Search

The VECELL 3-D insert is a new culture scaffold consisting of collagen-coated ePTFE (expanded polytetrafluoroethylene) mesh. We analyzed the effects of VECELL 3-D inserts on the functionality of HepG2, a human hepatocellular carcinoma cell line. HepG2 cells cultured on VECELL 3-D inserts maintained a round shape, while those cultured on a standard culture plate or collagen-coated cell culture plate showed a flattened and cubic epithelial-like shape. HepG2 cells cultured on VECELL 3-D inserts had showed upregulated expression of metallothionein genes and in turn a higher tolerance to toxicity induced by heavy metals. These results suggest that HepG2 cell functions were changed by the cell morphology that is induced by culturing on a VECELL 3-D insert.

CYP3A4, the major form of cytochrome P450 (P450) expressed in the adult human liver, is involved in the metabolism of approximately 50% of commonly prescribed drugs. Several genetic polymorphisms in CYP3A4 are known to affect its catalytic activity and to contribute in part to interindividual differences in the pharmacokinetics and pharmacodynamics of CYP3A4 substrate drugs. In this study, catalytic activities of the two alleles found in East Asians, CYP3A4*16 (T185S) and CYP3A4*18 (L293P), were assessed using the following seven substrates: midazolam, carbamazepine, atorvastatin, paclitaxel, docetaxel, irinotecan, and terfenadine. The holoprotein levels of CYP3A4.16 and CYP3A4.18 were significantly higher and lower, respectively, than that of CYP3A4.1 when expressed in Sf21 insect cell microsomes together with human NADPH-P450 reductase. CYP3A4.16 exhibited intrinsic clearances (V(max)/K(m)) that were lowered considerably (by 84-60%) for metabolism of midazolam, carbamazepine, atorvastatin, paclitaxel, and irinotecan compared with CYP3A4.1 due to increased K(m) with or without decreased V(max) values, whereas no apparent decrease in intrinsic clearance was observed for docetaxel. On the other hand, K(m) values for CYP3A4.18 were comparable to those for CYP3A4.1 for all substrates except terfenadine; but V(max) values were lower for midazolam, paclitaxel, docetaxel, and irinotecan, resulting in partially reduced intrinsic clearance values (by 34-52%). These results demonstrated that the impacts of both alleles on CYP3A4 catalytic activities depend on the substrates used. Thus, to evaluate the influences of both alleles on the pharmacokinetics of CYP3A4-metabolized drugs and their drug-drug interactions, substrate drug-dependent characteristics should be considered for each drug.

Gemcitabine (2',2'-difluorodeoxycytidine) is an anticancer drug, which is effective against solid tumours, including non-small-cell lung cancer and pancreatic cancer. After gemcitabine is transported into cells by equilibrative and concentrative nucleoside transporters, it is phosphorylated by deoxycytidine kinase (DCK) and further phosphorylated to its active diphosphorylated and triphosphorylated forms. Gemcitabine is rapidly metabolized by cytidine deaminase (CDA) to an inactive metabolite, 2',2'-difluorodeoxyuridine (dFdU), which is excreted into the urine. Toxicities of gemcitabine are generally mild, but unpredictable severe toxicities such as myelosuppression and interstitial pneumonia are occasionally encountered. The aim of this study was to determine the factors, including genetic polymorphisms of CDA, DCK and solute carrier family 29A1 (SLC29A1 [hENT1]), that alter the pharmacokinetics of gemcitabine in Japanese cancer patients.250 Japanese cancer patients who received 30-minute intravenous infusions of gemcitabine at 800 or 1000 mg/m2 in the period between September 2002 and July 2004 were recruited for this study. However, four patients were excluded from the final model built in this study because they showed bimodal concentration-time curves. Two patients who experienced gemcitabine-derived life-threatening toxicities in October 2006 and January 2008 were added to this analysis. One of these patients received 30-minute intravenous infusions of gemcitabine at 454 mg/m2 instead of the usual dose (1000 mg/m2). Plasma concentrations of gemcitabine and dFdU were measured by high-performance liquid chromatography-photodiode array/mass spectrometry. In total, 1973 and 1975 plasma concentrations of gemcitabine and dFdU, respectively, were used to build population pharmacokinetic models using nonlinear mixed-effects modelling software (NONMEM version V level 1.1).Two-compartment models fitted well to plasma concentration-time curves for both gemcitabine and dFdU. Major contributing factors for gemcitabine clearance were genetic polymorphisms of CDA, including homozygous CDA*3 [208GA (Ala70Thr)] (64% decrease), heterozygous *3 (17% decrease) and CDA -31delC (an approximate 7% increase per deletion), which has a strong association with CDA*2 [79AC (Lys27Gln)], and coadministered S-1, an oral, multicomponent anti-cancer drug mixture consisting of tegafur, gimeracil and oteracil (an approximate 19% increase). The estimated contribution of homozygous CDA*3 to gemcitabine clearance provides an explanation for the life-threatening severe adverse reactions, including grade 4 neutropenia observed in three Japanese patients with homozygous CDA*3. Genetic polymorphisms of DCK and SLC29A1 (hENT1) had no significant correlation with gemcitabine pharmacokinetic parameters. Aging and increased serum creatinine levels correlated with decreased dFdU clearance.A population pharmacokinetic model that included CDA genotypes as a covariate for gemcitabine and dFdU in Japanese cancer patients was successfully constructed. The model confirms the clinical importance of the CDA*3 genotype.

Summary: The bile sait export pump (BSEP) encoded by ABCB11 is located in the canalicular membrane of hepatocytes and mediates the secretion of numerous conjugated bile salts into the bile canaliculus. In this study, 28 ABCB11 exons (including non-coding exon 1) and their flanking introns were comprehensively screened for genetic variations in 120 Japanese subjects. Fifty-nine genetic variations, including 19 novel ones, were found: 14 in the coding exons (6 nonsynonymous and 8 synonymous variations), 4 in the 3'-UTR, and 41 in the introns. Three novel nonsynonymous variations, 361C>A (Gln121Lys), 667C>T (Arg223Cys), and 1460G>T (Arg487Leu), were found as heterozygotes and at 0.004 allele frequencies. These data provide fundamental and useful information for genotyping ABCB11 in the Japanese and probably other Asian populations.

Human carboxylesterase 2 (hCE-2) is a member of the serine esterase superfamily and is responsible for hydrolysis of a wide variety of xenobiotic and endogenous esters. hCE-2 also activates an anticancer drug, irinotecan (7-ethyl-10-[4-(1-piperidino)-1-piperidino]-carbonyloxycamptothecin, CPT-11), into its active metabolite, 7-ethyl-10-hydroxycamptothecin (SN-38). In this study, a comprehensive haplotype analysis of the CES2 gene, which encodes hCE-2, in a Japanese population was conducted. Using 21 single nucleotide polymorphisms (SNPs), including 4 nonsynonymous SNPs, 100C>T (Arg(34)Trp, *2), 424G>A (Val(142)Met, *3), 1A>T (Met(1)Leu, *5), and 617G>A (Arg(206)His, *6), and a SNP at the splice acceptor site of intron 8 (IVS8-2A>G, *4), 20 haplotypes were identified in 262 Japanese subjects. In 176 Japanese cancer patients who received irinotecan, associations of CES2 haplotypes and changes in a pharmacokinetic parameter, (SN-38 + SN-38G)/CPT-11 area under the plasma concentration curve (AUC) ratio, were analyzed. No significant association was found among the major haplotypes of the *1 group lacking nonsynonymous or defective SNPs. However, patients with nonsynonymous SNPs, 100C>T (Arg(34)Trp) or 1A>T (Met(1)Leu), showed substantially reduced AUC ratios. In vitro functional characterization of the SNPs was conducted and showed that the 1A>T SNP affected translational but not transcriptional efficiency. These findings are useful for further pharmacogenetic studies on CES2-activated prodrugs.

A liver-specific transporter organic anion transporting polypeptide 1B1 (OATP1B1, also known as OATP-C) is encoded by SLCO1B1 and mediates uptake of various endogenous and exogenous compounds from blood into hepatocytes. In this study, 15 SLCO1B1 exons (including non-coding exon 1) and their flanking introns were comprehensively screened for genetic variations in 177 Japanese subjects. Sixty-two genetic variations, including 28 novel ones, were found: 7 in the 5'-flanking region, 1 in the 5'-untranslated region (UTR), 13 in the coding exons (9 nonsynonymous and 4 synonymous variations), 5 in the 3'-UTR, and 36 in the introns. Five novel nonsynonymous variations, 311T>A (Met104Lys), 509T>C (Met170Thr), 601A>G (Lys201Glu), 1553C>T (Ser518Leu), and 1738C>T (Arg580Stop), were found as heterozygotes. The allele frequencies were 0.008 for 1738C>T (Arg580Stop) and 0.003 for the four other variations. Arg580Stop having a stop codon at codon 580 results in loss of half of transmembrane domain (TMD) 11, TMD12, and a cytoplasmic tail, which might affect transport activity. In addition, novel variations, IVS12-1G>T at the splice acceptor site and -3A>C in the Kozak motif, were detected at 0.003 and 0.014 frequencies, respectively. Haplotype analysis using -11187G>A, -3A>C, IVS12-1G>T and 9 nonsynonymous variations revealed that the haplotype frequencies for (*)1b, (*)5, (*)15, and (*)17 were 0.469, 0.000 (not detected), 0.037, and 0.133, respectively. These data would provide fundamental and useful information for pharmacogenetic studies on OATP1B1-transported drugs in Japanese.

Purpose Gemcitabine is rapidly metabolized to its inactive metabolite, 2′,2′-difluorodeoxyuridine (dFdU), by cytidine deaminase (CDA). We previously reported that a patient with homozygous 208A alleles of CDA showed severe adverse reactions with an increase in gemcitabine plasma level. This study extended the investigation of the effects of CDA genetic polymorphisms on gemcitabine pharmacokinetics and toxicities. Patients and Methods Genotyping of CDA was performed by a direct sequencing of DNA obtained from the peripheral blood of Japanese gemcitabine-naïve cancer patients (n = 256). The patients recruited to the association study received a 30-minute intravenous infusion of gemcitabine at a dose of either 800 or 1,000 mg/m2, and eight blood samples were periodically collected (n = 250). Plasma levels of gemcitabine and dFdU were measured by high-performance liquid chromatography. Plasma CDA activities toward cytidine and gemcitabine were also measured (n = 121). Results Twenty-six genetic variations, including 14 novel ones and two known nonsynonymous single nucleotide polymorphisms (SNPs), were detected. Haplotypes harboring the nonsynonymous SNPs 79A>C (Lys27Gln) and 208G>A (Ala70Thr) were designated *2 and *3, respectively. The allelic frequencies of the two SNPs were 0.207 and 0.037, respectively. Pharmacokinetic parameters of gemcitabine and plasma CDA activities significantly depended on the number of haplotype *3. Haplotype *3 was also associated with increased incidences of grade 3 or higher neutropenia in the patients who were coadministered fluorouracil, cisplatin, or carboplatin. Haplotype *2 showed no significant effect on gemcitabine pharmacokinetics. Conclusion Haplotype *3 harboring a nonsynonymous SNP, 208G>A (Ala70Thr), decreased clearance of gemcitabine, and increased incidences of neutropenia when patients were coadministered platinum-containing drugs or fluorouracil.

Summary: Thirty­nine genetic variations, including thirty novel ones, were found in the human SLC29A1 gene, which encodes equilibrative nucleoside transporter 1, from 256 Japanese cancer patients administered gemcitabine. The found novel variations included –8166G > A, –8110A > G, –7947G > A, –7789 T > C, –5595G > A, –3803–3783delTCGGGGAGGTGGCAGTGGGCG, –3548G > C, –3414G > A, –1355 T > C, –34C > G, IVS1 + 141G > A, IVS1 + 260C > T, IVS1– 82C > T, 177C > G, IVS3–6C > T, 564C > T, IVS8 + 44 T > C, IVS8 + 90 T > C, IVS8 + 97 T > C, IVS8 + 131C > T, IVS8 + 169G > A, 933 T > C, 954C > T, IVS11–52G > C, IVS11–46G > A, 1288G > A, 1641C > G, 1703_1704delGT, 1812C > T, and 1861C > T. The frequencies were 0.051 for IVS8 + 169G > A, 0.012 for –7947G > A, 0.006 for IVS1 + 141G > A and 1703_1704delGT, 0.004 for –8166G > A, –8110A > G, –3548G > C, –1355 T > C, –34C > G, IVS8 + 44 T > C, and 1812C > T, and 0.002 for the other 19 variations. Among them, 177C > G and 1288G > A resulted in amino acid substitutions Asp59Glu and Ala430Thr, respectively. Using the detected polymorphisms, linkage disequilibrium analysis was performed, and 28 haplotypes were identified or inferred. Our findings would provide fundamental and useful information for genotyping SLC29A1 in the Japanese and probably other Asian populations.

Chromosome DNA is continuously exposed to various endogenous and exogenous mutagens. Among them, oxidation is one of the most common threats to genetic stability, and multiple DNA repair enzymes protect chromosome DNA from the oxidative damage. In Escherichia coli, three repair enzymes synergistically reduce the mutagenicity of oxidized base 8-hydroxy-guanine (8-OH-G). MutM DNA glycosylase excises 8-OH-G from 8-OH-G:C pairs in DNA and MutY DNA glycosylase removes adenine incorporated opposite template 8-OH-G during DNA replication. MutT hydrolyzes 8-OH-dGTP to 8-OH-dGMP in dNTP pool, thereby reducing the chance of misincorporation of 8-OH-dGTP by DNA polymerases. Simultaneous inactivation of MutM and MutY dramatically increases the frequency of spontaneous G:C to T:A mutations, and the deficiency of MutT leads to the enhancement of T:A to G:C transversions more than 1000-fold over the control level. In humans, the functional homologues of MutM, MutY and MutT, i.e., OGG1, MUTYH (MYH) and MTH1, contribute to the protection of genomic DNA from oxidative stress. Interestingly, several polymorphic forms of these proteins exist in human populations, and some of them are suggested to be associated with cancer susceptibility. Here, we review the polymorphic forms of OGG1, MUTYH and MTH1 involved in repair of 8-OH-G and 8-OH-dGTP, and discuss the significance of the polymorphisms in the maintenance of genomic integrity. We also summarize the polymorphic forms of human DNA polymerase eta, which may be involved in damage tolerance and mutagenesis induced by oxidative stress.

Purpose: Thymidylate synthase (TS) is one of the target molecules for the antitumor effects of fluoropyrimidine drugs. The cellular thymidylate synthase level is one of the determining factors for the antitumor activity of fluoropyrimidines. TYMS, which encodes TS, has been reported to possess 28-bp tandem repeat sequences in its 5′-untranslated region, the number of which varies. In addition, single nucleotide polymorphisms have also been shown in a triple repeat sequence. In this study, correlation between the polymorphic tandem repeat sequences of the TYMS gene and the antitumor activities of 5-fluorouracil (5-FU) and 5-fluoro-2′-deoxyuridine (FUdR) were investigated with 30 established human cell lines derived from solid tumors. Methods: A reporter assay system was developed in order to compare the ability of the transactivation mediated by the double (2R) and triple (c- or g-type, 3Rc or 3Rg, respectively) repeat sequences using a human colon cancer cell line, DLD-1. The 50% inhibitory concentration (IC50) of cell growth by 5-FU and FUdR was measured with 30 different established cell lines of human solid tumors. Genotypes based on the number of the 28-bp TYMS tandem repeat for the above cell lines were determined by electrophoretical analysis of PCR products containing the repeat sequences and nucleotide sequencing. Results: The reporter activity mediated by the 3Rg sequence was significantly higher than that by the 2R and 3Rc sequences. Activities mediated by the 2R and 3Rc sequences were comparable. According to the reporter assay, 2R and 3Rc were judged as low TS expression alleles and 3Rg as a high TS expression allele. On the basis of IC50 values, cells possessing the 2R/2R and 2R/3R repeat of TYMS were significantly more sensitive to FUdR than those with the 3R/3R repeat. Cells possessing 3Rg/3Rg (a high TS expression genotype) were significantly less sensitive to FUdR than cells with 2R/2R, 2R/3Rc, and 3Rc/3Rc (low TS expression genotypes). Conclusions: Our results of the reporter assays using 2R, 3Rc, and 3Rg repeat sequences prompted us to classify 3Rg as a high TS expression allele, and 2R and 3Rc as low TS expression alleles. The cells with low TS expression alleles were shown to exhibit significantly higher FUdR sensitivity than the cells with high TS expression alleles for the first time. These results were consistent with numerous previous in vitro and in vivo findings that tumors showing high TS expression were less sensitive to fluoropyrimidines. These results support the idea that genotyping the tandem repeat sequences of TYMS in the 5′-untranslated region is useful for individualized therapy involving fluoropyrimidine antitumor drugs.

Purpose: We investigated single-nucleotide polymorphisms of the cytidine deaminase gene (CDA), which encodes an enzyme that metabolizes gemcitabine, to clarify the relationship between the single-nucleotide polymorphism 208G>A and the pharmacokinetics and toxicity of gemcitabine in cancer patients treated with gemcitabine plus cisplatin. Experimental Design: Six Japanese cancer patients treated with gemcitabine plus cisplatin were examined. Plasma gemcitabine and its metabolite 2′,2′-difluorodeoxyuridine were measured using an high-performance liquid chromatography method, and the CDA genotypes were determined with DNA sequencing. Results: One patient, a 45-year-old man with pancreatic carcinoma, showed severe hematologic and nonhematologic toxicities during the first course of chemotherapy with gemcitabine and cisplatin. The area under the concentration-time curve value of gemcitabine in this patient (54.54 μg hour/mL) was five times higher than the average value for five other patients (10.88 μg hour/mL) treated with gemcitabine plus cisplatin. The area under the concentration-time curve of 2′,2′-difluorodeoxyuridine in this patient (41.58 μg hour/mL) was less than the half of the average value of the five patients (106.13 μg hour/mL). This patient was found to be homozygous for 208A (Thr70) in the CDA gene, whereas the other patients were homozygous for 208G (Ala70). Conclusion: Homozygous 208G>A alteration in CDA might have caused the severe drug toxicity experienced by a Japanese cancer patient treated with gemcitabine plus cisplatin.

Benzo[a]pyrene (B[a]P) is an environmental carcinogenic polycyclic aromatic hydrocarbon (PAH). Mammalian enzymes such as cytochrome P-450s and epoxide hydrase convert B[a]P to reactive metabolites that can covalently bind to DNA. However, some carcinogenic compounds that normally require metabolic activation can also be directly photoactivated to mutagens. To examine whether B[a]P is directly mutagenic in the presence of light, we exposed Salmonella typhimurium strains with different DNA repair capacities to B[a]P and white fluorescent light at wavelengths of 370-750 nm. B[a]P plus light significantly enhanced the number of His+ revertants. Mutagenesis was completely light-dependent and required no exogenous metabolic activation. The order of mutability of strains with different DNA repair capacities was strain YG3001 (uvrB, mutMST) >> strain TA1535 (uvrB) > strain YG3002 (mutMST) > strain TA1975. The uvrB gene product is involved in the excision repair of bulky DNA adducts, and the mutMST gene encodes 8-oxoguanine (8-oxoG) DNA glycosylase, which removes 8-oxoG from DNA. Introduction of a plasmid carrying the mOgg1 gene that is the mouse counterpart of mutMST substantially reduced the light-mediated mutagenicity of B[a]P in strain YG3001. B[a]P plus light induced predominantly G:C --> T:A and G:C --> C:G transversions. We propose that B[a]P can directly induce bulky DNA adducts if light is present, and that the DNA adducts induce oxidative DNA damage, such as 8-oxoG, when exposed to light. These findings have implications for the photocarcinogenicity of PAHs.

Deranged oxidative metabolism is a property of many tumour cells. Oxidation of the deoxynucleotide triphosphate (dNTP) pool, as well as DNA, is a major cause of genome instability. Here, we report that two Y-family DNA polymerases of the archaeon Sulfolobus solfataricus strains P1 and P2 incorporate oxidized dNTPs into nascent DNA in an erroneous manner: the polymerases exclusively incorporate 8-OH-dGTP opposite adenine in the template, and incorporate 2-OH-dATP opposite guanine more efficiently than opposite thymine. The rate of extension of the nascent DNA chain following on from these incorporated analogues is only slightly reduced. These DNA polymerases have been shown to bypass a variety of DNA lesions. Thus, our results suggest that the Y-family DNA polymerases promote mutagenesis through the erroneous incorporation of oxidized dNTPs during DNA synthesis, in addition to facilitating translesion DNA synthesis. We also report that human DNA polymerase eta, a human Y-family DNA polymerase, incorporates the oxidized dNTPs in a similar erroneous manner.

Adenine paired with 8-hydroxyguanine (oh(8)G), a major component of oxidative DNA damage, is excised by MYH base excision repair protein in human cells. Since repair activity of MYH protein on an A:G mismatch has also been reported, we compared the repair activity of His(6)-tagged MYH proteins, expressed in Spodoptera frugiperda Sf21 cells, on A:oh(8)G and A:G mismatches by DNA cleavage assay and gel mobility shift assay. We also compared the repair ability of type 1 mitochondrial protein with type 2 nuclear protein, as well as of polymorphic type 1-Q(324) and 2-Q(310) proteins with type 1-H(324) and 2-H(310) proteins by DNA cleavage assay and complementation assay of an Escherichia coli mutM mutY strain. In a reaction buffer with a low salt (0-50 mM) concentration, adenine DNA glycosylase activity of type 2 protein was detected on both A:oh(8)G and A:G substrates. However, in a reaction buffer with a 150 mM salt concentration, similar to physiological conditions, the glycosylase activity on A:G, but not on A:oh(8)G, was extremely reduced and the binding activity of type 2 protein for A:G, but not for A:oh(8)G, was proportionally reduced. The glycosylase activity on A:oh(8)G and the ability to suppress spontaneous mutagenesis were greater for type 2 than type 1 enzyme. There was apparently no difference in the repair activities between the two types of polymorphic MYH proteins. These results indicate that human MYH protein specifically catalyzes the glycosylase reaction on A:oh(8)G under physiological salt concentrations.

dinP is an Escherichia coli gene recently identified at 5.5 min of the genetic map, whose product shows a similarity in amino acid sequence to the E. coli UmuC protein involved in DNA damage-induced mutagenesis. In this paper we show that the gene is identical to dinB , an SOS gene previously localized near the lac locus at 8 min, the function of which was shown to be required for mutagenesis of nonirradiated λ phage infecting UV-preirradiated bacterial cells (termed λUTM for λ untargeted mutagenesis). A newly constructed dinP null mutant exhibited the same defect for λUTM as observed previously with a dinB ::Mu mutant, and the defect was complemented by plasmids carrying dinP as the only intact bacterial gene. Furthermore, merely increasing the dinP gene expression, without UV irradiation or any other DNA-damaging treatment, resulted in a strong enhancement of mutagenesis in F′ lac plasmids; at most, 800-fold increase in the G6-to-G5 change. The enhanced mutagenesis did not depend on recA , uvrA , or umuDC . Thus, our results establish that E. coli has at least two distinct pathways for SOS-induced mutagenesis: one dependent on umuDC and the other on dinB / P .

Gene organization of the 54-kb transfer region of IncI1 plasmid R64 was deduced from the DNA sequence. Forty-eight ORFs were found in this region. A unique DNA rearrangement designated shufflon is located at the downstream region of an operon responsible for synthesis of thin pilus. The shufflon of R64 consists of four DNA segments, designated as A, B, C, and D, which are flanked and separated by seven 19-bp repeat sequences. Site-specific recombination mediated by the product of the rci gene between any two inverted repeats results in a complex DNA rearrangement. An analysis of open reading frames revealed that the shufflon is a biological switch to select one of seven C-terminal segments of the pilV genes. The products of pilV genes were shown to be components of thin pilus which was required for liquid mating. Seven R64 derivatives where the pilV genes were fixed in the seven C-terminal segments were constructed and their transfer frequencies in liquid mating were measured using various bacterial strains as recipients. Transfer frequencies of R64 in liquid mating strongly depended on the combination of C-terminal segments of the pilV genes in donor cells and bacterial strains of recipient cells, suggesting that the shufflon determines the recipient specificity in liquid mating of plasmid R64.

Cytidine deaminase, encoded by the CDA gene, catalyzes anti-cancer drugs gemcitabine and ara-C into their respective inactive metabolites. In CDA, two functionally significant non-synonymous polymorphisms, 79A>C (Lys27Gln) and 208G>A (Ala70Thr), have been found and their minor allele frequencies (MAFs) were reported in Japanese and Chinese patients and a relatively small numbers of healthy volunteers in Caucasians and Africans. In this study, we determined the MAFs of both polymorphisms in 200 healthy volunteers of Koreans, along with 206 Japanese, 200 Chinese-Americans, 150 Caucasian-Americans and 150 African-Americans to reveal ethnic differences. MAFs of 79A>C (Lys27Gln) were 0.153 in Koreans and 0.327 in Caucasian-Americans, 0.204 in Japanese, 0.155 in Chinese-Americans and 0.087 in African-Americans. MAFs of 208G>A (Ala70Thr) were 0.005 in Koreans and 0.022 in Japanese and the minor allele was not detected in Chinese-Americans, Caucasian-Americans or African-Americans. Thus possibly, MAF of 208G>A in Japanese is likely to be somewhat higher than in Koreans and Chinese-Americans. These data would provide fundamental and useful information for pharmacogenetic studies on cytidine deaminase-catalyzing drugs.

The shufflon is a DNA region that undergoes complex rearrangement mediated by the product of a putative site-specific recombinase gene, rci. The DNA sequences of the shufflon region and the rci gene of IncI2 plasmid R721 were determined. The R721 shufflon consists of three invertible DNA segments that are homologous to the shufflon segments found in IncI1 plasmid R64. Structural analysis of open reading frames indicated that the R721 shufflon possibly functions as a biological switch for selecting one of the six pilV genes in which the N-terminal region is constant and the C-terminal region is variable. The R721 rci gene was shown to encode a basic protein of 374 amino acid residues.

CYP2C9 is a polymorphic enzyme that metabolizes a number of clinically important drugs. In this study, catalytic activities of seven alleles found in Japanese individuals, CYP2C9*3 (I359L), *13 (L90P), *26 (T130R), *28 (Q214L), *30 (A477T), *33 (R132Q), and *34 (R335Q), were assessed using three substrates (diclofenac, losartan, and glimepiride). When expressed in a baculovirus-insect cell system, the holo and total (apo and holo) CYP2C9 protein expression levels were similar among the wild type (CYP2C9.1) and six variants except for CYP2C9.13. A large part of CYP2C9.13 was present in the apo form P420. Compared with CYP2C9.1, all variants except for CYP2C9.34 exhibited substrate-dependent changes in K(m), V(max), and intrinsic clearance (V(max)/K(m)). For diclofenac 4'-hydroxylation, the intrinsic clearance was decreased markedly (by80%) in CYP2C9.13, CYP2C9.30, and CYP2C9.33 and variably (63-76%) in CYP2C9.3, CYP2C9.26, and CYP2C9.28 due to increased K(m) and/or decreased V(max) values. For losartan oxidation, CYP2C9.13 and CYP2C9.28 showed 2.5- and 1.8-fold higher K(m) values, respectively, and all variants except for CYP2C9.34 showed77% lower V(max) and intrinsic clearance values. For glimepiride hydroxylation, the K(m) of CYP2C9.13 was increased 7-fold, and the V(max) values of all variants significantly decreased, resulting in reductions in the intrinsic clearance by80% in CYP2C9.3, CYP2C9.13, CYP2C9.26, and CYP2C9.33 and by 56 to 75% in CYP2C9.28 and CYP2C9.30. These findings suggest the necessity for careful administration of losartan and glimepiride to patients bearing these six alleles.

Effects of genetic polymorphisms/variations of ABCB1, ABCC2, ABCG2 and SLCO1B1 in addition to "UGT1A1*28 or *6" on irinotecan pharmacokinetics/pharmacodynamics in Japanese cancer patients were investigated.Associations between transporter haplotypes/variations along with UGT1A1*28 or *6 and SN-38 area under the time-concentration curve (AUC) or neutropenia were examined in irinotecan monotherapy (55 patients) and irinotecan-cisplatin-combination therapy (62 patients).Higher SN-38 AUC values were observed in ABCB1 2677GT (A893S) (*2 group) for both regimens. Associations of grade 3/4 neutropenia were observed with ABCC2 -1774delG (*1A), ABCG2 421CA (Q141K) and IVS12 + 49GT ((#) IIB) and SLCO1B1 521TC (V174A) (*15 x 17) in the irinotecan monotherapy, while they were evident only in homozygotes of ABCB1*2, ABCG2 (#) IIB, SLCO1B1*15 x 17 in the cisplatin-combination therapy. With combinations of haplotypes/variations of two or more genes, neutropenia incidence increased, but their prediction power for grade 3/4 neutropenia is still unsatisfactory.Certain transporter genotypes additively increased irinotecan-induced neutropenia, but their clinical importance should be further elucidated.

To locate the transfer region of the 122-kiloase plasmid R64drd-11 belonging to incompatibility group I1, a series of deletion derivatives was constructed by in vitro recombinant DNA techniques followed by double homologous recombination in vivo. A plasmid designated pKK609 and bearing a 56.7-kilobase R64 sequence was the smallest transferable plasmid. A plasmid designated pKK610 and no longer possessing the 44-base-pair sequence of the R64 transfer system is located at one end. The other end of the R64 transfer region comprises a DNA segment of about 19 kilobases responsible for pilus formation. Shufflon, DNA with a novel rearrangement in R64, was found to be involved in pilus formation.

CYP2C8 is known to metabolize various drugs including an anticancer drug paclitaxel. Although large interindividual differences in CYP2C8 enzymatic activity and several nonsynonymous variations were reported, neither haplotype structures nor their associations with pharmacokinetic parameters of paclitaxel were reported.Haplotype structures of the CYP2C8 gene were inferred by an expectation-maximization based program using 40 genetic variations detected in 437 Japanese patients, which included cancer patients. Associations of the haplotypes and paclitaxel pharmacokinetic parameters were analyzed for 199 paclitaxel-administered cancer patients.Relatively strong linkage disequilibriums were observed throughout the CYP2C8 gene. We estimated 40 haplotypes without an amino-acid change and nine haplotypes with amino acid changes. The 40 haplotypes were classified into six groups based on network analysis. The patients with heterozygous *IG group haplotypes harboring several intronic variations showed a 2.5-fold higher median area under concentration-time curve of C3'-p-hydroxy-paclitaxel and a 1.6-fold higher median value of C3'-p-hydroxy-paclitaxel/paclitaxel area under concentration-time curve ratio than patients bearing no *IG group haplotypes (P0.001 for both comparisons by Mann-Whitney U-test). No statistically significant differences, however, were observed between patients with and without the *IG group (haplotypes) in clearance and area under concentration-time curve of paclitaxel, area under concentration-time curve of 6alpha-hydroxy-paclitaxel and 6alpha-, C3'-p-dihydroxy-paclitaxel, and area under concentration-time curve ratio of 6alpha-hydroxy-paclitaxel/paclitaxel.CYP2C8*IG group haplotypes were associated with increased area under concentration-time curve of C3'-p-hydroxy-paclitaxel and area under concentration-time curve ratio of C3'-p-hydroxy-paclitaxel/paclitaxel. Thus, *IG group haplotypes might be associated with reduced CYP2C8 activity, possibly through its reduced protein levels.

Forty genetic variations including 14 novel ones were found in the human TYMS gene, which encodes thymidylate synthase, in 263 Japanese cancer patients who received 5-fluorouracil (FU)-based chemotherapy. Three novel variations were located within the 28-bp tandem repeat sequence in the 5'-untranslated region (UTR) and were designated 5Rc, 3Rc-ins and 4Rc. Allele frequencies were 0.021 for 5Rc, 0.006 for 3Rc-ins and 0.002 for 4Rc. Other novel variations included -133G>C and -125G>C in the 5'-UTR; IVS1-278G>A, IVS2-68C>T, IVS2-23T>C, IVS4+122_+123insATTG, IVS4-141G>A, IVS5-100A>T and IVS6-111G>A in the introns; and 1244(*302)A>G and 1264(*322)G>A in the 3'-UTR. The allele frequencies were 0.34 for IVS4+122_+123insATTG, 0.042 for -133G>C, 0.011 for IVS4-141G>A, 0.006 for -125G>C, 0.004 for IVS1-278G>A, IVS2-68C>T, 1244(*302)A>G and 1264(*322)G>A, and 0.002 for IVS2-23T>C, IVS5-100A>T and IVS6-111G>A. Using the detected polymorphisms, linkage disequilibrium (LD) analysis was performed, which divided the TYMS gene into three LD blocks. The 28-bp tandem repeat sequence in the 5'-UTR was assigned as Block 2 with a total of 7 alleles. In Blocks 1 and 3, 7 and 19 haplotypes were determined/inferred, respectively. Our findings provide fundamental and useful information for genotyping TYMS in the Japanese and probably other Asian populations.

Twelve single nucleotide polymorphisms (SNPs) in the human CES2 gene, which encodes a carboxylesterase, hCE-2 [human carboxylesterase 2 (EC 3.1.1.1)], have been reported in the Japanese. In this report, we have examined functional alterations of three SNPs, a nonsynonymous SNP (100C>T, R34W), an SNP at the splice acceptor site in intron 8 (IVS8-2A>G), and one newly discovered nonsynonymous SNP (424G>A, V142M). For the two nonsynonymous SNPs, the corresponding variant cDNAs were expressed in COS-1 cells. Both the R34W and V142M variants showed little esterase activities toward the anticancer agent irinotecan and two typical carboxylesterase substrates, p-nitrophenol acetate and 4-methylumbelliferyl acetate, although increased levels of cDNA-mediated protein expression were observed by Western blotting as compared with the wild type. To investigate a possible splicing aberration in IVS8-2A>G, an in vitro splicing assay was utilized and transcripts derived from CES2 gene fragments of the wild type and IVS8-2A>G were compared. Sequence analysis of the cloned transcripts revealed that IVS8-2A>G yielded mostly aberrantly spliced transcripts, including a deleted exon or a 32-bp deletion proximal to the 5' end of exon 9, which resulted in truncated hCE-2 proteins. These results suggested that 100C>T (R34W), 424G>A (V142M), and IVS8-2A>G are functionally deficient SNPs.

In order to identify single nucleotide polymorphisms (SNPs) and haplotype frequencies of CYP3A5 in a Japanese population, we sequenced the proximal promoter region, all exons, and the surrounding intronic regions using genomic DNA from 187 Japanese subjects. Thirteen SNPs, including seven novel ones: 13108T>C, 16025A>G, 16903A>G, 16993C>G, 27448C>A, 29782A>G, and 31551T>C (A of the translational start codon of GenBank Accession # NG_000004.2 is numbered 1 according to the CYP Allele Nomenclature), were identified. The most common SNP was 6986A>G (key SNP for CYP3A5*3), with a 0.759 frequency. Two novel SNPs, 29782A>G (I456V) and 31551T>C (I488T), as well as 12952T>C (*5 marker) were found, but these alterations were always associated with the *3A marker SNPs, 6986A>G and 31611C>T. Using these 13 SNPs, haplotype analysis was performed and five novel *1 haplotypes (subtypes) (*1e to *1i) and six novel *3 haplotypes (subtypes) (*3d to *3i) were identified. Our findings suggest that CYP3A5*3 is the major defective allele and that other functional exonic SNPs are rare in the Japanese.

In Escherichia coli , the dinB gene is required for the SOS-induced λ untargeted mutagenesis pathway and confers a mutator phenotype to the cell when the gene product is overexpressed. Here, we report that the purified DinB protein is a DNA polymerase. This novel E. coli DNA polymerase (pol IV) is shown to be strictly distributive, devoid of proofreading activity, and prone to elongate bulged (misaligned) primer/template structures. Site-directed mutagenesis experiments of dinB also demonstrate that the polymerase activity of DinB is required for its in vivo mutagenicity. Along with the sequence homologies previously found within the UmuC-like protein family, these results indicate that the uncovered DNA polymerase activity may be a common feature of all these homologous proteins.

The IncI1 plasmid R64 produces two kinds of sex pili: a thin pilus and a thick pilus. The thin pilus, which belongs to the type IV family, is required only for liquid matings. Fourteen genes, pilI to - V , were found in the DNA region responsible for the biogenesis of the R64 thin pilus (S.-R. Kim and T. Komano, J. Bacteriol. 179:3594–3603, 1997). In this study, we introduced frameshift mutations into each of the 14 pil genes to test their requirement for R64 thin pilus biogenesis. From the analyses of extracellular secretion of thin pili and transfer frequency in liquid matings, we found that 12 genes, pilK to - V , are required for the formation of the thin pilus. Complementation experiments excluded the possible polar effects of each mutation on the expression of downstream genes. Two genes, traBC , were previously shown to be required for the expression of the pil genes. In addition, the rci gene is responsible for modulating the structure and function of the R64 thin pilus via the DNA rearrangement of the shufflon. Altogether, 15 genes, traBC , pilK through pilV , and rci , are essential for R64 thin pilus formation and function.

The hOGG1 gene encodes a DNA glycosylase that excises 8-hydroxyguanine (oh8Gua) from damaged DNA. Structural analyses of the hOGG1 gene and its transcripts were performed in normal and lung cancer cells. Due to a genetic polymorphism at codon 326, hOGG1-Ser326 and hOGG1-Cys326 proteins were produced in human cells. Activity in the repair of oh8Gua was greater in hOGG1-Ser326 protein than in hOGG1-Cys326 protein in the complementation assay of an E. coli mutant defective in the repair of oh8Gua. Two isoforms of hOGG1 transcripts produced by alternative splicing encoded distinct hOGG1 proteins: one with and the other without a putative nuclear localization signal. Loss of heterozygosity at the hOGG1 locus was frequently (15/ 23, 62.2%) detected in lung cancer cells, and a cell line NCI-H526 had a mutation leading to the formation of the transcripts encoding a truncated hOGG1 protein. However, the oh8Gua levels in nuclear DNA were similar among lung cancer cells and leukocytes irrespective of the type of hOGG1 proteins expressed. These results suggest that the oh8Gua levels are maintained at a steady level, even though multiple hOGG1 proteins are produced due to genetic polymorphisms, mutations and alternative splicing of the hOGG1 gene.

8-Hydroxyguanine (7,8-dihydro-8-oxoguanine: oh8Gua) is a damaged form of guanine induced by oxygen-free radicals and causes GC to TA transversions. Previously we isolated the hOGG1 gene, a human homolog of the yeast OGG1 gene, which encodes a DNA glycosylase and lyase to excise oh8Gua in DNA. In this study, we isolated a mouse homolog (Ogg1) of the OGG1 gene, characterized oh8Gua-specific DNA glycosylase/AP lyase activities of its product, and determined chromosomal localization and exon-intron organization of this gene. A predicted protein possessed five domains homologous to human and yeast OGG1 proteins. Helix-hairpin-helix and C2H2 zinc finger-like DNA-binding motifs found in human and yeast OGG1 proteins were also retained in mouse Ogg1 protein. The properties of a GST fusion protein were identical to human and yeast OGG1 proteins in glycosylase/lyase activities, their substrate specificities, and suppressive activities against the spontaneous mutagenesis of an Escherichia coli mutM mutY double mutant. The mouse Ogg1 gene was mapped to Chromosome (Chr) 6, and consisted of 7 exons approximately 6 kb long. Two DNA-binding motifs were encoded in exons 4 through 5. These data will facilitate the investigation of the OGG1 gene to elucidate the relationship between oxidative DNA damage and carcinogenesis.

We report the cloning of a human homolog of the yeast OGGC1 gene, which encodes a DNA glycosylase that excises an oxidatively damaged form of guanine, 8-hydroxyguanine (also known as 7,8-dihydro-8-oxoguanine). Since the deduced amino acid sequence (68 amino acids) of a human expressed sequence tag, N55394, matched a short stretch of yeast OGG1 protein with greater than 40% amino acid identity, a full length cDNA clone was isolated from a HeLa cell cDNA library with the N55394 clone as a probe. The cDNA clone encodes a predicted protein of 345 amino acids which is homologous to yeast OGG1 protein throughout the entire polypeptide sequence and shares 38% amino acid identity with yeast OGG1 protein. Moreover, we found that both a human homolog and yeast OGG1 protein possess two distinct DNA binding motifs, a helix-hairpin-helix (HhH) motif and a C2H2 zinc finger like motif, and a domain homologous to human and E. coli MutY proteins. Expression of a human homolog suppressed spontaneous mutagenesis of an E. coli (mutM mutY) mutant as in the case of yeast OGG1 protein. The gene was ubiquitously expressed in a variety of human organs and mapped to chromosome 3p26.2. These results strongly suggest that the gene isolated here is a human counterpart of the yeast OGGI gene and is involved in the repair of oxidative DNA damage in human cells.

The shufflon is a unique DNA rearrangement found in plasmid R64. R64 shufflon consist of four DNA segments, which are flanked and separated by seven 19-bp repeat sequences. Site-specific recombination between any inverted repeats results in a complex DNA rearrangement where four DNA segments invert independently or in groups. The shufflon is a biological switch to select one of the seven C-terminal segments of the pilV gene. To examine the biological significance of the shufflon, R64 derivatives, where the pilV gene was fixed in seven C-terminal segments, were constructed and used as donor cells for liquid mating. The transfer frequencies depended markedly on the combinations of recipient bacterial strains and C-terminal segments of the pilV gene in donor cells, indicating that the shufflon determines the recipient specificity in liquid mating of R64. The products of the pilV genes were found to be a component of thin pili produced by R64.

A 3.6-kb BglII-SmaI segment of the transfer region of IncI1 plasmid R64drd-11 was sequenced and characterized. Analysis of the DNA sequence indicated the presence of four genes, traA, traB, traC, and traD, in this region. The expression of the traB, traC, and traD genes was examined by maxicell experiments and that of the traA gene was examined by constructing the traA-lacZ fusion gene. The introduction of frameshift mutations into the four genes indicated that the traB and traC genes are essential for conjugal transfer in liquid medium and on a solid surface. Both were also required for the formation of the thin pilus, which is the receptor for phages I alpha and PR64FS. Upstream of the traA gene, a promoter sequence for sigma 70 of E. coli RNA polymerase was identified by S1 nuclease mapping and primer extension experiments.

A shufflon or clustered inversion is a novel type of DNA rearrangement originally discovered in the IncI1 plasmid R64 (T. Komano, A. Kubo, and T. Nisioka, Nucleic Acids Res. 15:1165-1172, 1987). In a 1.95-kilobase region of R64 DNA, four DNA segments inverted independently or in groups, resulting in a complex DNA rearrangement. We found similar types of shufflon in other IncI1 plasmids, including delta, pIP111, pIP565, pIP112, pIP186, R144, R163, R483, and R621a. A variant type of shufflon occurs in the IncI1 plasmid ColIb.

The R64 shufflon is a novel type of DNA rearrangement in which four DNA segments invert independently or in groups. The related plasmid ColIb carries a variant shufflon. The present sequence analysis shows that the ColIb shufflon consists of three DNA segments that are highly homologous to the A, B, and C segments of the R64 shufflon. The 329-bp D segment of R64 is not present in the ColIb shufflon. As in the case of R64, the ColIb shufflon may act as a biological switch to select one of the six open reading frames in which the N-terminal region is constant while the C-terminal region is variable.