Search

Background: Clostridioides difficile infection (CDI) is an increasingly common disease in healthcare facilities and community settings. However, there are limited reports of community-onset CDI (CO-CDI) in China. Methods: We collected diarrheal stool samples from 3885 patients who went to outpatient department or emergency department in a tertiary hospital in China during 2010–2023, analyzed the correlation between patients’ basic information and the detection rate of CDI. Besides, all stool samples from 3885 outpatients included were tested by culturing. Moreover, we randomly selected 89 patients’ stools during the 14 years and isolated 126 C. difficile strains from them. The presence of toxin genes (tcdA, tcdB, cdtA, and cdtB) were confirmed by PCR. Toxigenic strains were typed using multilocus sequence typing (MLST). Susceptibility to 9 antimicrobials was evaluated using the E-test. Results: 528 of 3885 patients (13.6 %) with diarrhea were finally diagnosed as CDI. The median age of patients included was 51 years (6 months-95 years), while the median of patients with CDI was older than patients with negative results [55.5 years (6 months-93 years) vs. 50 years (9 months −95 years), p < 0.001]. In winter, patients with diarrhea might be more likely to have CDI. The detection rate of CDI of patients in emergency department was much higher than those in other outpatients (20.7 % vs. 12.4 %, p < 0.001), and did differ from each outpatient departments (p < 0.05). There were 95 isolated strains detected as toxigenic C. difficile. Among these strains, 82 (86.3 %) had the tcdA and tcdB genes (A+B+) and 5 of these 82 strains were positive for the binary toxin genes (cdtA and cdtB) (A+B+CDT+). There were 15 different sequence types (STs) by multilocus sequence typing (MLST), while the most ST was ST-54 (23.2 %). ST types composition was relatively stable over the time span of this study. Some strains had high resistance to ciprofloxacin, clindamycin, and erythromycin. Twenty-three isolates (24.2 %) were multidrug-resistant. Conclusions: Outpatients with CDI were common among patients having diarrhea during this period in our hospital. Elderly patients and patients went to emergency department may be susceptible to CDI. Based on MLST, the result revealed that the C. difficile isolates had high genetic diversity and maintained stability in this period. All isolates were susceptible to metronidazole and vancomycin, and nearly one quarter of all isolates had multidrug resistance.

Xylocarpin H, a limonoid from the Xylocarpin granatum, exhibits significant biological activities, including antioxidant, antiviral, analgesic, hypnotic, antimalarial, and antidepressant effects, demonstrating considerable potential for drug development. However, few studies have been reported to identify and classify active metabolites responsible for such excellent biological activities. In this study, we utilized ultra high-performance liquid chromatography/quadrupole time-of-flight mass spectrometry (UHPLC–Q–TOF–MS/MS) coupled with multiple data postprocessing techniques to rapidly identify in vivo and in vitro metabolites of xylocarpin H. Consequently, a total of 32 metabolites (23 in phase I and 9 in phase II) of xylocarpin H were detected both in rat feces, urine, bile, blood, intestinal flora, and rat and human liver microsomes. The metabolic pathways of xylocarpin H mainly involve hydrolysis, oxidation, reduction, addition, glucose conjugation, glucuronide conjugation, and sulfate conjugation. The metabolite M15 of xylocarpin H was synthesized by ester hydrolysis and its structure was determined by nuclear magnetic resonance spectroscopy. This study elucidates the metabolic pathways of xylocarpin H and provides insights into the origin of its pharmacological activity.

Abstract Background Portal hypertension (PHT) has been proven to be closely related to the development of hepatocellular carcinoma (HCC). Whether PHT before liver transplantation (LT) will affect the recurrence of HCC is not clear. Methods 110 patients with depressurization of the portal vein (DPV) operations (Transjugular Intrahepatic Portosystemic Shunt—TIPS, surgical portosystemic shunt or/and splenectomy) before LT from a HCC LT cohort, matched with 330 preoperative non-DPV patients; this constituted a nested case-control study. Subgroup analysis was based on the order of DPV before or after the occurrence of HCC. Results The incidence of acute kidney injury and intra-abdominal bleeding after LT in the DPV group was significantly higher than that in non-DPV group. The 5-year survival rates in the DPV and non-DPV group were 83.4% and 82.7% respectively (P = 0.930). In subgroup analysis, patients in the DPV prior to HCC subgroup may have a lower recurrence rate (4.7% vs.16.8%, P = 0.045) and a higher tumor free survival rate (88.9% vs.74.4%, P = 0.044) after LT under the up-to-date TNMI–II stage, while in TNM III stage, there was no difference for DPV prior to HCC subgroup compared with the DPV after HCC subgroup or the non-DPV group. Conclusion Compared with DPV after HCC, DPV treatment before HCC can reduce the recurrence rate of HCC after early transplantation (TNM I-II). DPV before LT can reduce the recurrence of early HCC.

Abstract Objectives Although several independent risk factors for postoperative pulmonary complications (PPCs) after spinal tumor surgery have been studied, a simple and valid predictive model for PPC occurrence after spinal tumor surgery has not been developed. Patients and methods We collected data from patients who underwent elective spine surgery for a spinal tumor between 2013 and 2020 at a tertiary hospital in China. Data on patient characteristics, comorbidities, preoperative examinations, intraoperative variables, and clinical outcomes were collected. We used univariable and multivariable logistic regression models to assess predictors of PPCs and developed and validated a nomogram for PPCs. We evaluated the performance of the nomogram using the area under the receiver operating characteristic curve (ROC), calibration curves, the Brier Score, and the Hosmer–Lemeshow (H–L) goodness-of-fit test. For clinical use, decision curve analysis (DCA) was conducted to identify the model’s performance as a tool for supporting decision-making. Results Among the participants, 61 (12.4%) individuals developed PPCs. Clinically significant variables associated with PPCs after spinal tumor surgery included BMI, tumor location, blood transfusion, and the amount of blood lost. The nomogram incorporating these factors showed a concordance index (C-index) of 0.755 (95% CI: 0.688–0.822). On internal validation, bootstrapping with 1000 resamples yielded a bias-corrected area under the receiver operating characteristic curve of 0.733, indicating the satisfactory performance of the nomogram in predicting PPCs. The calibration curve demonstrated accurate predictions of observed values. The decision curve analysis (DCA) indicated a positive net benefit for the nomogram across most predicted threshold probabilities. Conclusions We have developed a new nomogram for predicting PPCs in patients who undergo spinal tumor surgery.

During non-landing measurements of a theodolite, the accuracy of the goniometric readings can be compromised by wobble errors induced by various factors such as wind loads, theodolite driving torque, and the stiffness of the supporting structure. To achieve high-precision non-landing measurements, it is essential to accurately determine and correct the platform wobble errors affecting the azimuth and pitch pointing angles. In this paper, a non-contact optical measurement method is proposed for quantifying platform wobble errors. The method establishes an auto-alignment optical path between an autocollimator and a reflector in the measuring device. By detecting the deviation angle of the CCD image point as the optical path changes, precise measurements of the platform wobble errors can be obtained. Experimental results demonstrate that the measuring device can achieve an auto-alignment optical path within 5 minutes, significantly improving measurement efficiency. Furthermore, after measuring the platform wobble error and applying data correction, the average error in the azimuth pointing angle is reduced from 31.5″ to 9.8″, and the average error in the pitch pointing angle is reduced from 21″ to 9.2″. These results highlight the substantial correction effect achieved by the proposed method.

Low-frequency pulsating ripples exist on the input side of a single-phase inverter, which bring some adverse effects and harm to the inverter and photovoltaic power generation system. In order to suppress the low-frequency pulsating ripple and reduce the filter circuit parameters, a novel single-stage boost single-phase inverter is proposed, which can suppress low-frequency ripple. And a three-closed-loop compound control strategy that can suppress input low-frequency ripples under the limitation of an energy storage inductor current and buffer capacitor voltage is proposed. The circuit topology, control strategy, key circuit parameters design, system modeling, and simulation of the inverters are deeply analyzed and studied. Simulation and experimental results show that the inverter has a good ability to suppress input low-frequency ripples.

Abstract Background Oculogyric crisis (OGC) is a rare focal dystonia of the ocular muscles that not only interferes with patients’ medication adherence but also negatively affects the course and prognosis of the primary disease. Early detection and treatment of OGC can improve patients’ medication adherence and quality of life. Case presentation This paper reports a case of a 19-year-old Asian female with a diagnosis of schizophrenia who was treated intermittently with atypical antipsychotics aripiprazole or risperidone for 2 years, with improvement of psychotic symptoms during the course of medication, and then developed double eye rolling and staring with irritability when treated with risperidone 4 mg/d or 6 mg/d. Then, we changed the medication to clozapine, and the patient’s psychotic symptoms were controlled and stable. The symptoms of double eye rolling and gaze disappeared. Conclusion Oculogyric crisis (OGC) is a rare focal dystonia of the oculogyric muscle. This case provides clinicians with a basis for the early recognition and management of oculogyric crisis during the use of atypical antipsychotics (risperidone).

Abstract Background Inattention has been given to the pathogenesis of adolescent and young adult (AYA) hepatocellular carcinoma (HCC). Due to the more advanced tumor progression and poorer prognosis of AYA-HCC, together with a better tolerance ability, noncirrhotic background, and a stronger willingness to treat AYA-HCC, clinical and molecular biology studies are urgent and necessary, especially for those with hepatitis B infection. Methods For clinical aspects, the overall survival, the recurrence-free survival, and the Cox analyses were performed. Then, functional analysis, gene clustering, metabolic-related analysis, immune infiltration and competing endogenous RNA (ceRNA) construction were carried out using whole transcriptome sequencing technique. Results Based on the clinical information of our HCC cohort, the overall survival and recurrence-free survival rates were worse in the AYA group than in the elderly group as previously described. According to our whole transcriptome sequencing results, functional analysis revealed that metabolism-related pathways as well as protein translation and endoplasmic reticulum processing were enriched. Then the hub metabolism-related genes were screened by metabolite–protein interactions (MPIs) and protein–protein interactions (PPIs). Fatty acid metabolism is a crucial component of metabolic pathways, abnormalities of which may be the reason for the worse prognosis of HBV-AYA HCC. Finally, the relationship of disrupted expression of metabolism-related genes with immune infiltration was also analyzed, and the lncRNA‒miRNA‒mRNA-related ceRNA network for HBV-AYA HCC was constructed, which may provide new cues for HBV-AHA HCC prevention. Conclusion The worse prognosis and recurrence rate of HBV-AYA HCC may be related to abnormalities in metabolism-related pathways, especially disorders of fatty acid metabolism.

Abstract Background HIST1H1E is a member of the H1 gene family. Excess de novo likely gene‐disruptive variants involving the C‐terminal tail of HIST1H1E have been reported in neurodevelopmental disorders. Although clinical phenotypes in some patients have been described in single studies, few studies have reviewed the genotype and phenotype relationships using a relatively large cohort of patients with HIST1H1E variants. Methods Whole‐exome sequencing (WES) was performed on the proband. The variant was validated using Sanger sequencing in both proband and parents. Published HIST1H1E variants in neuropsychiatric disorders were reviewed. Results Herein, we reported a new de novo frameshift mutation in HIST1H1E (NM_005321.2, c.416_419dupAGAA, p.Ala141GlufsTer56) in an individual with Rahman syndrome. To explore the genotype–phenotype correlations for HIST1H1E variants in neurodevelopmental disorders, we comprehensively curated and summarized 23 variants and the clinical features from 52 patients. Our findings revealed that likely gene‐disrupting variants in HIST1H1E contribute to a wide range of neurodevelopmental phenotypes. We observed the common phenotypes including craniofacial features, ID, hypotonia, and autism/behavior problem in patients with HIST1H1E variants. While the different genotypes corresponding to different phenotypes or the same phenotype were also observed. Conclusion These data provide scientific evidence for the genetic diagnosis and precision clinical management.

Abstract Immunotherapy as a rapidly developing therapeutic approach has revolutionized cancer treatment and revitalized the field of tumor immunology research. 3D in vitro models are emerging as powerful tools considering their feature to maintain tumor cells in a near-native state and have been widely applied in oncology research. The novel 3D culture methods including the co-culture of organoids and immune cells, ALI culture, 3D-microfluidic culture and 3D-bioprinting offer new approaches for tumor immunology study and can be applied in many fields such as personalized treatment, immunotherapy optimizing and adoptive cell therapy. In this review, we introduce commonly used 3D in vitro models and summarize their applications in different aspects of tumor immunology research. We also provide a preliminary analysis of the current shortcomings of these models and the outlook of future development.

Diseases of tomato leaves can seriously damage crop yield and financial rewards. The timely and accurate detection of tomato diseases is a major challenge in agriculture. Hence, the early and accurate diagnosis of tomato diseases is crucial. The emergence of deep learning has dramatically helped in plant disease detection. However, the accuracy of deep learning models largely depends on the quantity and quality of training data. To solve the inter-class imbalance problem and improve the generalization ability of the classification model, this paper proposes a cycle-consistent generative-adversarial-network-based Transformer model to generate diseased tomato leaf images for data augmentation. In addition, this paper uses a Transformer model and densely connected CNN architecture to extract multilevel local features. The Transformer module is utilized to capture global dependencies and contextual information accurately to expand the sensory field of the model. Experiments show that the proposed model achieved 99.45% accuracy on the PlantVillage dataset. The 2018 Artificial Intelligence Challenger dataset and the private dataset attained accuracies of 98.30% and 95.4%, and the proposed classification model achieved a higher accuracy and smaller model size compared to previous deep learning models. The classification model is generalizable and robust and can provide a stable theoretical framework for crop disease prevention and control.

Hemostatic disturbances after cardiac surgery can lead to excessive postoperative bleeding. Thromboelastography (TEG) was employed to evaluate perioperative coagulative alterations in patients undergoing cardiac surgery with cardiopulmonary bypass (CPB), investigating the correlation between factors concomitant with cardiac surgery and modifications in coagulation. Coagulation index as determined by TEG correlated significantly with postoperative bleeding at 24-72 h after cardiac surgery ( P

IntroductionEnterococcus faecium is a common pathogen responsible for urinary tract infections (UTIs) and often establishes extensive colonization within the intestinal tract. Our aim was to assess the genomic and transcriptomic differences between colonized E. faecium without UTI (only-colonization) and colonized E. faecium causing UTI (endogenous infections).MethodWe investigated the correlation between fecal isolates from the same patient and UTI-causing isolates using PFGE and WGS, and classified fecal isolates into two groups: those that solely colonized and those associated with endogenous urinary tract infections. We characterized the genomes of colonization-only and endogenously infected isolates by Scoary GWAS, and the transcriptomes of the isolates at 3 h urine exposure to assess pathogen-related changes.ResultBased on PFGE and WGS, eight isolates of endogenously infected E. faecium and nine isolates of only-colonized E. faecium were characterized and carbon and nitrogen regulated metabolisms such as genes encoding the phosphotransferase (PTS) system were enriched in endogenously infected E. faecium. Transcriptome analysis revealed significant differences in gene expression in the PTS system, lysine synthesis, galactose metabolism and citrate import between endogenously infected and only-colonized E. faecium isolates, highlighting the important role of certain carbon regulatory genes in the colonization and survival of endogenously infected E. faecium.ConclusionIn only-colonized and endogenously infected isolates, we observed differential expression patterns of genes related to carbon metabolism and amino acids, suggesting that metabolic diversity is a strategy for isolates leading to endogenous infection.

BackgroundA growing number of studies have suggested that adolescents’ prosocial behavior can protect against depression and anxiety. It is known that anxiety and depression are often comorbid. However, it remains unclear if when depression is present, prosocial behavior remains protective against anxiety, and if when anxiety is present, prosocial behavior remains protective against depression. The purpose of this study was to determine the association of anxiety and depressive with prosocial behavior.MethodsA large representative sample of middle-school students was recruited for a cross-sectional study and completed standardized instruments (the Children’s Depression Inventory (CDI), Screen for Child Anxiety Related Emotional Disorders–Child version (SCARED-C), and Strengths and Difficulties Questionnaire (SDQ)). We used structural equation modeling (SEM) to examine the protective effect of prosocial behavior against anxiety when depression was present.ResultsA survey of 3,510 students was conducted, and the final analysis included 3,169 students, comprising 1,616 boys (51.0%) and 1,553 girls (49.0%), with a mean age of 13.09 years (SD = 1.31, range 11–16).The prevalence rates of anxiety and depression in early adolescents were 31.6 and 16.7%, respectively. More than two-thirds of depressed adolescents had comorbid anxiety, while more than one-third of anxious adolescents had comorbid depression. Regression models showed that compared with depressed adolescents, adolescents without depressive symptoms exhibited a significant negative correlation between prosocial behaviors and anxiety and depression (β = −0.01, p > 0.01, β = −0.06, p > 0.01; β = −0.11, p < 0.01, and β = −0.17, p < 0.01). There was no difference in the relationship between prosocial behavior and depression between anxious and non-anxious adolescents (p > 0.05).ConclusionAnxiety and depression are common in adolescence and are often comorbid disorders. However, the comorbidity is not symmetrical. Specifically, the protective effect of prosocial behavior against anxiety is weaker in depressed adolescents. Findings are discussed in light of related research and theory, and insights for intervention programs and future research are presented.

Abnormalities in hippocampal synaptic plasticity contribute to the pathogenesis of post-traumatic stress disorder (PTSD). The Wnt/β-catenin signaling pathway is critical for the regulation of synaptic plasticity. PTSD symptoms can be alleviated by correcting impaired neural plasticity in the hippocampus (Hipp). Electroacupuncture (EA) has a therapeutic effect by relieving PTSD-like behaviors. However, little is known about whether the Wnt/β-catenin pathway is involved in EA-mediated improvements of PTSD symptoms. In this study, we found that enhanced single prolonged stress (ESPS)-induced PTSD led to abnormal neural plasticity, characterized by the decline of dendritic spines, the expression of postsynaptic density 95 (PSD95), and synaptophysin (Syn) in the stressed Hipp along with the reduction of Wnt3a and β-catenin, and increased GSK-3β. EA significantly alleviated PTSD-like behaviors, as assessed by the open field test, elevated platform maze test and conditioning fear test. This was paralleled by correcting abnormal neural plasticity by promoting the expression of PSD95 and Syn, as well as the number of dendritic spines in the Hipp. Importantly, EA exerted anti-PTSD effects by augmenting the expression levels of Wnt3a and β-catenin, and decreasing that of GSK-3β. The effects mediated by EA were abolished by XAV939, an inhibitor of the Wnt/β-catenin pathway. This suggests that EA relieved ESPS-induced PTSD-like behaviors, which can largely be ascribed to impaired neural plasticity in the Hipp. These findings provide new insights into possible mechanisms linking neural plasticity in the Hipp as potential novel targets for PTSD treatment in EA therapy.

Given the inherent limitations of flash memory, solid-state storage devices require a host controller and a flash translation layer (FTL) to address two major conflicts: the conflict between the limited erase endurance of flash memory and the expectation of longer usage time and the conflict between the insufficient per-die bandwidth of flash memory and the exponential growth in data throughput.This paper presents a hybrid architecture implemented with FPGA logic and embedded processors. FPGA hardware acceleration is utilized to meet the requirement of high bandwidth, while the Host-FTL flash translation layer architecture is used to address the varying workload demands. By separating the storage device from the flash translation layer, the host manages the flash channel using the command and message units provided by the system.The design of Host-FTL not only implements conventional software algorithms such as address mapping, wear leveling, and bad block management but also uses a “pipeline” strategy for regular writes and a “parallel page group” strategy for large file writes, after analyzing the bandwidth bottleneck of the system. The channel-level RAID array enhances data security, and the localized wear leveling increases the total amount of written data in the solid-state disk array.

Background & Aims: The contribution of abnormal metabolic targets to hepatocellular carcinoma (HCC) progression and the associated regulatory mechanisms are attractive research areas. High-density lipoprotein binding protein (HDLBP) is an important transporter that protects cells from excessive cholesterol accumulation, but few studies have identified a role for HDLBP in HCC progression. Methods: HDLBP expression was determined in HCC tissues and published datasets. The biological roles of HDLBP in vitro and in vivo were examined by performing a series of functional experiments. Results: An integrated analysis confirmed that HDLBP expression was significantly elevated in HCC compared with noncancerous liver tissues. The knockdown or overexpression of HDLBP substantially inhibited or enhanced, respectively, HCC proliferation and sorafenib resistance. Subsequently, a mass spectrometry screen identified RAF1 as a potential downstream target of HDLBP. Mechanistically, when RAF1 was stabilized by HDLBP, MEKK1 continuously induced RAF1Ser259-dependent MAPK signaling. Meanwhile, HDLBP interacted with RAF1 by competing with the TRIM71 E3 ligase and inhibited RAF1 degradation through the ubiquitin–proteasome pathway. Conclusions: Our study reveals that HDLBP is an important mediator that stabilizes the RAF1 protein and maintains its activity, leading to HCC progression and sorafenib resistance. Thus, HDLBP might represent a potential biomarker and future therapeutic target for HCC.

The stator single-phase grounding fault location of large generator can provide guidance for rapid maintenance of faults. A third harmonic potential distribution based stator ground fault accurate location method is proposed. The current location methods mainly take coil as location unit and may have location error. However, accurate locate to the slot number is more meaningful for troubleshooting. In addition, the third harmonic potential induced by adjacent slots has larger phase difference, and has more distinct fault characteristics than the fundamental potential. In this paper, the fault location optimization model is constructed based on the analysis of the distribution characteristics of the third harmonic potential. The exhaustive solution of the location model is realized by artificially setting multiple reference points, and finally the reference point closest to the real fault point is obtained. The proposed method can accurately locate the fault slot number. PSCAD simulation verifies that the proposed method is robust against the transition resistance error and has higher accuracy than the existing methods.

ABSTRACT: Objectives: Patients with inflammatory bowel disease (IBD) are susceptible to Clostridioides difficile infection (CDI), resulting in poor outcomes and recurrence; therefore, the molecular characterization of C. difficile in IBD patients in China needs further investigation. Methods: C. difficile strains were isolated and identified from faecal samples of adult and paediatric IBD patients. Toxigenic strains were typed using multilocus sequence typing and whole genomic sequencing (WGS) to construct the phylogenetic tree. Susceptibility to 10 antimicrobials was evaluated using the Etest. Results: Among the 838 IBD patients, 82 toxigenic C. difficile were identified, which comprised 46 from adults and 36 children. A total of 90.2% (74/82) of the isolates were positive for both toxin A and toxin B genes (A+B+), whereas the remaining 9.8% were negative for toxin A gene but positive for toxin B gene (A–B+). These toxigenic strains were susceptible to metronidazole and vancomycin, but highly resistant to clindamycin, erythromycin, and fluoroquinolones. All moxifloxacin-resistant isolates had mutations resulting in an amino acid substitution in gryA (T82I). The dominant types were ST-35 (20.7%), ST-2 (17.1%), ST-54 (13.4%), and ST-3 (13.4%) in all patients. Conclusion: The incidence and molecular epidemiology of C. difficile infection in adult IBD patients resembled CDI in the general inpatient population. A higher antibiotic resistance rate was identified among the C. difficile isolates obtained from paediatric IBD patients than from adult patients, and a few STs accounted for most multidrug-resistant strains. However, the molecular genetic features of the same ST type between these two groups remains highly correlated.

Excess osteoclast activity is found in many bone metabolic diseases, and inhibiting osteoclast differentiation has proven to be an effective strategy. Here, we revealed that osteoclast precursors (pre-OCs) were more susceptible to thioredoxin reductase 1 (TXNRD1) inhibitors than bone marrow-derived monocytes (BMDMs) during receptor activator of nuclear factor kappa B ligand (RANKL)-mediated osteoclastogenesis. Mechanistically, we found that nuclear factor of activated T-cells 1 (NFATc1) upregulated solute carrier family 7 member 11 (SLC7A11) expression through transcriptional regulation during RANKL-induced osteoclastogenesis. During TXNRD1 inhibition, the rate of intracellular disulfide reduction is significantly reduced. Increased cystine transport leads to increased cystine accumulation, which leads to increased cellular disulfide stress and disulfidptosis. We further demonstrated that SLC7A11 inhibitors and treatments that prevent disulphide accumulation could rescue this type of cell death, but not the ferroptosis inhibitors (DFO, Ferro-1), the ROS scavengers (Trolox, Tempol), the apoptosis inhibitor (Z-VAD), the necroptosis inhibitor (Nec-1), or the autophagy inhibitor (CQ). An in vivo study indicated that TXNRD1 inhibitors increased bone cystine content, reduced the number of osteoclasts, and alleviated bone loss in an ovariectomized (OVX) mouse model. Together, our findings demonstrate that NFATc1-mediated upregulation of SLC7A11 induces targetable metabolic sensitivity to TXNRD1 inhibitors during osteoclast differentiation. Moreover, we innovatively suggest that TXNRD1 inhibitors, a classic drug for osteoclast-related diseases, selectively kill pre-OCs by inducing intracellular cystine accumulation and subsequent disulfidptosis.

BackgroundObservational studies have suggested an association between obesity and iron deficiency anemia, but such studies are susceptible to reverse causation and residual confounding. Here we used Mendelian randomization to assess whether the association might be causal.MethodsData on single-nucleotide polymorphisms that might be associated with various anthropometric indicators of obesity were extracted as instrumental variables from genome-wide association studies in the UK Biobank. Data on genetic variants in iron deficiency anemia were extracted from a genome-wide association study dataset within the Biobank. Heterogeneity in the data was assessed using inverse variance-weighted regression, Mendelian randomization Egger regression, and Cochran's Q statistic. Potential causality was assessed using inverse variance-weighted, Mendelian randomization Egger, weighted median, maximum likelihood and penalized weighted median methods. Outlier SNPs were identified using Mendelian randomization PRESSO analysis and “leave-one-out” analysis.ResultsInverse variance-weighted regression associated iron deficiency anemia with body mass index, waist circumference, trunk fat mass, body fat mass, trunk fat percentage, and body fat percentage (all odds ratios 1.003–1.004, P ≤ 0.001). Heterogeneity was minimal and no evidence of horizontal pleiotropy was found.ConclusionOur Mendelian randomization analysis suggests that obesity can cause iron deficiency anemia.

Epithelial regeneration is critical for barrier maintenance and organ function after intestinal radiation injury. Accumulating evidence indicates that the interleukin family members play critical roles in intestinal stem-cell-mediated epithelial regeneration. However, little is known about the relationship between interleukin 33 (IL-33)/ST2 axis and intestinal regeneration after radiation injury. We demonstrate here that IL-33 expression significantly increased after radiation treatment. Deficiency of IL-33/ST2 promotes intestinal epithelial regeneration, resulting in a reduction of mortality during radiation-induced intestine injury. Using ex vivo organoid cultures, we show that recombinant IL-33 promotes intestinal stem cell differentiation. Mechanistically, the effects of IL-33 were mediated by activation of transforming growth factor-β signaling. Our findings reveal a fundamental mechanism by which IL-33 is able to regulate the intestinal crypt regeneration after tissue damage.

BackgroundThe previous researches show that infertile patients have a higher incidence of endometritis and endometrial polyps, and the occurrence of these two diseases is related to changes in the microbiota of the genital tract. We aim to determine the composition and changing characteristics of the microbiota in the genital tract (especially the endometrium) of infertile patients with chronic endometritis or endometrial polyps, and find the correlation between it and the occurrence of diseases.MethodsThis is a prospective study. We collected genital tract biopsy samples from 134 asymptomatic infertile patients receiving assisted reproductive therapy before embryo transfer. Through pathological examination and 16S ribosomal RNA(16S rRNA) sequencing, we determined the distribution of chronic endometritis and endometrial polyps in these patients, as well as their distribution of reproductive tract microorganisms.ResultsCompared with the normal control group, the microbial group of reproductive tract in patients with chronic endometritis and endometrial polyps is changed, and there are significant species differences and relative abundance differences in the vagina, cervix and uterine cavity. Lactobacillus, the dominant flora of female genital tract, showed a change in abundance in patients with endometrial diseases. Endometrial microbiota composed of Staphylococcus, Gardnerella, Atopobium, Streptococcus, Peptostreptococcus, Chlamydia, Fusobacterium, Acinetobacter, etc. are related to chronic endometritis and endometrial polyps.ConclusionThe results showed that, compared with the normal control group, the endometrial microbiota of infertile patients with chronic endometritis or endometrial polyps did have significant changes in the relative abundance distribution of species, suggesting that changes in local microecology may be an important factor in the occurrence of disease, or even adverse pregnancy outcomes. The further study of endometrial microecology may provide a new opportunity to further improve the diagnosis and treatment strategy of chronic endometritis.

Carbapenemase-producing Enterobacteriaceae (CPE) isolates are recognized as one of the most severe threats to public health. However, the population structure and genetic characteristics of CPE isolates among bloodstream infections (BSIs) are largely unknown. To address this knowledge gap, in this study, we included patients with clinically significant BSIs due to Enterobacterales isolates, recruited from 26 sentinel hospitals in China (2014–2015). CPE isolates were microbiologically and genomically characterized, including their susceptibility profiles, molecular typing, phylogenetic features, and genetic context analysis of carbapenemase-encoding genes. Of the 2569 BSI Enterobacterales isolates enrolled, 42 (1.6%) were carbapenemase-positive. Moreover, among the 2242 investigated isolates, 1111 (49.6%) extended-spectrum β-lactamase (ESBL)-producing isolates were identified in Escherichia coli (E. coli), Klebsiella pneumoniae (K. pneumoniae), Proteus mirabilis (P. mirabilis), and Klebsiella oxytoca. Whole genome sequencing analysis showed the clonal spread of K. pneumoniae carbapenemase (KPC)-2-producing K. pneumoniae sequence type (ST) 11 and New Delhi metallo-β-lactamase (NDM)-5-producing E. coli ST167 in our collection. Plasmid analysis revealed that carbapenemase-encoding genes were located on multiple plasmids. A high prevalence of biofilm-encoding type 3 fimbriae clusters and yesiniabactin-associated genes was observed in K. pneumoniae isolates. This work demonstrates the high prevalence of ESBLs and the wide dissemination of CPE among BSI isolates in China, which represent real clinical threats. Moreover, our findings first illustrate a more comprehensive genome scenario of CPE isolates among BSIs. The clonal spread of KPC-2-producing K. pneumoniae ST11 and NDM-5-producing E. coli ST167 needs to be closely monitored.

Abstract Background Organoids are three-dimensional structures that closely recapitulate tissue architecture and cellular composition, thereby holding great promise for organoid-based drug screening. Although growing in three-dimensional provides the possibility for organoids to recapitulate main features of corresponding tissues, it makes it incommodious for imaging organoids in two-dimensional and identifying surviving organoids from surrounding dead cells after organoids being treated by irradiation or chemotherapy. Therefore, significant work remains to establish high-quality controls to standardize organoid analyses and make organoid models more reproducible. Methods In this study, the Z-stack imaging technique was used for the imaging of three-dimensional organoids to gather all the organoids’ maximum cross sections in one imaging. The combination of live cell staining fluorescent dye Calcein-AM and ImageJ assessment was used to analyze the survival of organoids treated by irradiation or chemotherapy. Results We have established a novel quantitative high-throughput imaging assay that harnesses the scalability of organoid cultures. Using this assay, we can capture organoid growth over time, measure multiple whole-well organoid readouts, and show the different responses to drug treatments. Conclusions In summary, combining the Z-stack imaging technique and fluorescent labeling methods, we established an assay for the imaging and analysis of three-dimensional organoids. Our data demonstrated the feasibility of using organoid-based platforms for high-throughput drug screening assays. Graphical Abstract

Abstract Background In most of the views, rectal stenosis after anterior resection for rectal cancer results from pelvic radiotherapy. However, patients without receiving radiotherapy also suffer stenosis. In this study, we evaluated the factors associated with rectal stenosis after anterior rectal resection (ARR). Methods We conducted a retrospective study with ARR patients who underwent neoadjuvant chemoradiotherapy and the patients without radiotherapy. Patients who received watch and wait strategy with a clinical complete response after chemoradiotherapy were also included. Patients with colonoscopy follow-up were included for further analyses; 439 patients who underwent neoadjuvant chemoradiotherapy; 545 patients who received ARR without radiotherapy and 33 patients who received watch and wait strategy. Stenosis was diagnosed when a 12-mm diameter colonoscopy could not be passed through the rectum. Univariate and multivariate logistic regression analyses were performed to identify variables associated with rectal stenosis. Results According to the multivariate analysis in patients receiving ARR, both protective stoma and preoperative radiotherapy affected the occurrence of stenosis, with the odds ratios (ORs) of 3.375 and 2.251, respectively. According to the multivariate analysis, a preventive ileostomy was the only factor associated with stenosis both in patients receiving preoperative radiotherapy and without radiotherapy. Non-reversal ileostomy and long time between ileostomy and restoration increased the possibility of stenosis. In 33 patients who received watch and wait strategy, only one patient (3%) experienced stenosis. Conclusion Both surgery and radiotherapy are risk factors for rectal stenosis in rectal cancer patients. Compared to preoperative radiotherapy, a protective ileostomy is a more critical factor associated with rectal stenosis.

LncRNA PVT1 has been implicated in numerous pathophysiological processes and diseases, especially cancers. However, the role and mechanism of PVT1 in the tumorigenesis of glioblastoma remain unclear. We investigated the alteration of PVT1 and its key functions in glioblastoma. PVT1 was upregulated and associated with poor prognosis in glioblastoma. We demonstrated that PVT1 silencing suppressed cell proliferation, colony formation, and orthotopic xenograft tumor growth. Mechanistic investigations found that PVT1 interacted with TRIM24 directly and increased its protein stability. PVT1 recruited COPS5 to deubiquitinate TRIM24; reciprocally, PVT1 depletion impaired the interaction between COPS5 and TRIM24, resulting in decreased expression of TRIM24. PVT1, TRIM24, and COPS5 coordinately contributed to the activation of STAT3 signaling and malignant phenotype of glioblastoma. Collectively, this study elucidates the essential role of PVT1 in the tumorigenesis of glioblastoma, which provides candidacy therapeutic target for glioblastoma treatment.

A kind of high extinction ratio (ER) and large bandwidth photonic crystal fiber (PCF) polarization filter based on surface plasmon resonance is proposed. The SPP modes can be inspired by two gold-wires to improve the filter characteristics and the effect of surface plasmon resonance is further enhanced by cladding monocrystalline silicon surrounding gold-wires. An asymmetric structure of leakage channel is introduced in y-pol direction axis which intensifies the energy leakage to external cladding, high polarization extinction ratio is occurred. By using the finite element method (FEM), the structural parameters and optical properties are quantitatively analyzed. Numerical analysis shows that two main adjacent resonance peaks appear in y-pol direction, confinement losses of y-pol core mode at the resonance wavelength of 1519 and 1664 nm are 573.33 and 543.21 dB/cm, while the losses of x-pol core mode are 16.97 and 0.98 dB/cm. When the fiber length L=3 mm, the maximum ER reaches 1449 dB at the wavelength of 1519 nm, and the bandwidth with ER better than 20 dB reaches 405 nm. Hence the proposed PCF with gold-wires coated by monocrystalline silicon would have a widely application in optical fiber communication, optical information processing and other fields.

Recent studies have suggested that exploring the potential mechanisms regulating ferroptosis vulnerability may contribute to improving the systemic therapeutic efficacy in HCC. High-density lipoprotein-binding protein (HDLBP), the largest RNA-binding protein, is an important transporter that protects cells from overaccumulation of cholesterol, but few studies have elucidated the role of HDLBP in the regulation of ferroptosis vulnerability in HCC. Our study suggests that HDLBP was markedly elevated in HCC compared with noncancerous liver tissues and that this elevation inhibited the ferroptosis vulnerability of HCC. Further experiments revealed that HDLBP bound to and stabilized the long noncoding RNA lncFAL (ferroptosis-associated lncRNA), which is derived from the plexin B2 gene. Moreover, our study suggests that the splicing of lncFAL was increased by YTH N6-methyladenosine (m6A) RNA-binding protein 2 (YTHDF2) in a m6A-dependent manner. Although HDLBP or lncFAL could not regulate the GPX4 antioxidant signalling pathway, lncFAL reduced ferroptosis vulnerability by directly binding to ferroptosis suppressor protein 1 (FSP1) and competitively abolishing Trim69-dependent FSP1 polyubiquitination degradation. More importantly, FSP1 inhibition promoted the antitumour activity of ferroptosis inducers both in vitro and in vivo. Collectively, our results provide a clinically promising demonstration that HDLBP stabilizes lncFAL, which mediates a FSP1-dependent anti-ferroptosis mechanism in HCC. These results support the enormous potential of disrupting FSP1 as a promising therapeutic approach for HCC patients with high HDLBP or lncFAL expression.

Abstract There is no effective method to predict chemotherapy response and postoperative prognosis of colorectal cancer liver metastasis (CRLM) patients. Patient‐derived organoid (PDO) has become an important preclinical model. Herein, a living biobank with 50 CRLM organoids derived from primary tumors and paired liver metastatic lesions is successfully constructed. CRLM PDOs from the multiomics levels (histopathology, genome, transcriptome and single‐cell sequencing) are comprehensively analyzed and confirmed that this organoid platform for CRLM could capture intra‐ and interpatient heterogeneity. The chemosensitivity data in vitro reveal the potential value of clinical application for PDOs to predict chemotherapy response (FOLFOX or FOLFIRI) and clinical prognosis of CRLM patients. Taken together, CRLM PDOs can be utilized to deliver a potential application for personalized medicine.

Cell maintenance and the establishment of cell polarity involve complicated interactions among multiple protein complexes as well as the regulation of different signaling pathways. As an important cell polarity protein, Par3 is evolutionarily conserved and involved in tight junction formation as well as tumorigenesis. In this review, we aimed to explore the function of Par3 in tumorigenesis. Research has shown that Par3 exhibits dual functions in human cancers, both tumor-promoting and tumor-suppressive. Here, we focus on the activities of Par3 in different stages and types of tumors, aiming to offer a new perspective on the molecular mechanisms that regulate the functions of Par3 in tumor development. Tumor origin, tumor microenvironment, tumor type, cell density, cell–cell contact, and the synergistic effect of Par3 and other tumor-associated signaling pathways may be important reasons for the dual function of Par3. The important role of Par3 in mammalian tumorigenesis and potential signaling pathways is context dependent.

Abstract The surgical treatment and transcatheter arterial chemoembolization (TACE) rate of human immunodeficiency virus (HIV)-infected hepatocellular carcinoma (HCC) patients is relatively low in West China. For various reasons, most patients do not receive timely surgical treatment. Upon transfer to an infectious disease centralized hospital, they were already classified in the Barcelona Clinic Liver Cancer (BCLC)-B stage. A total of 2249 BCLC-B HCC patients were analyzed. The eligible population was divided into three groups for analysis of survival and prognostic factors; These were 21 HIV infected (HIV+) HCC patients treated with TACE (TACE+), 1293 non-HIV-infected (HIV−) HCC patients treated with TACE, and 150 HIV− HCC patients who only receive medication (TACE−) as a second control group. After 1:2 matching, 1- and 2-year survival of HIV+ TACE+ and HIV− TACE+ groups was 64.3% and 76.5% (P = 0.453) and 45.5% vs. 50.0% (P = 0.790) respectively. We also compared one and two-year survival between HIV+ TACE+ and HIV− TACE−. One-year overall survival was 64.3% vs. 45.7% (P = 0.097) and 2-year survival was 45.5% vs. 7.1% (P = 0.004). Multivariate analysis showed that the most important prognostic factors for survival were serum alpha-fetoprotein (AFP) and Child–Pugh score and tumor size, while HIV status had no significant effect on prognosis statistically. CD4 levels below 200 may increase the risk of opportunistic infection after surgery, but after anti-infection and systematic supportive therapy, it has no effect on survival. HIV+ patients should have the same treatment opportunities as HIV− patients. If the patient's immune status permits, we suggest that early TACE treatment should be administered to BCLC-B HCC patients, regardless of HIV infection.

Clostridioides difficile is the most common pathogen causing antibiotic-associated diarrhea. Previous studies showed that diverse sources, aside from C. difficile infection (CDI) patients, played a major role in C. difficile hospital transmission. This study aimed to investigate relationships and transmission potential of C. difficile strains from different sources. A prospective study was conducted both in the intensive care unit (ICU) and six livestock farms in China in 2018–2019. Ninety-eight strains from CDI patients (10 isolates), asymptomatic hospitalized carriers (55), the ICU environment (12), animals (14), soil (4), and farmers (3) were collected. Sequence type (ST) 3/ribotype (RT) 001, ST35/RT046, and ST48/RT596 were dominant types, distributed widely in multiple sources. Core-genome single-nucleotide polymorphism (cgSNP) analysis showed that hospital and farm strains shared several common clonal groups (CGs, strains separated by ≤ 2 cgSNPs) (CG4/ST3/RT001, CG7/ST35/RT046, CG11/ST48/RT596). CDI patients, asymptomatic carriers, and the ICU environment strains also shared several common CGs. The number of virulence genes was not statistically different between strains from different sources. Multi-source strains in the same CG carried identical virulence gene sequences, including pathogenicity genes at the pathogenicity locus and adhesion-related genes at S-layer cassette. Resistance genes (ermB, tetM, etc.) were widespread in multiple sources, and multi-source strains in the same CG had similar resistance phenotypes and carried consistent transposons and plasmid types. The study indicated that interspecies and cross-regional transmission of C. difficile occurs between animals, the environment, and humans. Community-associated strains from both farms and asymptomatic hospitalized carriers were important reservoirs of CDI in hospitals.

BackgroundThe diagnosis and treatment of mixed vaginitis are more complicated than single pathogenic infections, and there may be adverse reactions and several contraindications to conventional antibiotic therapy. Therefore, this study aimed to evaluate the preliminary effects of Fufang Furong Effervescent Suppository for the management of aerobic vaginitis (AV) mixed with bacterial vaginosis (BV) using Accurate 16S absolute quantification sequencing (Accu16S).MethodsIn the present randomized, blind, multi-center clinical trial, women (20 to 55 years) who had received a diagnosis of AV+BV were randomly assigned into clindamycin positive control (n = 41) and Fufang Furong Effervescent Suppository (n = 39) groups. The follow-up occurred in three time periods (V1: -2~0 days; V2: 15-17 days; V3: 40 ± 3 days). At each visit, two vaginal swabs, one for clinical evaluation and one for laboratory examination, were taken from each patient. The Nugent score, Donders’ score, drug-related complications, recurrence rates, and microecological changes of vaginal swabs were assessed in the time three periods.ResultsAt baseline, the two groups were similar in frequency of presentation with vaginal burning, odor, abnormal discharge, and itching. No meaningful differences in Nugent and Donders’ scores were detected between the two groups at stage V2 (Nugent: p = 0.67; Donders’: p = 0.85) and V3 (Nugent: p = 0.97; Donders: p = 0.55). The Furong group presented fewer complications compared to the Clindamycin group. However, this difference was not statistically significant (p = 0.15). Additionally, Accu16S indicated that the total abundance of bacteria in both groups sharply decreased in stage V2, but slightly increased in V3. In stage V3, the absolute abundance of Lactobacillus in the Furong group was considerably higher compared to untreated samples (p < 0.05). On the other hand, no momentous increase was detected in the Clindamycin group (p > 0.05).ConclusionFufang Furong Effervescent Suppository can be as effective as clindamycin cream in the management of AV+BV while may restore the vagina microecosystem better.

Patients with hepatic cirrhosis are more susceptible to Clostridioides difficile infection (CDI) and colonization with Clostridioides difficile (C. difficile). Asymptomatic C. difficile colonization is thought to predispose to subsequent CDI. However, the dynamic gut microbiota changes remain unclear. In this study, we used 16S rRNA gene sequencing to longitudinally monitor alterations in the intestinal microbiota of 22 hepatic cirrhosis patients with toxigenic C. difficile colonization at admission (pre-CDI) and developed CDI during hospitalization, subdivided into pre-CDI and CDI. 21 hospitalized cirrhotic patients without C. difficile colonization served as controls (HC). Compared with HC, pre-CDI and CDI samples had significantly decreased microbial richness and diversity, a significantly higher relative abundance of opportunistic pathogen Enterococcus, and a lower relative abundance of beneficial symbionts, such as Faecalibacterium, Dorea, and Roseburia. Three biomarkers showed high accuracy for distinguishing pre-CDI samples from HC with an area under the curve (AUC) up to 0.81. In conclusion, our study explored the changes of the gut microbiome before and after CDI. The gut microbial richness as well as diversity in CDI patients were notably reduced, relative to controls. Imbalance of the intestinal flora may be related to the risk for development of CDI. Identifying key members of the gut microbiota and illustrating their roles and mechanisms of action in CDI development are important avenues for future research.

Abstract Background Adult hemiliver transplantation (AHLT) is an important approach given the current shortage of donor livers. However, the suitability of AHLT versus adult whole liver transplantation (AWLT) for recipients with high Model for End-Stage Liver Disease (MELD) scores remains controversial. Methods We divided patients undergoing AHLT and AWLT into subgroups according to their MELD scores (≥ 30: AHLT, n = 35; AWLT, n = 88; and

ObjectiveThe predicting values of programmed cell death protein 1 (PD-1) and programmed death-ligand 1(PD-L1) were unclear in Hepatocellular carcinoma (HCC) patients who receive sorafenib treatment after curative hepatic resection.MethodsWe retrospectively enrolled HCC patients who received adjuvant sorafenib treatment after curative resection (N = 154), and patients had resection alone (N = 312). Immunohistochemistry was used to assess expression of PD-1 on tumor infiltration immune cells and PD-L1 on HCC cells. Cox proportional hazard models were used to explore association between clinicopathological factors and risk of tumor recurrence.ResultsNo significant difference was detected in RFS (p = 0.542), or OS (p = 0.542) between the resection and sorafenib group and resection alone group. In the 154 patients who received adjuvant sorafenib, expression of PD-1 or PD-L1 was not significantly associated with long-term outcomes. However, in the 122 patients at high risk of postoperative recurrence who had adjuvant sorafenib treatment, characterized by maxim tumor size ≥5 cm, or the presence of macro- or micro-vascular invasion, patients with PD-L1 overexpression (≥3.0) had significantly worse RFS (p = 0.021), and overexpression of PD-L1 (HR: 1.88, 95%CI: 1.18–2.99, p = 0.008) was identified as an independent risk factor associated with unfavorable RFS.ConclusionOverexpression of PD-L1 serves as an independent predictor of recurrence in HCC patients at high risk of relapse who received adjuvant sorafenib treatment after curative resection.

Hepatocellular carcinoma (HCC) remains a global health challenge with a low early diagnosis rate and high mortality. The Rab GTPase (RAB) family plays an essential role in the occurrence and progression of HCC. Nonetheless, a comprehensive and systematic investigation of the RAB family has yet to be performed in HCC. We comprehensively assessed the expression landscape and prognostic significance of the RAB family in HCC and systematically correlated these RAB family genes with tumor microenvironment (TME) characteristics. Then, three RAB subtypes with distinct TME characteristics were determined. Using a machine learning algorithm, we further established a RAB score to quantify TME features and immune responses of individual tumors. Moreover, to better evaluate patient prognosis, we established a RAB risk score as an independent prognostic factor for patients with HCC. The risk models were validated in independent HCC cohorts and distinct HCC subgroups, and their complementary advantages guided clinical practice. Furthermore, we further confirmed that the knockdown of RAB13, a pivotal gene in risk models, suppressed HCC cell proliferation and metastasis by inhibiting the PI3K/AKT signaling pathway, CDK1/CDK4 expression, and epithelial-mesenchymal transition. In addition, RAB13 inhibited the activation of JAK2/STAT3 signaling and the expression of IRF1/IRF4. More importantly, we confirmed that RAB13 knockdown enhanced GPX4-dependent ferroptosis vulnerability, highlighting RAB13 as a potential therapeutic target. Overall, this work revealed that the RAB family played an integral role in forming HCC heterogeneity and complexity. RAB family-based integrative analysis contributed to enhancing our understanding of the TME and guided more effective immunotherapy and prognostic evaluation.

Abstract Background Thalassemia is one of the most common inherited diseases worldwide. This report presents three novel cases of α‐thalassemia and two novel cases of β‐thalassemia caused by five different mutations in the globin gene. Methods Next‐generation sequencing (NGS) was used to identify novel α‐ and β‐thalassemia in five individuals, which was confirmed by Sanger sequencing of the globin gene. Hematological parameters were determined by an automated cell counter, and hemoglobin electrophoresis was carried out by a capillary electrophoresis system, respectively. The isoelectric point (pI), molecular weight, and conservation for the mutations were described by the Internet software programs. The pathogenicity for globin mutations was analyzed by bioinformatics analysis and relative quantitative analysis. Results NGS revealed five novel cases of α‐ and β‐thalassemia: HBA2:c.245C>T, HBA2:c.95+11_95+34delCTCCCCTGCTCCGACCCGGGCTCC, HBA2:c.54delC, HBB:c.373C>A, and HBB:c.40G>A. The clinical implications of these mutations were described. Computational predictions were made for pI, amino acid conservation, and pathogenicity of the missense mutation. Relative quantitative data of the α‐globin mRNA were analyzed. Conclusion Five novel globin mutations were identified in the populations of China, and those mutations were analyzed to provide a mechanistic view for their pathogenicity. These analyzed results improve genetic diagnostics for thalassemia, which can improve screening programs for thalassemia and prenatal diagnosis for Chinese population.

Depression is a frequent and serious comorbidity associated with diabetes which adversely affects prognosis and quality of life. Glucagon-like peptide-1 receptor (GLP-1R) agonists, widely used in the treatment of diabetes, are reported to exert neuroprotective effects in the central nervous system. Thus, we aim to evaluate whether GLP-1R agonist exendin-4 (EX-4) could alleviate depression-like behaviors in diabetic mice and to explore its underlying mechanism. The antidepressant effects of EX-4 were evaluated using behavioral tests in db/db mice. The effects of EX-4 on microglial pyroptosis and neuroinflammation were assessed in N9 microglial cells. EX-4 administration alleviated depression-like behaviors in diabetic db/db mice. GLP-1R activation by EX-4 significantly suppressed microglial pyroptosis and neuroinflammation by downregulation of gasdermin D (GSDMD) and interleukin (IL)-1β in diabetic mice and lipopolysaccharide (LPS)-primed N9 microglia. Mechanistically, GLP-1R activation improved mitochondrial function and promoted mitophagy by decreasing the accumulation of mitochondrial reactive oxygen species (mtROS) and intracellular ROS production. EX-4 exhibits antidepressant effects in depression associated with diabetes in diabetic mice, which may be mediated by inhibiting microglial pyroptisis via promoting mitophagy. It is supposed that GLP-1R agonists may be a promising therapy in depression associated with diabetes.

Abstract: The aim is to study the immune function effect of two polysaccharides extracted from traditional Chinese herbs on rats. Ultrasonic-assisted extraction was used to extract the polysaccharide from traditional Chinese medicines. MTT assay was used to determine the effects of two polysaccharides on the conversion of pig peripheral T lymphocytes. For this, 24 Sprague–Dawley rats were selected for the clinical trial and divided into groups B (blank), CK (cyclophosphamide inhibitory control), AP (angelica polysaccharide), and RIP (radix isatidis polysaccharide). Except for group B, other groups can induce the immunodeficiency by using cyclophosphamide. Rats of the AP and RIP groups were given gavage of 1 mL of AP and RIP. The blood was sampled from the eyeball on days 0, 7, 14, 21, 28, and 35, respectively, to determine immune cells, IgG and IgM of immunoglobulin, body weight, and spleen index.Results: The average content of AP and RIP was 51.27 and 14.8%, and the extraction rate was 75.23 and 60.94%. The maximum stimulation index was 1.407 when the concentration of AP was 8,000 μg mL−1 and 1.5 when the concentration of RIP was 125 μg mL−1. Both kinds of polysaccharides can alleviate the decline of white blood cells, lymphocytes, monocytes, neutrophils, and serum IgG and IgM caused by cyclophosphamide. The two polysaccharides can regulate the rapid recovery of weight in immunosuppressed rats and increase the spleen index of immunosuppressed SD rats. The polysaccharides from the two traditional Chinese medicines can alleviate the immunosuppression caused by cyclophosphamide and promote the immune function of the body, which can be used as raw material resources of new veterinary medicine.

Background:Escherichia coli is the most common pathogens in patients with community-onset blood stream infections (COBSI). Knowledge of the epidemiology of this disease is crucial to improve allocation of health resources, formulate isolation strategies that prevent transmission, and guide empirical antibiotic therapy.Methods: This retrospective observational study examined patients with E. coli COBSI (EC-COBSI) at a non-tertiary hospital in China. Whole-genome sequencing and analysis of the isolates was performed. The relationships of clinical variables with antimicrobial resistance and the genetic background of the isolates were examined.Results: There were 148 isolates in patients with EC-COBSI. All isolates were susceptible to ceftazidime/avibactam, carbapenems, and tigecycline; 35.1% were positive for extended spectrum β-lactamase (ESBL+); and blaCTX–M–14 was the most common ESBL gene. Patients with ESBL- isolates were more likely to receive appropriate empiric treatment than those with ESBL+ isolates (61.5% vs. 91.4%, p < 0.001), but these two groups had similar mortality rates. The overall 30-day mortality rate was 9.5%. Phylogenetic analysis showed that the isolates were diverse, and that the main sequence types (STs) were ST95, ST131, and ST69. Intra-abdominal infection was the primary source of disease, and isolates from these patients had lower frequencies of virulence genes.Conclusion: The mortality rate of patients with EC-COBSI was unrelated to ESBL status of the isolates. Most isolates had low resistance to most of the tested antimicrobial agents. The isolates were diverse, and multiple strains were related. Prevention and control of EC-COBSI should target prevention of patient colonization and the living environment.

As an environment-friendly natural gas hydrate exploitation method, CO2 replacement method can not only achieve the purpose of mining natural gas hydrate, but also store the current greenhouse gas CO2 in the form of hydrate on the seabed, and maintain the stratum stability of hydrate deposit area. In order to improve the rate and efficiency of CH4-CO2 replacement reaction, researchers proposed to use CO2 contained gas mixture instead of pure CO2 to replace CH4 in natural gas hydrate. Based our previous work about CH4 hydrate recovery with 40% CO2 + 60% H2, in this study, the effect of gas concentration in gas phase on final CH4 recovery are investigated by implying different time interval of gas exchange operation. Experimental results show that The CH4 recovery efficiency is 10.41 when the gas exchange is continues through the whole replacement process, and CH4 recovery efficiency changes to 12.25, 32.24 and 28.86 when gas exchange operation is carried out every 12, 24, 36 h. Indicating that replaced CH4 needs to be discharged in time to avoid CH4 molecules being replaced to form hydrates again, and it is necessary to accurately control the time interval of gas exchange operation to avoid insufficient contact time between CO2 and H2 molecules and CH4 hydrate, which affects the final replacement efficiency. In addition, the mechanism of CO2 gas mixture containing small gas molecule such as H2, N2 are studied. The results indicate that when CO2 containing small molecules such as H2 and N2 displace CH4 hydrate, the existence of small molecules (H2, N2) can give rise to decompose the hydrate lattice and release CH4 gas. If the gas molecules (CO2, N2, H2, CH4) in the gas phase have enough driving force to enter the hydrate lattice and remain stability, CH4 hydrate will not decompose completely; If not, CH4 hydrate will be completely decomposed.

The glymphatic system (GS) is a novel defined brain-wide perivascular transit network between cerebrospinal fluid (CSF) and interstitial solutes that facilitates the clearance of brain metabolic wastes. The complicated network of the GS consists of the periarterial CSF influx pathway, astrocytes-mediated convective transport of fluid and solutes supported by AQP4 water channels, and perivenous efflux pathway. Recent researches indicate that the GS dysfunction is associated with various neurological disorders, including traumatic brain injury, hydrocephalus, epilepsy, migraine, and Alzheimer’s disease (AD). Meanwhile, the GS also plays a pivotal role in the pathophysiological process of stroke, including brain edema, blood–brain barrier (BBB) disruption, immune cell infiltration, neuroinflammation, and neuronal apoptosis. In this review, we illustrated the key anatomical structures of the GS, the relationship between the GS and the meningeal lymphatic system, the interaction between the GS and the BBB, and the crosstalk between astrocytes and other GS cellular components. In addition, we contributed to the current knowledge about the role of the GS in the pathology of stroke and the role of AQP4 in stroke. We further discussed the potential use of the GS in early risk assessment, diagnostics, prognostics, and therapeutics of stroke.

In modern society excessive consumption of a high-fat diet (HFD) is a significant risk factor for many diseases such as diabetes, osteoarthritis and certain cancers. Resolving cellular and molecular mechanisms underlying HFD-associated disorders is of great importance to human health. Mesenchymal stem cells (MSCs) are key players in tissue homeostasis and adversely affected by prolonged HFD feeding. Low-grade systemic inflammation induced by HFD is characterized by increased levels of pro-inflammatory cytokines and alters homeostasis in many organs. However, whether, which and how HFD associated inflammatory cytokines impair MSCs remain unclear. Here we demonstrated that HFD induced serum cytokines disturbances, especially a continuous elevation of serum CXCL2 level in rats. Coincidentally, the differentially expressed genes (DEGs) of bone marrow MSCs (BMSCs) which functions were impaired in HFD rats were enriched in cytokine signaling. Further mechanism analysis revealed that CXCL2 treatment in vitro suppresses the adipogenic potential of BMSCs via Rac1 activation, and promoted BMSC migration and senescence by inducing over-production of ELMO1 and reactive oxygen species (ROS) respectively. Moreover, we found that although glycolipid metabolism indicators can be corrected, the CXCL2 elevation and BMSC dysfunctions cannot be fully rescued by diet correction and anti-inflammatory aspirin treatment, indicating the long-lasting deleterious effects of HFD on serum CXCL2 levels and BMSC functions. Altogether, our findings identify CXCL2 as an important regulator in BMSCs functions and may serve as a serum marker to indicate the BMSC dysfunctions induced by HFD. In addition, our findings underscore the intricate link among high-fat intake, chronic inflammation and BMSC dysfunction which may facilitate development of protective strategies for HFD associated diseases.

Energy sustainability is one of the largest challenges for sustainable development. Energy sustainability in China varies by regions because of the differences in energy resources, technology and economic levels. Previous studies have assessed national energy sustainability, few to none have looked internally on a regional or provincial scale. This paper defined energy sustainability from the four dimensions of security, efficiency, cleanness and low carbon emissions, established an index system and evaluated the energy sustainability levels of 30 provinces in China by the Improved Entropy Weight-Cloud Model (IEW-CM). The results show that: (1) General energy sustainability in Chinese provinces is deficient, and energy cleanness and efficiency perform better than security and low carbon emissions. (2) Chinese energy sustainability has obvious spatial heterogeneity and within the same province, the level is unbalanced in four dimensions. The characteristics of energy sustainability exhibit significant differences in different regions. (3) Energy security and low carbon emissions play a crucial role in achieving energy sustainability. Natural gas deliverability, energy consumption elasticity coefficient, CO2 emission per unit of energy and share of fossil energy consumption are the primary factors affecting energy sustainability differences among provinces.

Abstract Background The purpose of this research was to assess the feasibility of reconstructing the middle hepatic vein (MHV) with resected left portal vein during left hemihepatectomy. Methods From January 2014 to January 2018, six patients received left hemihepatectomy combined with MHV reconstruction using the resected left portal vein in West China Hospital. We reviewed the clinical data including patient details, surgical technique, graft patency, and operative results. Results All six patients underwent left hemihepatectomy for liver tumors located at left hepatocaval confluence. In these patients, MHV was resected due to tumor invading and reconstructed using the resected left portal vein as graft. The mean operating time was 316 min. Two patients developed complications: one experienced bile leakage and one experienced pleural effusion. No patient developed vascular graft complications. All the grafts remained unobstructed, and no local tumor recurrence occurred during the observation period of 13–41 months. Conclusions Our results indicated that the left portal vein was a safe graft for hepatic vein reconstruction. In addition, left hemihepatectomy combined with middle hepatic vein resection and reconstruction using the left portal vein can be performed safely to treat liver tumors located at hepatocaval confluence.

Abstract Fat grafting procedures are considered to be a promising regenerative, cell‐directed therapy; however, their survival is mainly influenced by ischemia condition. Fructose 1,6‐bisphosphate (FBP), as an intermediate in energy metabolism, has the potential to rescue cells and tissues from hypoxic‐ischemic circumstances. In the present study, human lipoaspirates were grafted subcutaneously into nude mice followed by a daily intraperitoneal injection of FBP at different doses for 7 days. Next, the grafts were harvested at different time points till 12 weeks postimplantation and were evaluated for cell viability and function, tissue revascularization and inflammatory cell infiltration using histological analysis, whole‐mount living tissue imaging, glycerol 3‐phosphate dehydrogenase activity assays, and quantitative analysis of gene expression. The results demonstrated that exogenous FBP administration could attenuate the volume and weight reduction of fat graft; meanwhile, FBP enhanced adipocyte viability and function, increased blood vessel formation, and decreased inflammation. Moreover, in vitro cell experiments showed that FBP could promote adipose‐derived stem cell viability and vascular endothelial growth factor (VEGF) mRNA expression in ischemia conditions. Our study indicates that FBP can be used as a protective agent for fat grafting and may be applied in stem cell‐based regenerative medicine. Stem Cells Translational Medicine 2019;8:606–616