Search

Intelligent Robots and Systems(IROS 2003)(October 2003), Las Vegas, Nevada, 資料番号: ARDS030142000

The capability of (4R)-4-(2,3,4,6,6a beta,7,8,9,9a alpha,9b beta-decahydro-6a beta-methyl-3-oxo-1H-cyclopental[f]quinolin-7 beta-yl)valeric acid (DCQVA), a catabolite of cholic acid produced by enterobacteria, to induce peroxisome proliferation in vivo and in vitro was studied. Rats given 0.3% DCQVA in the diet for 2 weeks showed marked increases in peroxisomal beta-oxidation, mitochondrial 2,4-dienoyl-CoA reductase and microsomal laurate omega-oxidation activities in the liver compared with control rats given the diet without DCQVA. Cultured rat hepatocytes treated with DCQVA for 72 h also exhibited greatly enhanced beta-oxidation activity. The increased activity was concentration-dependent and the effective concentrations were comparable with those of clofibric acid that produced the same degree of induction in the assay. The results demonstrate that DCQVA is a potent peroxisome proliferator that occurs naturally in rat intestine.

Scleroderma renal crisis (SRC) developed in two patients with systemic sclerosis (SSc) and they died from respiratory failure. Findings on autopsy revealed congestion and oedema in both lungs and intimal thickening of the small renal arteries in both patients. Immunohistological investigations showed positive staining of anti-human endothelin (ET)-1 in the media of the small renal arteries and ET-B receptor in the medial smooth muscle of the small renal arteries. This observation suggests an important pathophysiological role of ET-1 in the development of SRC in some patients with SSc.

Clinical features and prognosis of sixty patients with connective tissue disease accompanied by pulmonary hypertension (PH) (26 MCTD, 20 SLE, and 14 PSS) reported retrospectively by multi-institutions were compared. Though the obtained data were incomplete and lacking in uniformity, no significant difference in the clinical features among the three diseases were observed except high incidence of pulmonary fibrosis and low % VC in PSS and PH patients. Statistically significant difference, however, was observed between live and dead patients of three diseases gathered in post sternal pain, pulmonary diastolic murmur, right ventricular hypertrophy on ECG and mean pressure of pulmonary artery. Higher incidence of anti-nRNP antibody was observed in SLE with PH and PSS with PH patients than with the general population. A quicker occurrence of PH and shorter survival time were observed in MCTD patients with PH than in SLE and PSS patients with PH.

Mucin-depleted foci (MDF) are considered as useful biomarkers in rat colon carcinogenesis. The purpose of the present study was to examine the mechanism(s) underlying rat colon carcinogenesis induced by 1,2-dimethylhydrazine (DMH) plus 1% Dextran Sulfate Sodium (DSS). Twelve male F344 rats were given subcutaneous injections (40mg/kg body) of DMH twice a week. They received DSS in the drinking water for 1 week after the first injection of DMH and then were maintained on tap water. The rats were sacrificed at 10 and 14 weeks after the first injection of DMH. Colon tissues were divided into 10 segments from anus to cecum (A/J) and stained with Alcian blue (AB) to identify MDF. We found that MDF and tumors were induced in the rat colon after treatment with DMH plus DSS and that the number of MDF in each segment of the colon was significantly correlated with that of tumors (p=0.006). In addition, we found that the beta-catenin protein was accumulated in cytoplasm and nuclei of MDF and the frequent beta-catenin gene mutations in the colon tumors. These results suggest that MDF is closely related to rat colon carcinogenesis induced by DMH plus DSS.

Polymerase chain reaction (PCR) amplification was used for detecting circulating tumor cells. However, PCR was so sensitive that it detected a very low level of mRNA with no relevance to tumor cells. We analyzed the degree of micro-tumor spread in esophageal cancer patients using quantitative PCR. Samples were collected from 28 patients and 35 controls. Real-time quantitative PCR (LightCycler) was employed for the detection of carcinoembryonic antigen (CEA) and cytokeratin 20 (CK-20). In the CEA and CK-20 mRNA assays, 7 and 3 out of 28 patients, respectively, showed higher mRNA levels in peripheral blood than the normal range based on values of controls (mean+/-2SD). Eleven out of 19, 4 out of 14, and 2 out of 5 patients showed higher CEA mRNA levels in the samples from tumor drainage vein, costal bone marrow, and thoracic duct lymph, respectively. One of the 7 patients who showed higher CEA mRNA levels in pretreatment peripheral blood is currently free from disease. These findings reveal that quantitative PCR can discriminate high levels of cancer-specific expression from low levels of illegitimate expression in blood. They also suggest that the identification of circulating tumor cells by the CEA mRNA assay is a reliable means of predicting early recurrence.

To explore the possible histogenesis of superficially spreading carcinoma of the esophagus, the clinicopathological features of these tumors (n = 44) were compared with those of ordinary superficial carcinoma (n = 163). Tumors of a heterogeneous histological type and having in situ carcinoma components were significantly more common (P.05), and the number of residual squamous islands was significantly greater (P0.05) in the former group than the latter. Furthermore, the tumor size was not different among in situ, intramucosal, and submucosal carcinomas of the former, whereas the tumors became larger according to the depth of invasion in the latter group. These results indicate that the collision of multiple simultaneously developing superficial tumors is a plausible histogenesis of superficially spreading carcinoma of the esophagus.

A 63-year-old man with rheumatoid arthritis presented with rhabdomyolysis and intractable arthritis of acute onset. He was diagnosed to have sepsis due to Staphylococcus aureus infection through of an ulcerated rheumatoid nodule. Staphylococcus aureus isolated from pus in the ulcerated rheumatoid nodule and a blood sample obtained from the heart post-mortem produced the toxic shock syndrome toxin-1 (TSST-1). The TSST-1 and/or unmethylated CpG motifs in the oligonucleotides present in a bacterium, Staphylococcus aureus in this case, might be implicated in the induction of rhabdomyolysis and intractable arthritis.

To analyze the immunological characteristics of the sera of patients with inflammatory connective tissue diseases complicated by pulmonary hypertension (PH).Sera of 24 patients with mixed connective tissue disease complicated by PH (MCTD-PH), sera of 11 patients with other connective tissue diseases complicated by PH (Other-PH; 6 systemic sclerosis, 3 systemic lupus erythematosus, 2 rheumatoid arthritis), and sera of 15 patients with MCTD not complicated by PH (MCTD-non-PH) were tested for IgG antibodies against U1RNP proteins, U1RNP-70K protein, U1RNP-A protein, and U1RNP-C protein, and for IgG and IgM antibodies to beta2-glycoprotein I dependent cardiolipin (CL) and human umbilical vein endothelial cells. We also measured the serum levels of von Willebrand factor related antigens and interleukin 6 (IL-6).(1) The titers of the anti-U1RNP, anti-U1RNP-70K, anti-U1RNP-A, and anti-U1RNP-C antibodies were significantly higher in the MCTD-PH and MCTD-non-PH groups than in the Other-PH group. However, there were no statistically significant differences in the titers of these 4 antibodies between the MCTD-PH and MCTD-non-PH groups. (2) The titers of the IgG aCL and the serum IL-6 levels were significantly higher in the MCTD-PH group than in the MCTD-non-PH group. (3) Statistically significant correlations between the anti-U1RNP and IgG anti-CL antibody titers, and between the IgG anti-endothelial cell and IgG anti-CL antibody titers were observed within the MCTD-PH and Other-PH groups, but not within the MCTD-non-PH group.The occurrence of anti-U1RNP, anti-endothelial cell, and anti-CL antibodies is associated with PH in certain patients with connective tissue disease.

Hepatitis C viral (HCV) infection has been shown to lead to autoimmune phenomena. Antineutrophil cytoplasmic antibodies (ANCA) have been known to be present in several autoimmune liver diseases. This study aimed to evaluate the prevalence of ANCA in sera of patients with antinuclear antibody (ANA)-positive chronic hepatitis C (CH-C) and to characterize ANCA antigens by Western blot compared with HCV-negative autoimmune hepatitis (AIH).Ninety sera obtained from 20 patients with ANA-positive CH-C, 20 patients with ANA-negative CH-C, 20 patients with AIH, 6 patients with primary screlosing cholangitis (PSC) and 24 healthy controls were tested using an indirect immunofluorescence assay, cell ELISA and Western blotting to detect ANCA.In the indirect immunofluorescence assay, ANCA was found in 60% (12/20) of patients with ANA-positive CH-C, 100% (20/20) of patients with AIH and 33.3% (2/6) of patients with PSC, but in none of patients with ANA-negative CH-C (n = 20) or healthy controls (n = 24). The staining pattern observed in sera of these patients was a peculiar mixture of both cytoplasmic and perinuclear patterns. The mean ANCA titer by cell ELISA was significantly (p0.01) higher in patients with AIH compared with ANA-positive or ANA-negative CH-C patients or healthy controls. However, no correlation was found between ANCA titers and ANA titers, serum alanine amino transferase (ALT) or IgG levels in either ANA-positive CH-C or AIH. Western blots of ANCA-positive sera from ANA-positive CH-C patients revealed two bands corresponding to molecular weights of 72 and 46 kDa and there was no differencies in ANCA antigens compared with that from AIH patients.We found an increased incidence of ANCA in ANA-positive CH-C patients. ANCA in ANA-positive CH-C patients is thought to be one of autoimmune phenomena lead by HCV infection because no difference was observed in the epitope of ANCA antigens between patients with CH-C and AIH.

Two sister cases of autoimmune hepatitis are described. Case 1 involved a 49-year-old woman who suffered from bleeding gums and general fatigue. Her laboratory data showed a marked increase in transaminase levels, an elevated IgG level with titers 1:80 or more of both antinuclear and smooth muscle antibodies and thrombocytopenia. Histology of the biopsied liver revealed chronic active hepatitis with a moderate infiltration of mononuclear cells. A complication of idiopathic thrombocytopenic purpura was determined based on higher titers of PA-IgG and a normal bone marrow findings. Case 2 involved a 54-year-old woman, an elder sister of case 1, who suffered from general fatigue with jaundice. Her laboratory data showed a severe damage of liver function and an elevated IgG level with positive antibodies to nuclear and smooth muscle antigen. Histology of the biopsied liver revealed chronic active hepatitis. Both patients were negative to markers of hepatotrophic agents. Under diagnosis of autoimmune hepatitis, they have been treated with prednisone followed by a significant clinical improvement. HLA types of two patients were Bw54-DR4 and DR4. Among 4 other siblings, the eldest sister suffered from rheumatoid arthritis. The occurrence of two sister cases of type-1 autoimmune hepatitis has rarely reported and the fact would support a role of enviromental factors besides genetic factors for the onset of this disease.

Clinical features of mixed connective tissue disease and overlap syndrome were described. Especially, importance of diagnosis and treatment in early stage of pulmonary hypertension in patients with MCTD were stressed.

To characterize DNA in sera of patients with systemic lupus erythematosus (SLE) in terms of size, guanine plus cytosine (G+C) content (by percentage), CpG dinucleotide (CpG) (percentage), and effects on mononuclear cells (MNC).Nine DNA clones were sequenced. Oligodeoxynucleotides with the characteristic CpG motif (TTCGAA or PuPuCGPyPy) were examined for their proliferative effect on MNC by [3H]thymidine incorporation, expression of HLA-DR and intercellular adhesion molecule (ICAM)-1 on monocytes by flow cytometry, and mRNA levels encoding interleukin 12 (IL-12) and interferon-gamma (IFN-gamma) by semiquantitative reverse transcription polymerase chain reaction.The size of DNA clones ranged from 87 to 318 bp (mean +/- SD, 177+/-68) and enrichment in G+C and CpG ranged from 34.7 to 69.7% (48.1+/-10.7) and 0.63 to 12.8% (4.0+/-4.1), respectively. Three of 9 clones contained the characteristic CpG motif. Oligonucleotides proliferated MNC, and augmented HLA-DR and ICAM-1 expression in company with an increase of mRNA encoding IL-12 and IFN-gamma.Circulating CpG motif-containing DNA fragments in SLE increased mRNA encoding IL-12 and IFN-gamma, which in turn increased HLA-DR and ICAM-1 on monocytes, resulting in MNC proliferation. This mechanism could contribute to the pathogenesis of SLE.

T cells that infiltrate the synovial lesions of rheumatoid arthritis may play a key role in its pathogenesis. To learn more about their functional nature, we determined the frequency of synovial T cells that harbored the TNF alpha and Fas ligand transcript by a technique, called Fluorescence In-Cell Labeling Polymerase Chain Reaction (FICL-PCR). The mRNA of interest was detected in fixed cells by the incorporation during PCR of a fluorescein-12-dUTP label following an initial reverse transcription PCR step. Using this technique the CD3 transcript was detected in the T leukemic cell line, MOLT-4, with calculated sensitivity and specificity values of 91% and 100%, respectively. The percentage mean (+/-S.D.) of TNF alpha mRNA positive cells and Fas ligand mRNA positive cells in peripheral blood mononuclear cells from 12 rheumatoid arthritis patients were 5.1+/-2.3% and 4.8+/-3.1%, respectively. The percentage mean (+/-S.D.) of TNF alpha mRNA positive cells and Fas ligand mRNA positive cells among synovial mononuclear cells from six rheumatoid arthritis patients was 16.8+/-8.3% and 10.8+/-1.8%, respectively. This result indicates that the cytotoxic T cells expressing TNF alpha accumulate in rheumatoid arthritic lesions where they may play a pathogenic role.

Adult Still's disease is a febrile disorder of unknown etiology, characterized by spiking fever, arthralgia, leukocytosis and a typical rash. However, most of these clinical findings, except for the typical rash, are not specific to this disease: therefore, the typical rash is the most important clinical finding for diagnosing this disease and physicians often have difficulty in making a definite diagnosis without the typical rash. In our department and related institutions, we have encountered 10 patients with Adult Still's disease who fulfilled the preliminary criteria for classification as Adult Still's disease, proposed by the Adult Still's Research Committee in Japan. The three major criteria are fever, arthralgia and typical rash, and 8 of 10 patients had an atypical rash; one satisfied two major criteria, and had an atypical rash and the other satisfied three major criteria and had an atypical rash on her eyelids. Here, we present the two cases of Adult Still's disease with atypical rash. The first patient was a 36-year-old male with an itchy annular erythema chronicum migrans, frequently seen inpatients with Lyme's disease, on his back. His clinical symptoms improved and the erythema disappeared after treatment with corticosteroids. The second patient, a 17-year-old female, had three major findings. In addition to the typical rash on her face, she had a heliotrope rash, usually seen in patients with dermatomyositis, on her eyelids. The typical rash on her face was related to her other clinical manifestations, and improved after treatment with corticosteroids. However, the rash on her eyelids showed no improvement after steroid therapy, suggesting that the erythema was probably not related to Adult Still's disease. Typical rash in Adult Still's disease, defined as a macular or maculopapular nonpruritic salmon pink eruption, was demonstrated to have the highest relative value associated with relatively high sensitivity and specificity for the diagnosis of Adult Still's disease. However, we have to be aware that some patients with Adult Still's disease could also have an atypical rash.

We conducted a retrospective study on 711 patients with early gastric cancer. Twenty-two patients (4.0%) developed recurrent disease and 21 died of recurrence during this study. One hundred and sixty-three patients died of unrelated or unknown causes. The recurrence patterns of 22 patients were as follows: hematogeneous metastasis to the liver in 11 patients, peritoneal dissemination in 3, recurrence in the remnant stomach in 3, and in the distant lymphonodes in 1. The mean survival period of patients with recurrent disease was 50.4 months, and 7 of these patients (31.8%) died more than 5 years after surgery. A retrospective clinicopathologic evaluation of the 22 patients and 526 patients without recurrence revealed significant differences between the two groups with respect to mean age at the time of surgery (62.5 years in the recurrent group vs 57.3 years in the nonrecurrent group), tumor size (41.2 vs 30.6 mm), depth of invasion (submucosal cancer: 19 vs 256), lymphnode metastasis (11 vs 48), lymphatic (11 vs 89) and venous (7 vs 18) invasion, and operative curability (curability B: 8 vs 48). Three patients with intramucosal cancer who died of hematogenous and/or peritoneal recurrence within 7 years after surgery had neither lymphnode metastasis nor lymphatic or venous invasion, suggesting that new techniques are needed for prediction of recurrent disease in patient with early gastric cancer.

To evaluate the relationship between viral hepatitis and apoptosis, expression of Fas antigen in liver tissue sections of patients with viral hepatitis was investigated by immunohistochemical study using antibody to Fas antigen. A total of 46 liver tissues were obtained from 12 patients with acute viral hepatitis (AH) and 34 patients with chronic hepatitis (CH). Fas antigen was more markedly expressed in hepatocytes of AH patients than of CH patients. The Fas-positive hepatocytes of AH patients was localized rather diffusely in the inter lobular area and they were associated with closely to the area of the inflammatory cell infiltration. In CH patients, Fas antigen was weakly expressed in hepatocytes and was more intense in chronic active hepatitis than in persistent hepatitis patients. These results indicate that apoptosis may occur more frequently in AH than CH and might contributed to death of hepatocytes mainly in viral AH and partly in viral CH.

To investigate the histopathological arthropathy in severe combined immunodeficient (SCID) mice given intraarticular injection of toxic shock syndrome toxin-1 (TSST-1) stimulated T cells from patients with rheumatoid arthritis (RA).Unstimulated or TSST-1 stimulated T cell blasts (TB-TSST) of synovial fluid mononuclear cells from patients with RA (RASFMC) were intraarticularly injected into the knee joint of SCID mice. Four weeks later, the knee joints were histopathologically examined and the numbers of fibroblasts in the synovial tissues were compared with those of controls. Total RNA of the SCID mouse knee joints was isolated and Southern analysis for human T cell receptor (TCR) V beta 2 and human tumor necrosis factor-alpha (TNF-alpha) was carried out.Hyperplasia and increased numbers of the fibroblasts as well as neovascularization of the synovial tissues were observed in the SCID mouse knee joint tissues injected with TB-TSST of RASFMC compared with those injected with unstimulated T cells from RASFMC or with TB-TSST from peripheral blood of healthy controls. Messenger RNA for human TCR V beta 2 and TNF-alpha were detected in the SCID mouse knee joint tissues injected with TB-TSST from RASFMC.Superantigen TSST-1 stimulated T cells from RASFMC have the ability to induce chronic arthropathy with fibroblast proliferation and neovascularization in the SCID mouse.

To determine the clinical significance of anti-endothelial cell antibodies in mixed connective tissue disease (MCTD), we measured the titers of antibodies to both untreated and cytokine-treated endothelial cells (EC) in the sera of the MCTD patients by means of an enzyme linked immunosorbent assay. The mean titer of antibodies to untreated EC (aEC) in the sera of the MCTD patients was significantly higher than that for the healthy subjects. The mean titer of antibody to EC treated with IFN gamma, IL1 (aIL1-EC) or TNF alpha (aTNF-EC) was significantly higher than that of aEC in the sera of the MCTD patients with proteinuria, and the mean titer of aTNF-EC was significantly higher than that of aEC in the sea of the MCTD patients with pulmonary fibrosis. Furthermore, the mean titers of aIL1-EC and aTNF-EC in the sera of the MCTD patients with pulmonary fibrosis were significantly higher than those of aIL1-EC and aTNF-EC in the sera of the MCTD patients without pulmonary fibrosis. These results suggest that antibodies to cytokine-treated EC may play a more important role in the manifestation of renal or pulmonary lesions in MCTD patients than aEC.

We investigated the production of interleukin-8 (IL-8) and chemotactic activity released from Chang liver cells subjected to long-term treatment with ethanol (Et) and subsequent stimulation with tumor necrosis factor-alpha (TNF-alpha). Chang liver cells were cultured in the presence of 5, 50 or 100 mmol/l Et for 4 weeks and then treated with recombinant TNF-alpha (1, 10, 100 U/ml). The culture supernatants were assayed for IL-8 using a sandwich ELISA and chemotactic activity was measured using a chemotactic chamber. Total RNA was also extracted from these cells and IL-8 mRNA was assayed by RT-PCR. In addition, TNF-receptor expression on the Et-treated cells was analyzed by flow cytometry. IL-8 levels in supernatants of cells stimulated with 100 U/ml of TNF-alpha for 48 h rose significantly with increasing concentrations of Et and values obtained were as follows: 4,918 +/- 244.4 pg/ml at 0 mmol/l Et, 5,335 +/- 266.2 pg/ml at 5 mmol/l Et, 8,726 +/- 873.4 pg/ml at 50 mmol/l Et and 9,134 +/- 866.0 pg/ml at 100 mmol/l Et. The chemotactic activity also increased with increasing concentrations of Et and was almost completely suppressed by anti-IL-8 antibody. Using semiquantitative analysis of radioactivity of IL-8 mRNA using a 32P gamma ATP-labeled primer for IL-8 mRNA, Et-treated cells were shown to have markedly higher levels of radioactivity than untreated cells. In addition, TNF-receptor expression was significantly higher in cells treated with 100 mmol/l Et. These data suggest that long-term Et treatment of Chang liver cells stimulated with TNF-alpha may enhance transcription of the IL-8 gene with up-regulation of the TNF receptor.

We describe the case of a 25-year-old woman who developed soft tissue ectopic nephritis. Ectopic calcinosis rarely occurs in systemic lupus erythematosus (SLE) patients. This is the first detailed case report of metastatic ectopic calcinosis, one of two categories of ectopic calcinosis, probably due to 1 alpha-OH-vitamin D3 therapy. We administered disodium 3-amino-1-hydroxypropylidene-1, 1-bisphosphonate pentahydrate, a second-generation bisphosphonate, to decrease the patient's serum calcium level, and subsequently observed a dramatic decrease in severity of the ectopic calcinosis along with decreases in both the serum calcium level and the (serum calcium level)x(serum phosphate level) index. We suggest that 1 alpha-OH vitamin D3 should be used in cases of lupus nephritis with great caution.

A 37-year-old woman who had portal hypertension followed by splenomegaly, developed collateral blood flow of spleno-renal shunt and paraesophageal veins, esophageal varices and further with narrowing of intrahepatic bile ducts shown by endoscopic retrograde cholangiography was described. Liver function was almost normal except the slight elevation of serum alkaline phosphatase and gamma-glutamyl transpeptidase levels. However, endoscopic retrograde cholangiography revealed the narrowing of the intrahepatic bile ducts. The histological examination of biopsied specimen showed no prominent change in portal tracts and bile ducts without cell infiltration or fibrosis in the portal area. This case will be considered as idiopathic portal hypertension complicated by narrowing of the intrahepatic bile ducts.

The sequence of 9 DNA clones obtained from DNA-anti-DNA antibody immune complexes (IC) in 11 SLE patients was analyzed and the possible pathogenic role of the circulating DNA in SLE patients was discussed. Nucleic acid length of 9 cloned DNAs ranged from 87 to 312 base pairs(bp), with a mean length of 177 +/- 62bp, which were rich in guanine (G) + cytosine(C), CpG dinucleotide and palindromic sequences. Oligonucleotide TTTTCAATTCGAAGATGATT which contain the CpG motif in hexamer palindromic sequence segments in cloned DNA augmented the expression of ICAM-1 on the endothelial cells detected by FACS analysis and also augmented the gene expression of several cytokines such as interleukin-2, interleukin-6, interleukin-8 and tumor necrosis factor alpha. These data suggest that DNA in IC of SLE patients will augment expression of ICAM-1 on endothelial cells, resulting in exacerbation of vasculitis.

A 66-yr-old man had undergone a total gastrectomy with esophagojejunostomy for gastric cancer 29 yr previously. Soon after the operation, he began to suffer frequent bile regurgitation and subsequent alkaline reflux esophagitis. A small esophageal tumor was found incidentally above the esophagojejunostomy at a follow-up endoscopy, and he subsequently underwent a lower esophagectomy in 1995. The resected specimen revealed evidence of an early adenocarcinoma arising in a short segment of columnar cell-lined esophagus which had not been grossly evident prior to the esophagectomy. The present case indicates that columnar metaplasia with a neoplastic potential can be induced in the esophagus by the chronic reflux of duodenal contents in the absence of gastric acid.

The role of activated cells determined by staining with bromodeoxyuridine (BrdU) and the role of alveolar macrophages as a source of cytokines were investigated in monocrotaline (MCT)-induced pulmonary hypertension (PH) in rats. BrdU was mainly incorporated by mononuclear cells; their number increased strikingly prior to the development of PH. Cytokines such as interleukin (IL)-1, IL-6 and tumor necrosis factor were produced during the development of PH. The amount of IL-6 showed significant correlation (p0.05) with the number of BrdU-positive cells, which, in turn, correlated with the extent of PH. These results indicate that BrdU-positive cells and cytokines produced by alveolar macrophages may play an important role in the pathogenesis of MCT-induced PH in rats.

We experienced three patients who have collagen diseases with respiratory failure accompanied by hyponatremia. They were one systemic lupus erythematosus patient with interstitial pneumonia, one rheumatoid arthritis patient with acute pneumonitis, and one dermatomyositis patient with pulmonary fibrosis and organizing pneumonia. In all 3 patients, hyponatremia appeared along with a decrease in arterial O2 partial pressure (PaO2) and the hyponatremia tended to improve when the PaO2 increased after inhalation of oxygen, even though their respiratory failure were not improved. In dermatomyositis patient, serum Na levels were over-corrected after increase in PaO2. The serum and urine osmolality, serum antidiuretic hormone (ADH) levels and clinical pictures demonstrated a presence of inappropriate secretion of ADH (SIADH) in all 3 cases when hyponatremia and hypoxia appeared. A close association between hyponatremia and hypoxia observed in 3 patients strongly suggested that their SIADH were associated with hypoxia since SIADH could be demonstrated by hypoxia. Therefore, it is important to realize that hypoxia-induced hyponatremia will be promptly corrected to hypernatremia by an oxygen inhalation, which could cause a lethal central pontine myelinolysis.

The proliferative response of mononuclear cells (MNC) in synovial fluid (SF) and peripheral blood (PB) of patients with rheumatoid arthritis (RA) to mycobacterial 65 kDa heat shock protein (HSP65) was tested and the response compared with the percentage of HLA-DR+.gamma delta+ T cells in lymphocytes of SFMNC or PBMNC:Proliferative response of MNC was measured by means of 3H-thymidine incorporation and expressed by means of the stimulation index. Percentage of HLA-DR+.gamma delta+ T cells in lymphocytes was measured by means of the 2-color flow cytometry method.Higher response of SFMNC than PBMNC to HSP65 was noted in 14 of 19 patients with RA. Stimulation indexes of RA-SFMNC correlated significantly with HLA-DR+.gamma delta+ T cell percentage in lymphocytes.In the SF of patients with RA, an accumulation of HSP65 reactive and HLA-DR+.gamma delta+ T cells was noted.

We report on a case of C9 deficiency followed by the onset of systemic lupus erythematosus (SLE). A 51-year-old female patient had suffered from repeated urinary tract infections since 1977. In 1980, at 41 years of age, she had proteinuria and facial erythema along with low level of CH50 less than 12.0 U/ml. She was diagnosed as C9 deficiency (C9D) because of C9 protein less than 0.5 mg/dl, C9 activity 0.03% and C8 activity 94% and also SLE was strongly suspicious. Subsequently, she suffered from repeated urinary tract infections. In 1990, she was diagnosed as SLE because of pleuritis, pericarditis and positive anti-nuclear (1:640) and positive anti-DNA antibody (28.0 U/ml) in addition to proteinuria and facial erythema. From the family study, her two sisters showed homozygous C9D (less than 0.5 mg/dl) with hypergammaglobulinemia (2290 and 2230 mg/dl, respectively) and positive anti-nuclear antibody (1:80) in both. Her father also showed heteropygous C9D (1.7 mg/dl) with anti-nuclear antibody (1:640). These results suggest that healthy carriers of C9D may have some abnormalities in humoral or cell-mediated immunity. The possibility was thought that other unrecognized disease associated loci exist in linkage with the C9 allele like that of C4D was speculated. And repeated infections due to C9D may possibly induce B cell activation followed by the occurrence of SLE or related disorders. This case seems to be very valuable with respect to the onset of SLE under a long-term observation of C9D.

We have shown that a microbial cholic acid catabolite (4R)-4-(2,3,4,6,6a beta,7,8,9,9a alpha,9b beta-decahydro-6a beta-methyl-3-oxo- 1H-cyclopenta[f]quinolin-7 beta-yl)valeric acid (DCQVA), is a potent peroxisome proliferator. In this paper a possible key stage in DCQVA metabolism, the activation of DCQVA to its CoA ester, has been investigated in rat liver microsomes and particulate fractions. The microsomal reaction was dependent on CoA, ATP, DCQVA (0.2-1 mM) and protein content. The reaction was decreased by storage at 4 degrees C, preincubation of microsomes at 37 degrees C for 5 min, or inclusion of Triton X-100 in the reaction mixture. Such treatments also enhanced generation of long-chain fatty acyl-CoAs, as determined by h.p.l.c. analysis. The same effect was caused by exposing the microsomes to phospholipase A2, suggesting that endogenous fatty acids may compete with DCQVA for esterification with CoA. Subcellular fractionation of rat liver demonstrated that the activity of DCQVA-CoA synthesis was localized predominantly in the microsomal fraction, in contrast to long-chain fatty acyl-CoA synthetase, which was distributed among all particulate fractions. Administration of clofibrate of rats did not affect the distribution of DCQVA-CoA synthesis activity. In contrast to a 2-fold induction of long-chain fatty acyl-CoA synthetase by clofibrate treatment, the activity of DCQVA-CoA synthesis in the microsomal fraction decreased by 80%. These results suggest that DCQVA is activated by an enzyme distinct from long-chain fatty acyl-CoA synthetase. The resulting perturbation of fatty acid metabolism may be involved in the mechanism whereby DCQVA causes peroxisome proliferation.

A 78-year-old male patient suffered from slight dryness of his mouth and eyes, which was followed by swelling of the parotid and submandibular glands on both sides. Subsequently, he developed generalized lymphadenopathy accompanied by hypergammaglobulinemia IgG 7740 mg/dl, main subclass: IgG4, 5800 mg/dl. Histopathological examination of lymph nodes from his left neck showed follicular proliferation of plasma cells containing cytoplasmic kappa and lambda chains of IgG4, without destruction of the lymph node structure. His serum showed very low levels of complement: 0 U/ml of CH 50, 14 mg/ml of C3 and less than 11 mg/ml of C4. During treatment with prednisolone at 30 mg/day, the swelling of the salivary glands and lymph nodes reduced the IgG and IgG4 decreased and the complement increased. Finally, all lymph nodes, IgG and complement abnormalities were normalized. Anticomplementariness of IgG4 was demonstrated in this patient.