a dashed curve whereas the proximal patch is outlined with a solid curve). Compared to granulation on legs I��� III (Figs 8���9), the granulation on legs IV is more distinct and forms larger patches, with the proximal patches merged into a single transverse band of granulation (Figs 10���11). Both pores and granulation are poorly visible, with the dorso-lateral patches being the least visible, thus the cuticle has to be observed under a good quality contrast microscope and at the highest magnification in order to ensure correct interpretation. Mouth antero-ventral (Fig. 12). Bucco-pharyngeal apparatus of the Macrobiotus type, with the ventral lamina and ten small peribuccal lamellae. The lamellae are only clearly visible under SEM (Figs 13���14) and very difficult to identify under LM (Fig. 15). The oral cavity armature composed of three bands of teeth, but under LM only the third band is visible (Fig. 15) and SEM is required to reveal the first and the second bands of teeth (see Figs 13���14). The first band of teeth comprises extremely small cones arranged in a single row situated at the anterior portion of the oral cavity, on the bases of peribuccal lamellae (Fig. 13, indented arrowhead). The second band of teeth is composed of ca. five rows of slightly larger cones, positioned at the rear of the oral cavity, between the ring fold and the third band of teeth (Figs 13���14, flat arrowheads). The teeth of the third band are positioned at the rear of the oral cavity, between the second band of teeth and the buccal tube opening (Figs 13���15). Under LM, the teeth of the third band appear as a single ventral and a single dorsal thin transversal ridge (Fig. 15 and the lower insert). However, SEM reveals that both ventral and dorsal teeth indeed form continuous ridges, but with evident median and lateral peaks corresponding to median and lateral teeth in species with stronger oral cavity armatures (Fig. 14). Median teeth are smaller than the lateral teeth, which appears under LM as a thinning in the central portion of the ridges (Fig. 15 and the lower insert). In addition, there are a number of smaller accessory teeth placed laterally to the lateral teeth. These accessory teeth are more likely to develop on the ventral side than on the dorsal. Buccal tube walls are slightly thickened posterior to the stylet support insertion point (Fig. 15, empty indented arrowhead). Pharyngeal bulb spherical, with triangular apophyses, two rod-shaped macroplacoids and a triangular microplacoid (Fig. 15 and the upper insert). Macroplacoid length sequence 2 hufelandi type (Figs 16���19). Primary branches with distinct accessory points. Lunules on legs I���III smooth (Figs 16���17), but those on legs IV from crenulate in young animal to dentate in larger specimens (Figs 18���19). Bars under claws absent, but extremely faint (barely visible under LM, only clearly visible in SEM) paired muscle attachments below claws I���III present. Eggs (measurements and statistics in Table 5): Laid freely, light yellow, spherical and with a hufelandi type chorion ornamentation (Figs 20���45). The surface between processes is covered with a very dense regular reticulum (mesh diameter 0.05���0.20 ��m, reticulum thickness 0.05���0.30 ��m) (Figs 32 ���34, 38, 40���42). As these diameters are on the margin or below the resolution of LM, the mesh is only clearly visible with SEM. Under LM the mesh outline can merely be detected only on some eggs (usually only around the processes, where meshes are slightly larger), but on the majority of eggs the surface appears to be covered with faint dots when observed with PCM (Figs 24 and 26). Thus, eggs have to be observed under a good quality contrast microscope and at the highest magnification in order to ensure correct identification. Importantly, however, SEM also does not guarantee the correct identification regarding the chorion sculpture. In some of the eggs we observed with SEM, the reticulum was partially covered by a layer of an unknown substance that fills the mesh and makes the egg surface appear smooth (Figs 31, 33, 35, 39, 41 and 43). Figures 33 and 41 show a transition from a clearly visible reticulum to an obscured smooth surface. As eggs with an obscured reticulum appear smooth, they could be erroneously classified as the persimilis type (i.e. with a smooth chorion). Thus, the examination of a larger number of eggs and at magnifications> 30,000 �� is necessary in order to avoid false interpretations. Processes are in the shape of inverted goblets with slightly concave conical trunks and well-defined terminal discs (Figs 20���45). When observed under SEM, all trunks have 5���7 distinct ring undulations (Figs 36���41), whereas in LM the undulations are lightly outlined only in some processes (Fig. 28, indented arrowheads), with the majority of processes appearing to have smooth trunks. Processes exhibit a considerable variation in height and, therefore, also in the base/height ratio (e.g. see Figs 22���23). Terminal discs are cog-shaped, with a concave central area and with 8���10 small irregular teeth (Figs 28 ���29, 34��� 45). In SEM, small granules 0.05���0.08 ��m in diameter, are visible on the teeth (Figs 42���45). Approximately half the processes have one to a few teeth on the disc that are elongated into thin flexible filaments, less than 0.5 ��m in diameter and up to 20 ��m in length (Figs 34���41). The filaments are hair-like under LM, but under SEM they are covered with the same type of granulation as the disc teeth (Fig. 41), so they probably enhance the adhesive function of egg processes. Eggs found in the sample were devoid of filaments and we were able to observe them only on eggs obtained from cultured animals. The most probable explanation for this is that the filaments are very fragile and easily broken, thus are not present on some eggs. Also, the filaments are very thin so could be overlooked and/or misinterpreted as dirt attached to eggs. Therefore, extreme care must be taken when examining the eggs in order to avoid incorrect conclusions. DNA sequences. First, we sequenced all four DNA fragments for four individuals. As we found no polymorphism in any of the sequences, for the remaining ten individuals we have amplified and sequenced only ITS- 2, potentially the most variable fragment. Again, there were no differences between all fourteen sequences. Since the type population exhibited only one haplotype, only a single sequence for each of the four DNA fragments was uploaded to the GenBank. The typical DNA sequences for Ma. paulinae sp. nov. are as follows: The 18 S rRNA sequence (GenBank: KT 935502), 1731 bp long: AGATTAGCCATGCATGTCTCAGTACTTGCTTTTACAAGGCGAAACCGCGAATGGCTCATTAAATCAGTTATGGTTCACTA GATCGTAAATTTTACACGGATAACTGTGGTAATTCTAGAGCTAATACGTGCAAGCAGCTCGTTTCCTTGTGGAGCGAGCG CAGTTATTAGAACAAGACCAATCCGGCCTTCGGGTCGGTACAATTGGTGACTCTGAATAACCGAAGCGGAGCGCATGGTC TCGTACCGGCGCCAGATCTTTCAAGTGTCTGACTTATCAGCTTGTTGTTAGGTTACGTTCCTAACAAGGCTTCGACGGGT AACGGGGTATTAGGGTCCGATACCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAA TTACCCACTCCTAGCACAGGGAGGTAGTGACGAAAAATAACGATGCGAGGGCTAATAGCTTCTCGTAATCGGAATGGGTA CACTTTAAATCCTTTAACGAGGATCTATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGT ATATTAAAGTTGCTGCGGTTAAAAAGCTCGTAGTTGGATCTGGGCTTCTGAATGGACGGTTCACTTTACGGTGTAACTGC TCGTTTGGTGCCACAAGCCGGCCATGTCTTGCATGCCCTTTGCTGGGTGTGCTTGGCGACCGGAACGTTTACTTTGAAAA AATTAGAGTGCTCAAAGCAGGCGTATGGCCTTGCATAATGGTGCATGGAATAATGGAATAGGACCTCGGTTCTATTTTGT TGGTTTTCGGAACTCGAGGTAATGATTAAGAGGAACAGACGGGGGCATTCGTATTGCGGCGTTAGAGGTGAAATTCTTGG ATCGTCGCAAGACGAACTACTGCGAAAGCATTTGCCAAGAATGTTTTCATTAATCAAGAACGAAAGTTAGAGGTTCGAAG GCGATCAGATACCGCCCTAGTTCTAACCATAAACGATGCCAACCAGCGATCCGTCGGTGTTTTTTTTATGACTCGACGGG CAGCTTTCCGGGAAACCAAAGTGCTTAGGTTCCGGGGGAAGTATGGTTGCAAAGCTGAAACTTAAAGGAATTGACGGAAG GGCACCACCAGGCGTGGAGCCTGCGGCTTAATTTGACTCAACACGGGAAAACTTACCCGGCCCGGACACTGTAAGGATTG ACAGATTGAGAGCTCTTTCTTGATTCGGTGGGTGGTGGTGCATGGCCGTTCTTAGTTGGTGGAGCGATTTGTCTGGTTAA TTCCGATAACGAACGAGACTCTAGCCTGCTAAATAGCCGACCGATCCGCAGCGTCGGTTGCTACAAAAGCTTCTTAGAGG GACAGGCGGCGTTTAGTCGCACGAGATTGAGCAATAACAGGTCTGTGATGCCCTTAGATGTCCGGGGCCGCACGCGCGCT ACACTGAAGGGACCAGAGTGCTTAACTACCTTGGCCGGAAGGCCTGGGGAATCCGGTTAAACCCCTTCGTGATTGGGATT GAGCTTTGTAATTATCGCTCATGAACGAGGAATGCCCAGTACTCGCGAGTCATAAGCTCGCGATGATTACGTCCCTGCCC TTTGTACACACCGCCCGTCGCTACTACCGATTGAATGATTTAGTGAGGTCTTCGGACTGGCCGTCGATGCTGACTCTGTT GGCGTCGGTTGGATCGGAAAGACGACCAAACTGGCTCATTAGAGGAAGTAA The 28 S rRNA sequence (GenBank: KT 935501), 788 bp long: TACTAAGCGGAGGAAAAGAAACCAACGGGGATGCCGATAGTACTGCGAGTGAAATCGGCCAAGCCCAGCGCCGAATCCTG TTGCTGGCGACGGTGACAGGAACTGTGGCGTGAAGAACGTCCTTACCGGTACGGTTTGCGTGCGTAAGTTCTCCTGAGTG AGGCTCCATTCCAAGGAGGGTGCAAGACCCGTATCGCGTGCAACCGGTGTCGGTGTAAGATGTTCGGAGAGTCGCCTTGT TTGTGAGTACAAGGTGAAGTCGGTGGTAAACTCCATCGAAGGCTAAATATGACCACGAGTCCGATAGCGAACAAGTACCG TGAGGGAAAATTGAAAAGCACTTTGAAGAGAGAGCGAAACAGTGCGTGAAACCGCTCAGAGGCAAGCAAATGGGGCCTCG AAGGCAAGGCAGCGAATTCAGCTGGTGGTCTGCGCGGCTGGTTGGTTTGGAGATCTTACGACTCTGGCCGGCTGGGCTCT GAGCGTAGGTGCCAGTGCACTTTTGTTGCTTGTACGCCACCGCCGTTGAGTGGGCATCCGTCGAGTTGGCAATGCGAAGC CTTGAGCCTTTACGGGCCTAGGTGCTTGCAGCCGGCTTTTGTACGCGTTTGCACTTCAACCGGTCATGTTTGCATGTGCC AGCAATTTGGCGTTGGATCGGCTTGCTCTGCCGTTTGTCGTGAGATGACGAGCTTGCTCGGCTCTTCGGCATCTATGGTA GAATCGGGTCGGTTTCAACGTGGGCACATTGTAATTCGGTGGCGAGTAGATGGCTGCCCATTTAACCC The COI sequence (GenBank: KT 951668), 707 bp long: TTGACAGCTTGTGTAGGAACATCACTAAGCTTTTTAATCCGAACAGAACTCAGCCWACCAGGACTTCTTTTAGCTGATGA ACAAATATATAATGTCATTGTCACAAGCCACGCCTTTATTATAATTTTTTTTTTTGTAATGCCAATTCTTATTGGAGGAT TTGGTAATTGATTAATCCCTTTAATAATCAGAGCCCCCGACATAGCTTTCCCTCGTATAAATAATTTAAGATTTTGAATA CTACCTCCCTCATTTCTTCTAATTACATTAAGAACTATGGCTGAACAGGGAGCCGGTACGGGATGAACTGTGTACCCCCC TCTCTCGCATTTTTTTGCTCATAGGGGGCCTAGGGTAGACTTGACTATTTTTTCTCTTCATGTAGCCGGTATCTCCTCCA TTTTAGGGGCTATTAATTTTATTTCTACAATTATTAATATGCGAGCCCCGTTTATAAGGTTAGAAAAAATACCTCTTTTT GTTTGGTCAGTACTCCTAACTGCCATTTTACTTTTATTAGCTCTGCCTGTGCTTGCAGGGGGCATCACTATATTATTACT AGACCGAAATTTTAACACTTCTTTTTTTGACCCTGCGGGCGGGGGAGACCCTATTTTATACCAACATTTATTTTGATTTT TTGGGCATCCCGAAGTGTATATTTTAATTTTGCCTGGTTTTGGGATTATCTCTCAAATTGTAATTCA The ITS- 2 sequence (GenBank: KT 935500), 440 bp long: AAAATGCGAGACGTAACGTGAATTGCAGGACTTTGTGAACGTTAATTCTTCGAACGCACATTGCGGCTTCGGGTTAACTG AAGCCATGCCTGGTTGAGGGTCAGTTGAAATAAAAAATCGTAATCGYGCATTGATTACGGATTGTCTGGTTTTAACGGCC TTGTGTGCCGTTTCCGGATAAAGTTGAGACCAGATGTGTGCGCTCATTTGACCGGTGCAAGCAACGCTTTGCCGAGTTGG AGCATCCGACTTGTTTAGTCGTGCGCCGCAGCTGCACAATGGCTAAGCATGGTCAACCAACGGCGTTTGATGGCAAAGAA AGACTGGTACAAAAGTGCGCAAGCGCATAGACACGTCTGTGGCCGAAAAAGAACGCACCCAAGTGTGTTTTTGCTCATTC TTTTGACCTCAGCTCAGACAAGATTACCCGCTGAACTTAA Type locality. 02�� 39 ' 15.75 ''N, 36 �� 56 ' 9.99 ''E; 1824 m asl: Kenya, Eastern Province, Marsabit County, Mount Kulal Biosphere Reserve, Kulal Mt., near Gatab. Habitat: compact high, dense and shady forest (with approximately 30 min of sunshine a day reaching the forest floor). Sample: moss from a dead fallen tree (Chionanthus sp.). Coll. Radoslav Smolak. Etymology. The species is named after a former member of the Michalczyk lab and the first author���s friend, Miss Paulina Kosztyła, who wears braids that resemble fine filaments on the egg processes of the new species. Type depositories. Holotype: slide KE.001.01 (with 17 paratypes), 108 paratypes (slides: KE.001/*, where the asterisk can be substituted by any of the following numbers: 1, 2, 3, 4, 5, 6, 8, 9, 11, 13, 14, 16, 17, 18, 19, 22, 26, 27, 28) and 7 eggs (slides: KE.001/*: 21, 23, 24) are deposited at the Department of Entomology, Institute of Zoology, Jagiellonian University, Gronostajowa 9, 30- 387, Krak��w, Poland; 25 paratypes (slides: KE.001/*: 10, 12, 15, 20) and 4 eggs (slide KE.001/ 25) are deposited at the Department of Animal Taxonomy and Ecology, Institute of Environmental Biology, Adam Mickiewicz University in Poznań, Umultowska 89, 61- 614 Poznań, Poland., Published as part of Stec, Daniel, Smolak, Radoslav, Kaczmarek, ��ukasz & Michalczyk, ��ukasz, 2015, An integrative description of Macrobiotus paulinae sp. nov. (Tardigrada: Eutardigrada: Macrobiotidae: hufelandi group) from Kenya, pp. 501-526 in Zootaxa 4052 (2) on pages 506-517, DOI: 10.11646/zootaxa.4052.5.1, http://zenodo.org/record/238460