Search

Telomeric G-quadruplexes (G4s) are non-canonical DNA structures composed of TTAGGG repeats. They are extensively studied both as biomolecules key for genome stability and as promising building blocks and functional elements in synthetic biology and nanotechnology. This is why it is extremely important to understand how the interaction between G4s is affected by their topology. We used small-angle x-ray scattering to investigate the end-to-end stacking of antiparallel telomeric G-quadruplexes formed by the sequence AG3(T2AG3)3. To represent the experimental data, we developed a highly efficient coarse-grained fitting tool, which successfully described the samples as an equilibrium mixture of monomeric and dimeric G4 species. Our findings indicate that the antiparallel topology prevents the formation of long multimeric structures under self-crowding conditions, unlike the hybrid/parallel structures formed by the same DNA sequence. This result supports the idea that the stacking of monomeric G-quadruplexes is strongly affected by the presence of diagonal loops. [ABSTRACT FROM AUTHOR]

Energy and its dissipation are fundamental to all living systems, including cells. Insufficient abundance of energy carriers─as caused by the additional burden of artificial genetic circuits─shifts a cell's priority to survival, also impairing the functionality of the genetic circuit. Moreover, recent works have shown the importance of energy expenditure in information transmission. Despite living organisms being non-equilibrium systems, non-equilibrium models capable of accounting for energy dissipation and non-equilibrium response curves are not yet employed in genetic design automation (GDA) software. To this end, we introduce Energy Aware Technology Mapping, the automated design of genetic logic circuits with respect to energy efficiency and functionality. The basis for this is an energy aware non-equilibrium steady state model of gene expression, capturing characteristics like energy dissipation─which we link to the entropy production rate─and transcriptional bursting, relevant to eukaryotes as well as prokaryotes. Our evaluation shows that a genetic logic circuit's functional performance and energy efficiency are disjoint optimization goals. For our benchmark, energy efficiency improves by 37.2% on average when comparing to functionally optimized variants. We discover a linear increase in energy expenditure and overall protein expression with the circuit size, where Energy Aware Technology Mapping allows for designing genetic logic circuits with the energetic costs of circuits that are one to two gates smaller. Structural variants improve this further, while results show the Pareto dominance among structures of a single Boolean function. By incorporating energy demand into the design, Energy Aware Technology Mapping enables energy efficiency by design. This extends current GDA tools and complements approaches coping with burden in vivo.

Living cells regulate the dynamics of developmental events through interconnected signaling systems that activate and deactivate inert precursors. This suggests that similarly, synthetic biomaterials could be designed to develop over time by using chemical reaction networks to regulate the availability of assembling components. Here we demonstrate how the sequential activation or deactivation of distinct DNA building blocks can be modularly coordinated to form distinct populations of self-assembling polymers using a transcriptional signaling cascade of synthetic genes. Our building blocks are DNA tiles that polymerize into nanotubes, and whose assembly can be controlled by RNA molecules produced by synthetic genes that target the tile interaction domains. To achieve different RNA production rates, we use a strategy based on promoter nicking and strand displacement. By changing the way the genes are cascaded and the RNA levels, we demonstrate that we can obtain spatially and temporally different outcomes in nanotube assembly, including random DNA polymers, block polymers, and as well as distinct autonomous formation and dissolution of distinct polymer populations. Our work demonstrates a way to construct autonomous supramolecular materials whose properties depend on the timing of molecular instructions for self-assembly, and can be immediately extended to a variety of other nucleic acid circuits and assemblies.

Synthetic biology primarily uses genetic engineering to control living cells. In contrast, recent work has ushered in the architectural engineering of living cells through intracellular materials. Specifically, Cyborg Bacteria are created by incorporating synthetic PEG-based hydrogel inside cells. Cyborg Bacteria do not replicate but maintain essential cellular functions, including metabolism and protein synthesis. Thus far, Cyborg Bacteria have been engineered using one primary composition of intracellular hydrogel components. Here, we demonstrate the versatility of controlling the physical and biochemical aspects of Cyborg Bacteria using different structures of hydrogels. The intracellular cell-gel architecture is modulated using a different photoinitiator, PEG-diacrylate (PEG-DA) of different molecular weights, 4arm PEG-DA, and dsDNA-PEG. We show that the molecular weight of the PEG-DA affects the generation and metabolism of Cyborg Bacteria. In addition, we show that the hybrid dsDNA-PEG intracellular hydrogel controls protein expression levels of the Cyborg Bacteria through post-transcriptional regulation and polymerase sequestration. Our work creates a new frontier of modulating intracellular gel components to control Cyborg Bacteria function and architecture.

The diversity of plant natural products presents a rich resource for accelerating drug discovery and addressing pressing human health issues. However, the challenges in accessing and cultivating source species, as well as metabolite structural complexity, and general low abundance present considerable hurdles in developing plant-derived therapeutics. Advances in high-throughput sequencing, genome assembly, gene synthesis, analytical technologies, and synthetic biology approaches, now enable us to efficiently identify and engineer enzymes and metabolic pathways for producing natural and new-to-nature therapeutics and drug candidates. This review highlights challenges and progress in plant natural product discovery and engineering by example of recent breakthroughs in identifying the missing enzymes involved in the biosynthesis of the anti-cancer agent Taxol®. These enzyme resources offer new avenues for the bio-manufacture and semi-synthesis of an old blockbuster drug.

Steroidal alkaloids are FDA-approved drugs (e.g., Zytiga) and promising drug candidates/leads (e.g., cyclopamine); yet many of the ≥697 known steroidal alkaloid natural products remain underutilized as drugs because it can be challenging to scale their biosynthesis in their producing organisms. Cyclopamine is a steroidal alkaloid produced by corn lily (Veratrum spp.) plants, and it is an inhibitor of the Hedgehog (Hh) signaling pathway. Therefore, cyclopamine is an important drug candidate/lead to treat human diseases that are associated with dysregulated Hh signaling, such as basal cell carcinoma and acute myeloid leukemia. Cyclopamine and its semi-synthetic derivatives have been studied in (pre)clinical trials as Hh inhibitor-based drugs. However, challenges in scaling the production of cyclopamine have slowed efforts to improve its efficacy and safety profile through (bio)synthetic derivatization, often limiting drug development to synthetic analogs of cyclopamine such as the FDA-approved drugs Odomzo, Daurismo, and Erivedge. If a platform for the scalable and sustainable production of cyclopamine were established, then its (bio)synthetic derivatization, clinical development, and, ultimately, widespread distribution could be accelerated. Ongoing efforts to achieve this goal include the biosynthesis of cyclopamine in Veratrum plant cell culture and the semi-/total chemical synthesis of cyclopamine. Herein, this work advances efforts towards a promising future approach: the biosynthesis of cyclopamine in engineered microorganisms. We completed the heterologous microbial production of verazine (biosynthetic precursor to cyclopamine) from simple sugars (i.e., glucose and galactose) in engineered Saccharomyces cerevisiae (S. cerevisiae) through the inducible upregulation of the native yeast mevalonate and lanosterol biosynthetic pathways, diversion of biosynthetic flux from ergosterol (i.e., native sterol in S. cerevisiae) to cholesterol (i.e., biosynthetic precursor to verazine), and expression of a refactored five-step verazine biosynthetic pathway. The engineered S. cerevisiae strain that produced verazine contains eight heterologous enzymes sourced from seven different species. Importantly, S. cerevisiae-produced verazine was indistinguishable via liquid chromatography-mass spectrometry from both a commercial standard (Veratrum spp. plant-produced) and Nicotiana benthamiana-produced verazine. To the best of our knowledge, this is the first report describing the heterologous production of a steroidal alkaloid in an engineered yeast. Verazine production was ultimately increased through design-build-test-learn cycles to a final titer of 83 ± 3 μg/L (4.1 ± 0.1 μg/g DCW). Together, this research lays the groundwork for future microbial biosynthesis of cyclopamine, (bio)synthetic derivatives of cyclopamine, and other steroidal alkaloid natural products.

Agricultural systems are under increasing pressure from declining environmental conditions, a growing population, and changes in consumer preferences, resulting in widespread malnutrition-related illnesses. Improving plant nutritional content through biotechnology techniques such as synthetic biology is a promising strategy to help combat hidden hunger caused by the lack of affordable and healthy foods in human diets. Production of compounds usually found in animal-rich diets, such as vitamin D or omega-3 fatty acids, has been recently demonstrated in planta. Here, we review recent biotechnological approaches to biofortifying plants with vitamins, minerals, and other metabolites, and summarise synthetic biology advances that offer the opportunity to build on these early biofortification efforts.

Transcription factors can promote gene expression through activation domains. Whole-genome screens have systematically mapped activation domains in transcription factors but not in non-transcription factor proteins (e.g., chromatin regulators and coactivators). To fill this knowledge gap, we employed the activation domain predictor PADDLE to analyze the proteomes of Arabidopsis thaliana and Saccharomyces cerevisiae. We screened 18,000 predicted activation domains from >800 non-transcription factor genes in both species, confirming that 89% of candidate proteins contain active fragments. Our work enables the annotation of hundreds of nuclear proteins as putative coactivators, many of which have never been ascribed any function in plants. Analysis of peptide sequence compositions reveals how the distribution of key amino acids dictates activity. Finally, we validated short, "universal" activation domains with comparable performance to state-of-the-art activation domains used for genome engineering. Our approach enables the genome-wide discovery and annotation of activation domains that can function across diverse eukaryotes.

Algae biotechnology holds immense promise for revolutionizing the bioeconomy through the sustainable and scalable production of various bioproducts. However, their development has been hindered by the lack of advanced genetic tools. This study introduces a synthetic biology approach to develop such tools, focusing on the construction and testing of synthetic promoters. By analyzing conserved DNA motifs within the promoter regions of highly expressed genes across six different algal species, we identified cis-regulatory elements (CREs) associated with high transcriptional activity. Combining the algorithms POWRS, STREME, and PhyloGibbs, we predicted 1511 CREs and inserted them into a minimal synthetic promoter sequence in 1, 2, or 3 copies, resulting in 4533 distinct synthetic promoters. These promoters were evaluated in vivo for their capacity to drive the expression of a transgene in a high-throughput manner through next-generation sequencing post antibiotic selection and fluorescence-activated cell sorting. To validate our approach, we sequenced hundreds of transgenic lines showing high levels of GFP expression. Further, we individually tested 14 identified promoters, revealing substantial increases in GFP expression─up to nine times higher than the baseline synthetic promoter, with five matching or even surpassing the performance of the native AR1 promoter. As a result of this study, we identified a catalog of CREs that can now be used to build superior synthetic algal promoters. More importantly, here we present a validated pipeline to generate building blocks for innovative synthetic genetic tools applicable to any algal species with a sequenced genome and transcriptome data set.

Advancements in synthetic biology have facilitated the incorporation of heterologous metabolic pathways into various bacterial chassis, leading to the synthesis of targeted bioproducts. However, total output from heterologous production pathways can suffer from low flux, enzyme promiscuity, formation of toxic intermediates, or intermediate loss to competing reactions, which ultimately hinder their full potential. The self-assembling, easy-to-modify, protein-based bacterial microcompartments (BMCs) offer a sophisticated way to overcome these obstacles by acting as an autonomous catalytic module decoupled from the cell's regulatory and metabolic networks. More than a decade of fundamental research on various types of BMCs, particularly structural studies of shells and their self-assembly, the recruitment of enzymes to BMC shell scaffolds, and the involvement of ancillary proteins such as transporters, regulators, and activating enzymes in the integration of BMCs into the cell's metabolism, has significantly moved the field forward. These advances have enabled bioengineers to design synthetic multi-enzyme BMCs to promote ethanol or hydrogen production, increase cellular polyphosphate levels, and convert glycerol to propanediol or formate to pyruvate. These pioneering efforts demonstrate the enormous potential of synthetic BMCs to encapsulate non-native multi-enzyme biochemical pathways for the synthesis of high-value products.

Synthetic biology constitutes a scientific domain focused on intentional redesign of organisms to confer novel functionalities or create new products through strategic engineering of their genetic makeup. Leveraging the inherent capabilities of nature, one may address challenges across diverse sectors including medicine. Inspired by this concept, we have developed an innovative bioengineering platform, enabling high-yield and large-scale production of biological small interfering RNA (BioRNA/siRNA) agents via bacterial fermentation. Herein, we show that with the use of a new tRNA fused pre-miRNA carrier, we can produce various forms of BioRNA/siRNA agents within living host cells. We report a high-level overexpression of nine target BioRNA/siRNA molecules at 100% success rate, yielding 3-10 mg of BioRNA/siRNA per 0.25 L of bacterial culture with high purity (>98%) and low endotoxin (

Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5 and 3 regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5: GTTAACTTCA) and Syn3-10b-2 (3: GGGCCTGTGG). These promoters activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5 sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3 sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter.

The field of Artificial Life studies the nature of the living state by modeling and synthesizing living systems. Such systems, under certain conditions, may come to deserve moral consideration similar to that given to nonhuman vertebrates or even human beings. The fact that these systems are nonhuman and evolve in a potentially radically different substrate should not be seen as an insurmountable obstacle to their potentially having rights, if they are sufficiently sophisticated in other respects. Nor should the fact that they owe their existence to us be seen as reducing their status as targets of moral concern. On the contrary, creators of Artificial Life may have special obligations to their creations, resembling those of an owner to their pet or a parent to their child. For a field that aims to create artificial life-forms with increasing levels of sophistication, it is crucial to consider the possible ethical implications of our activities, with an eye toward assessing potential moral obligations for which we should be prepared. If Artificial Life is larger than life, then the ethics of artificial beings should be larger than human ethics.

Ribosomally synthesized and post-translationally modified peptides (RiPPs) represent a significant potential for novel therapeutic applications because of their bioactive properties, stability, and specificity. RiPPs are synthesized on ribosomes, followed by intricate post-translational modifications (PTMs), crucial for their diverse structures and functions. PTMs, such as cyclization, methylation, and proteolysis, play crucial roles in enhancing RiPP stability and bioactivity. Advances in synthetic biology and bioinformatics have significantly advanced the field, introducing new methods for RiPP production and engineering. These methods encompass strategies for heterologous expression, genetic refactoring, and exploiting the substrate tolerance of tailoring enzymes to create novel RiPP analogs with improved or entirely new functions. Furthermore, the introduction and implementation of cutting-edge screening methods, including mRNA display, surface display, and two-hybrid systems, have expedited the identification of RiPPs with significant pharmaceutical potential. This comprehensive review not only discusses the current advancements in RiPP research but also the promising opportunities that leveraging these bioactive peptides for therapeutic applications presents, illustrating the synergy between traditional biochemistry and contemporary synthetic biology and genetic engineering approaches.

Machine learning applied to large compendia of transcriptomic data has enabled the decomposition of bacterial transcriptomes to identify independently modulated sets of genes, such iModulons represent specific cellular functions. The identification of iModulons enables accurate identification of genes necessary and sufficient for cross-species transfer of cellular functions. We demonstrate cross-species transfer of: 1) the biotransformation of vanillate to protocatechuate, 2) a malonate catabolic pathway, 3) a catabolic pathway for 2,3-butanediol, and 4) an antimicrobial resistance to ampicillin found in multiple Pseudomonas species to Escherichia coli. iModulon-based engineering is a transformative strategy as it includes all genes comprising the transferred cellular function, including genes without functional annotation. Adaptive laboratory evolution was deployed to optimize the cellular function transferred, revealing mutations in the host. Combining big data analytics and laboratory evolution thus enhances the level of understanding of systems biology, and synthetic biology for strain design and development.

Synthetic biology dictates the data-driven engineering of biocatalysis, cellular functions, and organism behavior. Integral to synthetic biology is the aspiration to efficiently find, access, interoperate, and reuse high-quality data on genotype-phenotype relationships of native and engineered biosystems under FAIR principles, and from this facilitate forward-engineering strategies. However, biology is complex at the regulatory level, and noisy at the operational level, thus necessitating systematic and diligent data handling at all levels of the design, build, and test phases in order to maximize learning in the iterative design-build-test-learn engineering cycle. To enable user-friendly simulation, organization, and guidance for the engineering of biosystems, we have developed an open-source python-based computer-aided design and analysis platform operating under a literate programming user-interface hosted on Github. The platform is called teemi and is fully compliant with FAIR principles. In this study we apply teemi for i) designing and simulating bioengineering, ii) integrating and analyzing multivariate datasets, and iii) machine-learning for predictive engineering of metabolic pathway designs for production of a key precursor to medicinal alkaloids in yeast. The teemi platform is publicly available at PyPi and GitHub.

An emerging cellular engineering method creates synthetic polymer matrices inside cells. By contrast with classical genetic, enzymatic, or radioactive techniques, this materials-based approach introduces non-natural polymers inside cells, thus modifying cellular states and functionalities. Here, we cover various materials and chemistries that have been exploited to create intracellular polymer matrices. In addition, we discuss emergent cellular properties due to the intracellular polymerization, including nonreplicating but active metabolism, maintenance of membrane integrity, and resistance to environmental stressors. We also discuss past work and future opportunities for developing and applying synthetic cells that contain intracellular polymers. The materials-based approach will usher in new applications of synthetic cells for broad biotechnological applications.

UNLABELLED: Diazotrophic bacteria can reduce atmospheric nitrogen into ammonia enabling bioavailability of the essential element. Many diazotrophs closely associate with plant roots increasing nitrogen availability, acting as plant growth promoters. These associations have the potential to reduce the need for costly synthetic fertilizers if they could be engineered for agricultural applications. However, despite the importance of diazotrophic bacteria, genetic tools are poorly developed in a limited number of species, in turn narrowing the crops and root microbiomes that can be targeted. Here, we report optimized protocols and plasmids to manipulate phylogenetically diverse diazotrophs with the goal of enabling synthetic biology and genetic engineering. Three broad-host-range plasmids can be used across multiple diazotrophs, with the identification of one specific plasmid (containing origin of replication RK2 and a kanamycin resistance marker) showing the highest degree of compatibility across bacteria tested. We then demonstrated modular expression by testing seven promoters and eleven ribosomal binding sites using proxy fluorescent proteins. Finally, we tested four small molecule inducible systems to report expression in three diazotrophs and demonstrated genome editing in Klebsiella michiganensis M5al. ONE-SENTENCE SUMMARY: In this study, broad-host plasmids and synthetic genetic parts were leveraged to enable expression tools in a library of diazotrophic bacteria.

Mosquito-borne illnesses represent a significant global health peril, resulting in approximately one million fatalities annually. West Nile, dengue, Zika, and malaria are continuously expanding their global reach, driven by factors that escalate mosquito populations and pathogen transmission. Innovative control measures are imperative to combat these catastrophic ailments. Conventional approaches, such as eliminating breeding sites and using insecticides, have been helpful, but they face challenges such as insecticide resistance and environmental harm. Given the mounting severity of mosquito-borne diseases, there is promise in exploring innovative approaches using synthetic biology to bolster mosquitoes' resistance to pathogens, or even eliminate the mosquito vectors, as a means of control. This review outlines current strategies, future goals, and the importance of gene editing for global health defenses against mosquito-borne diseases.

Filamentous fungi are critical in the transition to a more sustainable food system. While genetic modification of these organisms has promise for enhancing the nutritional value, sensory appeal, and scalability of fungal foods, genetic tools and demonstrated use cases for bioengineered food production by edible strains are lacking. Here, we develop a modular synthetic biology toolkit for Aspergillus oryzae, an edible fungus used in fermented foods, protein production, and meat alternatives. Our toolkit includes a CRISPR-Cas9 method for gene integration, neutral loci, and tunable promoters. We use these tools to elevate intracellular levels of the nutraceutical ergothioneine and the flavor-and color molecule heme in the edible biomass. The strain overproducing heme is red in color and is readily formulated into imitation meat patties with minimal processing. These findings highlight the promise of synthetic biology to enhance fungal foods and provide useful genetic tools for applications in food production and beyond.

Over the past two decades Biomedical Engineering has emerged as a major discipline that bridges societal needs of human health care with the development of novel technologies. Every medical institution is now equipped at varying degrees of sophistication with the ability to monitor human health in both non-invasive and invasive modes. The multiple scales at which human physiology can be interrogated provide a profound perspective on health and disease. We are at the nexus of creating avatars (herein defined as an extension of digital twins) of human patho/physiology to serve as paradigms for interrogation and potential intervention. Motivated by the emergence of these new capabilities, the IEEE Engineering in Medicine and Biology Society, the Departments of Biomedical Engineering at Johns Hopkins University and Bioengineering at University of California at San Diego sponsored an interdisciplinary workshop to define the grand challenges that face biomedical engineering and the mechanisms to address these challenges. The Workshop identified five grand challenges with cross-cutting themes and provided a roadmap for new technologies, identified new training needs, and defined the types of interdisciplinary teams needed for addressing these challenges. The themes presented in this paper include: 1) accumedicine through creation of avatars of cells, tissues, organs and whole human; 2) development of smart and responsive devices for human function augmentation; 3) exocortical technologies to understand brain function and treat neuropathologies; 4) the development of approaches to harness the human immune system for health and wellness; and 5) new strategies to engineer genomes and cells.

Coacervate microdroplets, arising from liquid–liquid phase separation, have emerged as promising models for primary cells, demonstrating the ability to regulate biomolecular enrichment, create chemical gradients, accelerate confined reactions, and even express proteins. Notably, multiphase coacervation provides a robust framework to replicate hierarchically complex cellular structures, offering valuable insights into cellular organization and function. In this review, we explore the recent advancements in the study of multiphase coacervates, focusing on design strategies, underlying mechanisms, structural control, and their applications in biomimetics. These developments highlight the potential of multiphase coacervates as powerful tools in the field of synthetic biology and material science. [ABSTRACT FROM AUTHOR]

Zellen benutzen transiente, membranlose Organellen um biologische Reaktionsnetzwerke zu regulieren. Stressgranula zum Beispiel sind in der Lage, selektiv mRNA einzulagern, um die Proteinexpression im Fall von Hitze oder oxidativem Stress zu regulieren. Modelle welches diese aktive Verhalten nachstellen sind nützlich um die in vivo Regulierung durch Kompartimentierung besser zu verstehen. Hier benutzen wir aktive komplexe Koazervat‐Tröpfchen als Modell für membranlose Organellen, welche die Aktivität einer katalytischen DNA (DNAzym) räumlich und zeitlich kontrollieren können. Beim Eintritt in die Peptid‐RNA‐Tröpfchen entfaltet sich das DNAzym und verliert seine Fähigkeit, einen Nukleinsäurestrang zu spalten. Wir können die DNAzym Aktivität vorübergehend pausieren, indem wir die Tröpfchenbildung mit einem Treibstoff induzieren. Nach dem Verbrauch des Treibstoffs beginnt die Aktivität des DNAzym wieder von selbst. Wir können uns vorstellen, dass dieses System zur Hoch‐ und Herunterregulierung mehrere Reaktionen in einem Netzwerk benutzt werden könnte, was zu einem besseren Verständnis der Komplexität von zellulären Reaktionswegen führen würde. Mit einem Netzwerk, in welchem das DNAzym reziprok die Eigenschaften des Tröpfchens regulieren kann, hätten wir ein vielversprechendes Instrument für die Konstruktion von synthetischen Zellen. [ABSTRACT FROM AUTHOR]

Cells use transient membraneless organelles to regulate biological reaction networks. For example, stress granules selectively store mRNA to downregulate protein expression in response to heat or oxidative stress. Models mimicking this active behavior should be established to better understand in vivo regulation involving compartmentalization. Here we use active, complex coacervate droplets as a model for membraneless organelles to spatiotemporally control the activity of a catalytic DNA (DNAzyme). Upon partitioning into these peptide‐RNA droplets, the DNAzyme unfolds and loses its ability to catalyze the cleavage of a nucleic acid strand. We can transiently pause the DNAzyme activity upon inducing droplet formation with fuel. After fuel consumption, the DNAzyme activity autonomously restarts. We envision this system could be used to up and downregulate multiple reactions in a network, helping understand the complexity of a cell's pathways. By creating a network where the DNAzyme could reciprocally regulate the droplet properties, we would have a powerful tool for engineering synthetic cells. [ABSTRACT FROM AUTHOR]

Morphogens, locally produced signaling molecules, form a concentration gradient to guide tissue patterning. Tissue patterns emerge as a collaboration between morphogen diffusion and responsive cell behaviors, but the mechanisms through which diffusing morphogens define precise spatial patterns amidst biological fluctuations remain unclear. To investigate how cells respond to diffusing proteins to generate tissue patterns, we develop SYMPLE3D, a 3D culture platform. By engineering gene expression responsive to artificial morphogens, we observe that coupling morphogen signals with cadherin-based adhesion is sufficient to convert a morphogen gradient into distinct tissue domains. Morphogen-induced cadherins gather activated cells into a single domain, removing ectopically activated cells. In addition, we reveal a switch-like induction of cadherin-mediated compaction and cell mixing, homogenizing activated cells within the morphogen gradient to form a uniformly activated domain with a sharp boundary. These findings highlight the cooperation between morphogen gradients and cell adhesion in robust tissue patterning and introduce a novel method for tissue engineering to develop new tissue domains in organoids. Synopsis: A synthetic biology approach termed SYMPLE3D demonstrates that cell adhesion output in response to diffusible proteins can convert a signaling gradient into binarized tissue domains with a sharp boundary. The SYMPLE3D system allows to explore which cellular responses to secreted proteins can robustly generate multicellular patterns. Interlocking of morphogen gradient and cadherin induces a robust pattern of distinct tissue domains with a sharp boundary. Morphogen-induced cadherin gathers receiver cells to remove ectopically-activated cells within a signaling gradient. A switch-like property of cadherin function causes cell mixing inside a morphogen gradient, generating a uniformly-activated tissue domain. A synthetic biology approach termed SYMPLE3D demonstrates that cell adhesion output in response to diffusible proteins can convert a signaling gradient into binarized tissue domains with a sharp boundary. [ABSTRACT FROM AUTHOR]

An increasing population, climate change, and diminishing natural resources present severe threats to global food security, with traditional breeding and genetic engineering methods often falling short in addressing these rapidly evolving challenges. CRISPR/Cas systems have emerged as revolutionary tools for precise genetic modifications in crops, offering significant advancements in resilience, yield, and nutritional value, particularly in staple crops like rice and maize. This review highlights the transformative potential of CRISPR/Cas technology, emphasizing recent innovations such as prime and base editing, and the development of novel CRISPR-associated proteins, which have significantly improved the specificity, efficiency, and scope of genome editing in agriculture. These advancements enable targeted genetic modifications that enhance tolerance to abiotic stresses as well as biotic stresses. Additionally, CRISPR/Cas plays a crucial role in improving crop yield and quality by enhancing photosynthetic efficiency, nutrient uptake, and resistance to lodging, while also improving taste, texture, shelf life, and nutritional content through biofortification. Despite challenges such as off-target effects, the need for more efficient delivery methods, and ethical and regulatory concerns, the review underscores the importance of CRISPR/Cas in addressing global food security and sustainability challenges. It calls for continued research and integration of CRISPR with other emerging technologies like nanotechnology, synthetic biology, and machine learning to fully realize its potential in developing resilient, productive, and sustainable agricultural systems. [ABSTRACT FROM AUTHOR]

Introduction: Cancer is still a major challenge of human health. The abnormality of intracellular cancer-related signal pathways is an important mechanism for the occurrence of cancer. Methods: We used a molecular-senor to act on the endogenous signal molecules within the cell to redirect the abnormal signal flows in the cell to treat cancer. Based on CRISPR-dCas12f procedures, we combined aptamers and ribozymes to construct riboswitches, which served as molecular switches to reprogram sgRNAs, so that CRISPR-dCas12f redirected the intracellular anti-cancer signal flows after sensing specific input signal molecules. In addition, the activated molecular sensors and the inhibitory molecular sensors were constructed by combining transcription factors (VP64) and transcription inhibitors (KRAB) to specifically activate and inhibit target genes of interest. Results: Our experimental results showed that the molecular sensors that we designed and constructed specifically sensed the endogenous signal molecules and then redirect the cancer related signal networks of cancer cells. In addition, corresponding logic gates were constructed to distinguish cancer cells from normal cells and redirect anticancer signal flows to trigger specific cancer immunotherapy. Conclusion: The constructed molecular sensors constructed specifically recognized the signal molecules within the cell and redirected the endogenous signal pathway to reprogram the fate of cancer cells. [ABSTRACT FROM AUTHOR]

The methylotrophic yeast Ogataea polymorpha shows potential in methanol biotransformation that is a promising approach for green biomanufacturing and carbon neutrality. The development of synthetic biology tools has facilitated the metabolic rewiring and production of various chemicals in O. polymorpha. Systems biology could help deepen our understanding of global metabolic systems and support the engineering of synthetic metabolic capabilities in O. polymorpha. Ogataea (Hansenula) polymorpha is a nonconventional yeast with some unique characteristics, including fast growth, thermostability, and broad substrate spectrum. Other than common applications for protein production, O. polymorpha is attracting interest for chemical and protein production from methanol; a promising feedstock for the next-generation biomanufacturing due to its abundant sources and excellent characteristics. Benefiting from the development of synthetic biology, it has been engineered to produce value-added chemicals by extensively rewiring cellular metabolism. This Review discusses recently developed synthetic biology tools of O. polymorpha. The advances of chemicals production and systems biology were reviewed comprehensively. Finally, we look ahead to the developments of biomanufacturing in O. polymorpha to make an overall understanding of this chassis for academia and industry. [ABSTRACT FROM AUTHOR]

Omega fatty acids are important for human health. They are traditionally extracted from animals or plants but can be alternatively produced using oleaginous yeast. Current efforts are producing yeast strains with similar fatty acid distributions and powerful lipogenesis capacity. The next step is to further make the process more competitive. [ABSTRACT FROM AUTHOR]

Microbial fermentation has provided fermented foods and important chemicals such as antibiotics, amino acids, and vitamins. Metabolic engineering of synthetic microbes has expanded the range of compounds produced by fermentation. Petroleum-derived aromatic compounds are widely used in industry as raw materials for pharmaceuticals, dyes, and polymers and are in great demand. This review highlights the current efforts in the microbial production of various aromatic chemicals such as aromatic amines, cinnamic acid derivatives, and flavoring aromatics, including their biosynthesis pathways. In addition, the unique biosynthetic mechanism of pyrazine, a heterocyclic compound, from amino acids is described to expand the use of biomass-derived aromatic compounds. I also discuss our efforts to develop high-performance bioplastics superior to petroleum plastics from the aromatic compounds produced by microbial fermentation. [ABSTRACT FROM AUTHOR]

Cellulases and xylanases are plant cell wall-degrading enzymes (CWDEs) that are critical to sustainable bioproduction based on renewable lignocellulosic biomass to reduce carbon dioxide emission. Currently, these enzymes are mainly produced from filamentous fungi, especially Trichoderma reesei and Penicillium oxalicum. However, an in-depth comparison of these two producers has not been performed. Although both P. oxalicum and T. reesei harbor CWDE systems, they exhibit distinct features regulating the production of these enzymes, mainly through different transcriptional regulatory networks. This review presents the strikingly different modes of genome-wide regulation of cellulase and xylanase biosynthesis in P. oxalicum and T. reesei, including sugar transporters, signal transduction cascades, transcription factors, chromatin remodeling, and three-dimensional organization of chromosomes. In addition, different molecular breeding approaches employed, based on the understanding of the regulatory networks, are summarized. This review highlights the existence of very different regulatory modes leading to the efficient regulation of CWDE production in filamentous fungi, akin to the adage that "every road leads to Rome." An understanding of this divergence may help further improvements in fungal enzyme production through the metabolic engineering and synthetic biology of certain fungal species. [ABSTRACT FROM AUTHOR]

In the past few years, synthetic biologists have established some biological elements and bioreactors composed of nucleotides under the guidance of engineering methods. Following the concept of engineering, the common bioreactor components in recent years are introduced and compared. At present, biosensors based on synthetic biology have been applied to water pollution monitoring, disease diagnosis, epidemiological monitoring, biochemical analysis and other detection fields. In this paper, the biosensor components based on synthetic bioreactors and reporters are reviewed. In addition, the applications of biosensors based on cell system and cell-free system in the detection of heavy metal ions, nucleic acid, antibiotics and other substances are presented. Finally, the bottlenecks faced by biosensors and the direction of optimization are also discussed. [ABSTRACT FROM AUTHOR]

Serine integrases are phage- (or mobile element-) encoded enzymes that catalyse site-specific recombination reactions between a short DNA sequence on the phage genome (attP) and a corresponding host genome sequence (attB), thereby integrating the phage DNA into the host genome. Each integrase has its unique pair of attP and attB sites, a feature that allows them to be used as orthogonal tools for genome modification applications. In the presence of a second protein, the Recombination Directionality Factor (RDF), integrase catalyses the reverse excisive reaction, generating new recombination sites, attR and attL. In addition to promoting attR x attL reaction, the RDF inhibits attP x attB recombination. This feature makes the directionality of integrase reactions programmable, allowing them to be useful for building synthetic biology devices. In this report, we describe the degree of orthogonality of both integrative and excisive reactions for three related integrases (ϕC31, ϕBT1, and TG1) and their RDFs. Among these, TG1 integrase is the most active, showing near complete recombination in both attP x attB and attR x attL reactions, and the most directional in the presence of its RDF. Our findings show that there is varying orthogonality among these three integrases – RDF pairs. ϕC31 integrase was the least selective, with all three RDFs activating it for attR x attL recombination. Similarly, ϕC31 RDF was the least effective among the three RDFs in promoting the excisive activities of the integrases, including its cognate ϕC31 integrase. ϕBT1 and TG1 RDFs were noticeably more effective than ϕC31 RDF at inhibiting attP x attB recombination by their respective integrases, making them more suitable for building reversible genetic switches. AlphaFold-Multimer predicts very similar structural interactions between each cognate integrase – RDF pair. The binding surface on the RDF is much more conserved than the binding surface on the integrase, an indication that specificity is determined more by the integrase than the RDF. Overall, the observed weak integrase/RDF orthogonality across the three enzymes emphasizes the need for identifying and characterizing more integrase – RDF pairs. Additionally, the ability of a particular integrase's preferred reaction direction to be controlled to varying degrees by non-cognate RDFs provides a path to tunable, non-binary genetic switches. [ABSTRACT FROM AUTHOR]

A dominant assumption in pharmacology throughout the 20th century has been that in vivo target occupancy—and attendant pharmacodynamics—depends on the systemic concentration of drug relative to the equilibrium dissociation constant for the drug–target complex. In turn, the duration of pharmacodynamics is temporally linked to the systemic pharmacokinetics of the drug. Yet, there are many examples of drugs for which pharmacodynamic effect endures long after the systemic concentration of a drug has waned to (equilibrium) insignificant levels. To reconcile such data, the drug–target residence time model was formulated, positing that it is the lifetime (or residence time) of the binary drug–target complex, and not its equilibrium affinity per se, that determines the extent and duration of drug pharmacodynamics. Here, we review this model, its evolution over time, and its applications to natural ligand‐macromolecule biology and synthetic drug–target pharmacology. [ABSTRACT FROM AUTHOR]

The flavonoid diosmin (diosmetin 7-O-rutinoside) is used as a therapeutic agent for disorders of the blood vessels such as hemorrhoids and varicose veins. Diosmin is commercially produced using semi-synthetic methods involving the oxidation of hesperidin, the most abundant flavonoid in citrus fruits. However, this method produces byproducts that are toxic to the environment, and new sustainable methods to produce diosmin are required. Here, we used a synthetic biology approach to produce diosmin without generating toxic byproducts through reconstitution of the diosmin biosynthetic pathway in Nicotiana benthamiana. We first established that N. benthamiana leaves co-infiltrated with all seven genes in the flavonoid biosynthesis pathway produced high levels of luteolin, a precursor of diosmetin. We then compared the activity of modification enzymes such as methyltransferases, glucosyltransferases, and rhamnosyltransferases in Escherichia coli and in planta and selected genes encoding enzymes with the highest activity for producing diosmetin, diosmetin 7-O-glucoside, and diosmin, respectively. Finally, we reconstructed the entire diosmin biosynthetic pathway using three constructs containing ten genes encoding enzymes in this pathway, from phenylalanine ammonia lyase to rhamnosyltransferase. N. benthamiana leaves transiently co-expressing all these genes yielded 37.7 µg diosmin per gram fresh weight. To our knowledge, this is the first report of diosmin production in a heterologous plant system without the supply of a precursor. Successful production of diosmin in N. benthamiana opens new avenues for producing other commercially important flavonoids using similar platforms. [ABSTRACT FROM AUTHOR]

Xylose is an abundant, inexpensive and readily available carbohydrate common in minimally processed feedstocks such as seaweed and algae. While a wide variety of marine microbes have evolved to utilize seaweed and algae, only a few currently have the requisite characteristics and genetic engineering tools necessary to entertain the use of these underutilized feedstocks. The rapidly growing Gram‐negative halophilic bacterium Vibrio natriegens is one such chassis. In this study, we engineered and tested xylose induction in V. natriegens as a tool for scalable bioproduction applications. First, we created a sensing construct based on the xylose operon from Escherichia coli MG1665 and measured its activity using a fluorescent reporter and identified that cellular import plays a key role in induction strength and that expression required the XylR transcription factor. Next, we identified that select deletions of the promoter region enhance gene expression, limiting the effect of carbohydrate repression when xylose is used as an inducer in the presence of industrially relevant carbon sources. Lastly, we used the optimized constructs to produce the biopolymer melanin using seawater mimetic media. One of these formulations utilized a nori‐based seaweed extract as an inducer and demonstrated melanin yields comparable to previously optimized methods using a more traditional and costly inducer. Together, the results demonstrate that engineering xylose induction in V. natriegens can provide an effective and lower cost option for timed biosynthesis in scalable biomanufacturing applications using renewable feedstocks. [ABSTRACT FROM AUTHOR]

Demis Hassabis, the visionary cofounder and CEO of DeepMind, has made significant contributions to artificial intelligence (AI) and scientific discovery. His work on AlphaFold, an AI system that predicts protein structures, led to him winning the 2024 Nobel Prize in Chemistry. Hassabis' journey from designing computer games to pioneering AI showcases the transformative power of visionary leadership in innovation development. DeepMind's integration of AI into scientific research and interdisciplinary collaboration highlights the potential for AI to drive transformative advancements in various fields. [Extracted from the article]

Mathematical modeling is a fundamental aspect of synthetic biology, enabling precise design and analysis of biological systems. To enhance students' understanding of this critical topic, we developed a series of webinars aimed at teaching mathematical modeling to iGEM teams. These webinars were initially created to maintain student engagement during a period of restricted lab access but quickly demonstrated their value as an effective educational tool. The success of these webinars highlighted the suitability of mathematical modeling as a topic well-suited to both onsite and online learning environments. Recognizing this, we expanded the content into a comprehensive syllabus for undergraduate courses in synthetic biology at the Universitat Politècnica de Valencia in Spain and Universidad de las Fuerzas Armadas--ESPE in Ecuador. The course now serves as a core component of synthetic biology education, offering students a robust framework for understanding and applying mathematical models. It includes a series of lectures, practical exercises, and case studies, all designed to deepen students' knowledge and skills in this essential area. To support educators and students, we have also developed a deck of slides and example scripts that provide practical examples and reinforce the concepts taught in the course. This manuscript presents the development, implementation, and impact of these educational initiatives, demonstrating how mathematical modeling can be effectively integrated into synthetic biology curricula to prepare students for real-world challenges in the field. [ABSTRACT FROM AUTHOR]

The ability to remotely control the activity of chimeric antigen receptors (CARs) with small molecules can improve the safety and efficacy of gene-modified T cells. Split ON-or OFF-switch CARs involve the dissociation of tumor-antigen binding from T cell activation (i.e., CD3ζ) on the receptor (R-) and signaling (S-) chains, respectively, that either associate or are disrupted in the presence of a small molecule. Here, we have developed an inducible (i)ON-CAR comprising the anti-apoptotic B cell lymphoma protein 2 protein in the ectodomain of both chains which associate in the presence of venetoclax. We showed that inducible ON (iON)-CAR T cells respond to target tumors cells in the presence of venetoclax or the BH3 mimetic navitoclax in a dose-dependent manner, while there is no impact of the drugs on equivalent second generation-CAR T cells. Within 48 h of venetoclax withdrawal, iON-CAR T cells lose the ability to respond to target tumor cells in vitro as evaluated by Interferon-gamma (IFNγ) production, and they are reliant upon the presence of venetoclax for in vivo activity. Finally, by fusing a degron sequence to the endodomain of the iON-CAR S-chain we generated an all-in-one ON/OFF-switch CAR, the iONØ-CAR, down-regulated by lenalidomide within 4 to 6 for functionally inactive T cells (no IFNγ production) within 24 h. We propose that our remote-control CAR designs can reduce toxicity in the clinic. Moreover, the periodic rest of iON and iONØ-CAR T cells may alleviate exhaustion and hence augment persistence and long-term tumor control in patients. [ABSTRACT FROM AUTHOR]

The genomic signature of an organism captures the characteristics of repeated oligonucleotide patterns in its genome 1, such as oligomer frequencies, GC content, and differences in codon usage. Viruses, however, are obligate intracellular parasites that are dependent on their host cells for replication, and information about genomic signatures in viruses has hitherto been sparse. Here, we investigate the presence and specificity of genomic signatures in 2,768 eukaryotic viral species from 105 viral families, aiming to illuminate dependencies and selective pressures in viral genome evolution. We demonstrate that most viruses have highly specific genomic signatures that often also differ significantly between species within the same family. The species-specificity is most prominent among dsDNA viruses and viruses with large genomes. We also reveal consistent dissimilarities between viral genomic signatures and those of their host cells, although some viruses present slight similarities, which may be explained by genetic adaptation to their native hosts. Our results suggest that significant evolutionary selection pressures act upon viral genomes to shape and preserve their genomic signatures, which may have implications for the field of synthetic biology in the construction of live attenuated vaccines and viral vectors. Genomic analysis of 2,768 viral species reveals conserved and distinct genome-wide differences in specific oligonucleotide patterns, so-called genomic signatures. These are likely caused by various selection pressures acting on viral genomes. [ABSTRACT FROM AUTHOR]

Membrane proteins often possess critical structural features, such as transmembrane domains (TMs), N-glycosylation, and disulfide bonds (SS bonds), which are essential to their structure and function. Here, we extend the study of the motifs carrying N-glycosylation, i.e. the sequons, and the Cys residues supporting the SS bonds, to the whole human proteome with a particular focus on the Cys positions in human proteins with respect to those of sequons and TMs. As the least abundant amino acid residue in protein sequences, the positions of Cys residues in proteins are not random but rather selected through evolution. We discovered that the frequency of Cys residues in proteins is length dependent, and the frequency of CC gaps formed between adjacent Cys residues can be used as a classifier to distinguish proteins with special structures and functions, such as keratin-associated proteins (KAPs), extracellular proteins with EGF-like domains, and nuclear proteins with zinc finger C2H2 domains. Most importantly, by comparing the positions of Cys residues to those of sequons and TMs, we discovered that these structural features can form dense clusters in highly repeated and mutually exclusive modalities in protein sequences. The evolutionary advantages of such complementarity among the three structural features are discussed, particularly in light of structural dynamics in proteins that are lacking from computational predictions. The discoveries made here highlight the sequence-structure-function axis in biological organisms that can be utilized in future protein engineering toward synthetic biology. [ABSTRACT FROM AUTHOR]

Significant advances are being made in the incorporation of enzymes into functional materials, which leverage their inherent substrate specificity, efficient catalytic activity, and sustainable origin. These engineered "dead" materials, however, lack the incredible systems‐level control of enzyme activity that living organisms have evolved over millennia. This gap is now being bridged by the rapidly emerging field of engineered living materials (ELMs), which couples the tools of advanced synthetic biology with modern materials science. In this review, the impressive array of methodologies used to fabricate the extensive library of functional enzyme‐based dead materials is discussed, and the design strategies that facilitate their creation unpacked. The spectacular suite of natural and synthetic genetic and post‐translational control systems for enzymes in living organisms is then described. Finally, key recent examples of ELMs that utilize enzyme activity are reviewed, highlighting the central role of the living component in providing responsivity and adaptability to this new class of materials. [ABSTRACT FROM AUTHOR]

Inducible expression systems are pivotal for governing gene expression in strain engineering and synthetic biotechnological applications. Therefore, a critical need persists for the development of versatile and efficient inducible expression mechanisms. In this study, the xylose-responsive promoter xylA5p and its transcriptional regulator XylR were identified in Parageobacillus thermoglucosidasius DSM 2542. By combining promoter xylA5p with its regulator XylR, fine-tuning the expression strength of XylR, and reducing the glucose catabolite repression on xylose uptake, we successfully devised a xylose-inducible and glucose-insensitive expression system, denoted as IExyl*. This system exhibited diverse promoter strengths upon induction with xylose at varying concentrations and remained unhindered in the presence of glucose. Moreover, we showed the applicability of IExyl* in P. thermoglucosidasius by redirecting metabolic flux towards riboflavin biosynthesis, culminating in a 2.8-fold increase in riboflavin production compared to that of the starting strain. This glucose-insensitive and xylose-responsive expression system provides valuable tools for designing optimized biosynthetic pathways for high-value products and facilitates future synthetic biology investigations in Parageobacillus. Key points: • A xylose-inducible and glucose-insensitive expression system IExyl* was developed. • IExyl* was applied to enhance the riboflavin production in P. thermoglucosidasius • A tool for metabolic engineering and synthetic biology research in Parageobacillus strains. [ABSTRACT FROM AUTHOR]

Background: Conjugation-based episome delivery is a highly efficient method used to transfer DNA into the diatom Phaeodactylum tricornutum, facilitating the production of recombinant proteins and high-value metabolites. However, previous reports have indicated phenotypic heterogeneity among individual cells from clonally propagated exconjugant cell lines, potentially affecting the stability of recombinant protein production in the diatom. Results: Here, we characterized the differences between subpopulations with distinct fluorescence intensity phenotypes derived from a single exconjugant colony of P. tricornutum expressing the enhanced green fluorescent protein (eGFP). We analyzed the expression cassette sequence integrity, plasmid copy number, and global gene expression. Our findings reveal that lower copy numbers and the deletion of the expression cassette in part of the population contributed to low transgene expression. Gene co-expression analysis identified a set of genes with similar expression pattern to eGFP including a gene encoding a putative Flp recombinase, which may be related to variations in fluorescence intensity. These genes thus present themselves as potential candidates for increasing recombinant proteins production in P. tricornutum episomal expression system. Conclusions: Overall, our study elucidates genetic and transcriptomic differences between distinct subpopulations in a clonally propagated culture, contributes to a better understanding of heterogeneity in diatom expression systems for synthetic biology applications. [ABSTRACT FROM AUTHOR]

Encapsulating biological and non-biological materials in lipid vesicles presents significant potential in both industrial and academic settings. When smaller than 100 nm, lipid vesicles and lipid nanoparticles are ideal vehicles for drug delivery, facilitating the delivery of payloads, improving pharmacokinetics, and reducing the off-target effects of therapeutics. When larger than 1 μm, vesicles are useful as model membranes for biophysical studies, as synthetic cell chassis, as bio-inspired supramolecular devices, and as the basis of protocells to explore the origin of life. As applications of lipid vesicles gain prominence in the fields of nanomedicine, biotechnology, and synthetic biology, there is a demand for advanced technologies for their controlled construction, with microfluidic methods at the forefront of these developments. Compared to conventional bulk methods, emerging microfluidic methods offer advantages such as precise size control, increased production throughput, high encapsulation efficiency, user-defined membrane properties (i.e., lipid composition, vesicular architecture, compartmentalisation, membrane asymmetry, etc.), and potential integration with lab-on-chip manipulation and analysis modules. We provide a review of microfluidic lipid vesicle generation technologies, focusing on recent advances and state-of-the-art techniques. Principal technologies are described, and key research milestones are highlighted. The advantages and limitations of each approach are evaluated, and challenges and opportunities for microfluidic engineering of lipid vesicles to underpin a new generation of therapeutics, vaccines, sensors, and bio-inspired technologies are presented. [ABSTRACT FROM AUTHOR]

Synthetic biology is a growing field with an increasing number of successful applications. Yet, synthetic biology (SynBio) education initiatives are underreported and disconnected from each other. In this review we survey the literature on SynBio education and stratify this body of work into three categories: classroom activities, course designs, and program-level curriculaplanning. For each category, we discuss the methods used to assess students' experiences and achievement of learning objectives. Throughout, we identify trends and opportunities for further development in SynBio education. We determined that the design of low-cost education kits is a growing opportunity to support student learning at the level of classroom activities. In support of that work, we present a mapping of published education kits onto Bloom's taxonomy, taking into account increasing accumulation of knowledge through continued experience. We further found that project-based learning is used widely and has proven effective in course designs. To facilitate such activities, we provide a high-level guide for the conversion of a didactic course into a project-based learning course. Further, we note that, currently, programs are delivered primarily at the graduate level, taking inspiration from traditional degree programs while incorporating interdisciplinary training. Finally, we find that design-based research may provide an effective framework for an iterative, mixed-method study design. To support such efforts, we provide a schematic overview of design-based research and its application to a learning progression for interdisciplinary skills. We conclude with a discussion of specific learning concepts that may be useful to SynBio educators and education researchers. [ABSTRACT FROM AUTHOR]

The CRISPR system finds extensive application in molecular biology, but its continuous activity can yield adverse effects. Leveraging programmable CRISPR/Cas9 function via nano-device mediation effectively mitigates these drawbacks. The integration of RNA-sensing platforms into CRISPR thus empowers it as a potent tool for processing internal cell data and modulating gene activity. Here, an intelligent guide RNA—a cis-repressed gRNA synthetic circuit enabling efficient recognition of specific trigger RNAs—is developed. This platform carries two toehold switches and includes an inhibited CrRNA sequence. In this system, the presence of cognate trigger RNA promotes precise binding to the first toehold site, initiating a cascade that releases CrRNA to target a reporter gene (luciferase) in this study. Decoupling the CrRNA segment from the trigger RNA enhances the potential of this genetic logic circuit to respond to specific cellular circumstances, offering promise as a synthetic biology platform. Developed 'IngRNA,' an intelligent CRISPR/Cas9 system with RNA-sensing toehold switches, enabling precise gene modulation by activating CrRNA in response to specific trigger RNAs. Demonstrated effective luciferase targeting in various systems. [ABSTRACT FROM AUTHOR]

AbstractAstaxanthin (AXT), a natural carotenoid, has strong antioxidant and anti-ageing effects and can reduce ultraviolet light-induced damage to cells and DNA, stimulate the immune system, and improve cardiovascular disease prognosis. Despite its wide applications in the: nutraceutical, cosmetic, aquaculture, and pharmaceutical industries, AXT industrial production and application are hindered by natural source scarcity, low production efficiency, and high requirements. This review compares the qualitative differences of AXT derived from different natural sources, evaluates the upstream procedures for AXT expression in different chassis organisms, and investigates synthetic biology- and cell factory-based strategies for the industrial production of natural AXT. Synthetic biology is a promising novel strategy for reprogramming plants or microorganisms to produce AXT. Additionally, genetic engineering using cell factories extends beyond terrestrial applications, as it may contribute to the long-term sustainability of human health during space exploration and migration endeavors. This review provides a theoretical basis for the efficient and accurate genetic engineering of AXT from the microalga Haematococcuspluvialis, providing a valuable reference for future research on the biomanufacturing of AXT and other biological metabolites. [ABSTRACT FROM AUTHOR]