Search

Safety assessment approaches of novel food, currently adopted in the Russian Federation, imply mandatory in vivo reproductive toxicity tests with the study of reproductive function and offspring development in order to obtain comprehensive evidence of the absence of distant adverse effects that may manifest only in the next generation. Comprehensive study of reproductive function, pre- and postnatal offspring development, as a rule, includes the research of a large number of parameters, all of which has a wide range of physiological fluctuations, and the heterogeneous distribution of some parameters' values complicates the interpretation of the results. The purpose of the study was to investigate the efficiency of a reduced adaptive potential model in rats, based on decreased diet protein intake, for the use in reproductive toxicity experiments. Material and methods . The research lasting 155 days was carried out on rats of F0 (180 females and 90 males) and F1 (773 pups, 456 fetuses) generations. Animals of parental generation F0 were divided into 3 groups - control, the 1st and the 2nd test groups, 30 males and 60 females in each. The initial age of F0 rats was 28-35 days. Animals of all groups during growth and sexual maturation (25-90 days of life) received a diet with reduced protein content (9.4 g per 100 g of diet, which is 9% in calorie value). After reaching the age of physiological maturity (100 days) rats were transferred to a diet with lower protein content (6.1 g per 100 g of diet, 6% in calorie value), and received this diet during mating, pregnancy and feeding of F1 offspring. The rats of the test groups received with feed the model herbicide glyphosate (isopropylamine salt, concentration 360 g/l) at a dose of 0.3 g/kg body weight (6% of LD50): the 1st test group - from day 70 of life, the 2nd test group - from day 30 of life throughout the duration of the experiment. Reproductive function was evaluated by the fertility of F0 animals and by the character of prenatal and postnatal development of F1 offspring. Results . The toxic factor's influence on the background of reduced protein supply did not lead to complex changes in the reproductive function of rats, the test groups differed from the control group only by the post-implantation loss and the mean litter size in the postnatal period: post-implantation loss in the 1st and the 2nd test groups was higher than normal, exceeding the value of this indicator in the control group (4.7±1.6%) by 3.1 (p<0.05) и 2.2 (р>0.05) times; the mean litter size in the 1st and the 2nd test groups was by 15.8 and 21.3% (р<0.05) lower than in the control group. Survival rate of offspring during the 1st month of life in all groups was at least 72%, which corresponds to the lower limit of the norm characteristic for Wistar rats. Conclusion . The use of the alimentary model of adaptation potential reduction based on diet protein deficiency does not consider appropriate in reproductive toxicity studies, since it does not increase either the severity of the reaction to toxic effects or the reliability of the results obtained. This model can be recommended for subacute toxicological studies of low-toxicity objects, in particular, when assessing the safety of novel food., Competing Interests: The author declares no conflicts of interest., (Copyright© GEOTAR-Media Publishing Group.)

The improvement of the novel foods' safety assessment algorithms is currently one of the food hygiene significant areas. Within the studying of Hermetia illucens insects' effect, the standard in vivo allergological research integrated in the protocol of medical and biological evaluation of genetically modified food has been used. The protocol was supplemented with cytokine profile indicators and pathomorphologic characteristics of immunocompetent organs' lymphoid tissue. The purpose of the research was to study the effect of black soldier fly (Hermetia illucens) larvae biomass on the rats' immune status in the experiment on the induced anaphylactic shock model. Material and methods . The effect of black soldier fly (Hermetia illucens) larvae biomass was studied in a 29-day experiment on growing (43-72 days of life) male Wistar rats fed with Hermetia illucens biomass - main group (n=29) and semi-synthetic casein diet - control group (n=29). The complex assessment of allergenic potential of Hermetia illucens biomass was carried out in the experiment on the induced anaphylactic shock model in Wistar rats. An expanded pool of immune status indicators was studied including active anaphylactic shock severity (lethality, number of severe anaphylaxis reactions, anaphylactic index); cytokine profile (content of proinflammatory and anti-inflammatory cytokines, as well as regulators of cellular and humoral immune response); IgG1 and IgG4 level before and after administration of ovalbumin permissive dose (4 mg/kg b.w.). In addition to this pathomorphologic characteristics of lymphoid tissue of the main immunocompetent organs (thymus, spleen, Payer's patches) have been obtained. Results . The significant systemic anaphylaxis reaction decrease in the main group has been shown. Comparative assessment of the serum cytokines (GM-CSF, IFN-γ, IL-10, IL-12(p70), IL-13, IL-1α, IL-1β, IL-2, IL-4, IL-5, IL-6, TNF-α) as well as the level of immunoglobulins of the IgG1, IgG4 class before and after administration of ovalbumin permissive dose did not reveal significant differences in rats of the control and main groups. In the main group, there was a decrease in blood serum proallergic cytokines: the level of IL-4 reduced by 1.3 fold, IL-10 - 1.1 and IL-13 - 1.2 fold (p>0.05), and in animals with mild anaphylactic reaction - by 1.8, 1.4 and 1.4 times, respectively (p>0.05). The morphologic studies of the immune system organs showed no intergroup differences. Conclusion . Thus, allergological studies of black soldier fly (Hermetia illucens) larvae in the experiment with the use of systemic anaphylaxis rat model and determination of immune status indicators (anaphylactic shock severity, cytokine profile, IgG1 and IgG4 level, morphologic structure of immunocompetent organs) did not reveal any allergenic effect of the studied product., Competing Interests: The authors have no conflict of interest to declare., (Copyright© GEOTAR-Media Publishing Group.)

The investigation of the perspectives for the application of alternative protein sources in food production has allowed us to identify two main directions requiring comprehensive scientific support: firstly, the development of production and processing of food protein technologies to obtain food hydrolysates with a given composition and properties, and secondly, the assessment of the such product safety, including evaluation of their allergenic potential. Currently, within the second direction, research is being conducted to improve approaches to assessing the allergenic potential of innovative food, search for new in vitro and in vivo models and biomarkers to guarantee the safety of these products for consumers. The purpose of the study was to research the allergenic potential of the methanotrophic bacteria protein hydrolysates on the model of systemic anaphylaxis in rats and to formulate approaches to assessing the novel foods' safety. Material and methods . The allergenic potential of acid and enzymatic hydrolysates of Methylococcus capsulatus methanotrophic bacteria was investigated on the systemic anaphylaxis' model in two 30-day experiments on Wistar rats' male fed diet containing acid hydrolysate in the 1st experiment and enzymatic hydrolysate in the 2nd experiment. Animals of the corresponding control groups were kept on semi-synthetic casein diet. The ingredients of the experimental groups' diets were substituted taking into account the content of protein, fat, carbohydrates and dietary fibers in the hydrolysates in compliance with the principle of isocaloric content and identity of chemical composition. Allergenic potential of hydrolysates was assessed using an expanded pool of indicators: severity of active anaphylactic shock (mortality, number of severe anaphylaxis reactions); cytokine profile (content of pro-inflammatory and anti-inflammatory cytokines, as well as regulators of cellular and humoral immune response), ovalbumin specific IgG immunoglobulin level before administration of ovalbumi permissive dose. Results . In the sensitised rats the inclusion of methanotrophic bacteria hydrolysates in the diet caused an increase in allergic reactivity. The systemic anaphylaxis severity was 20% (p<0.05) higher in rats of the 1st experimental group receiving acid hydrolysate with the diet than in animals of the 1st control group; in rats of the 2nd experimental group it was 33% (p<0.05) lower than the corresponding control. The assessment of the humoral immune response intensity shows a slight statistically unreliable increase by 11% (p>0.05) in the sum of IgG1 + IgG4 antibodies in rats of the 1st experimental group compared to the corresponding control group. This indicator in rats of the 2nd experimental group was 81% (p<0.05) higher than in rats of the 2nd control group. The study of serum cytokine profiles revealed an increase in Th1/Th2-regulators of the immune response in rats of both experimental groups compared to the corresponding controls: in rats of the 1st experimental group 8 out of 12 indices exceeded control values by 4-69% (p>0.05), in rats of the 2nd experimental group 7 out of 12 indices exceeded control values by 5-19% (p>0.05), and 2 out of 12 - by 88-191% (p<0.05). The experimental data processed by nonparametric ranked two-factor dispersion analysis confirmed the influence of the methanotrophic bacteria protein hydrolysis' technology on the hydrolysates allergenicity and the influence of the diet protein source. Conclusion . The results of the allergenic potential' investigation of Methylococcus capsulatus protein hydrolysates in the systemic anaphylaxis rats' model indicate the promising use of enzymatic hydrolysis. However, further optimisation of the technology is required to create a product with low residual antigenicity and immunogenicity. Approaches to allergenic potential assessment of innovative food obtained by microbial synthesis, including a number of in vitro and in vivo studies, were formed on the basis of the obtained data analysis., Competing Interests: The authors have no conflict of interest to declare., (Copyright© GEOTAR-Media Publishing Group.)

A promising growth vector of food protein production in the context of the Russian Federation's food sovereignty security is the use of microbial synthesis. Taking into consideration the proven promising use of biotechnological processes in the production of alternative protein sources, modern scientific research is focused, among other issues, on improving the technology of obtaining food microbial protein using a variety of substrates and strains-producers, as well as evaluating the consumer properties, food, biological value and safety of such products. The purpose of the research was to study and comparatively evaluate protein concentrate (PC) from bacteria Methylococcus capsulatus and basic food of animal and plant origin within the development of the technology of optimal in nutritional and biological value PC production. Material and methods . Analysis of the nutritional and biological value of PC obtained from denucleinized and purified from cell walls biomass of methanoxidizing bacteria Methylococcus capsulatus (strain GSB-15) was carried out on 46 indicators, including estimation of protein content and amino acid composition, fat content and fatty acid composition, ash and moisture. Biological studies based on measuring of net protein ratio / net protein utilization were performed on 28 growing (between 25-50 days of life) male Wistar rats. Rats in the control group (n=14) received a semi-synthetic casein diet with a protein content of ~12% in calories, the test group (n=14) received a diet including an equivalent amount of PC protein. Body weight, feed intake, and fecal and urine nitrogen losses were measured during the experiment. The biological value and digestibility of protein were judged by coefficients of protein efficiency ratio, net protein ratio, true protein digestibility, true protein biological value, true net protein utilization. Results . The nutritional value study of PC showed high protein content - 69.0%, the share of fat, moisture and ash, accounted for 0.17, 9.5 and 14.4%, respectively. The carbohydrate content was 7.0% (of which mono- and disaccharides were <0.1%). The results of a comparative assessment of Methylococcus capsulatus protein amino acid profile and basic food of animal and plant origin showed a balanced content of the most amino acids, the level of which is comparable with the protein of chicken egg, which is traditionally a standard of quality of complete protein. At the same time, the content of the essential amino acid tryptophan in PC was an order of magnitude lower than in chicken egg protein; the content of this amino acid in PC is comparable with incomplete plant proteins (sunflower, flax, rapeseed). The results of the biological value evaluation of the Methylococcus capsulatus protein in the experiment on rats indicate a relatively low biological value of the microbial synthesis protein, that is caused, most likely, by tryptophan deficiency. Rats of the test group had a significant decrease in body weight gain, feed/protein intake, coefficient of protein efficiency ratio, coefficient of net protein ratio, true protein biological value, true net protein utilization. Conclusion . The results of a comparative evaluation of PC from methanotrophic bacteria Methylococcus capsulatus denucleinized biomass and basic food of animal and plant origin indicate its relatively high nutritional value. However, the characteristics of this PC sample were not optimal in regard of protein biological value by reason of tryptophan deficiency. A single amino acid deficiency is not a valid argument for not using microbially synthesized protein in human nutrition, considering the capabilities of the modern food industry, including ways to enrich foodstuffs with missing components. In addition, there is every cause to believe that adjusting the hydrolysis technology used in the production of PC will allow to eliminate the essential amino acid loss, thereby increasing the biological value of this product., Competing Interests: The authors have no conflict of interest to declare., (Copyright© GEOTAR-Media Publishing Group.)

Liver morphology, intensity of apoptosis, and activity of xenobiotic metabolism enzymes were studied in a chronic model experiment in rats receiving a mixture of 6 pesticides against the background of life-long diets with adequate and insufficient supply of water-soluble vitamins. The dose of each pesticide in the mixture did not exceed the acceptable daily intake (1 ADI). It was found that chronic exposure to low doses of anthropogenic toxicants in combination with permanent vitamin deficiency provokes a number of liver changes, such as increased apoptosis activity, cytochrome P450 system depletion, steatosis, and inflammatory infiltration, which is a potential health risk factor., (© 2023. Springer Science+Business Media, LLC, part of Springer Nature.)

Forwarding development of identification methods for novel foods, derived from edible insects, is necessary to ensure control over their marketing within the framework of the current legislation's requirements. The purpose of the research was the development and validation of a monoplex TaqMan-PCR assay protocol (a real-time polymerase chain reaction with TaqMan technology) for the insect Hermetia Illucens' taxon-specific DNA detection and identification in food raw materials and foods. Material and methods . Studies were performed using samples containing the target DNA sequence (dried whole larvae of H. Illucens as well as H. Illucens in oilcake meal and powdered capsule forms) and inherently not containing the target DNA sequence (other insect species, mammals, plants, microorganisms as well as multicomponent food: meat, dairy and plant food). DNA extraction and purification were performed by CTAB methods [commercial kits "Sorb-GMO-B" (Syntol, Russia) and "DNeasy mericon Food Kit" (QIAGEN, Germany)]. For amplification of the target sequence, which was a fragment of the cytochrome c oxidase subunit I mitochondrial gene, we used primers and the probe: Hei-COI-F (CCTGAGCTGGTATAGTGGGAAC); Hei-COI-R (AATTTGGTCATCTCCAATTAAGC); Hei-COI-P (FAM-CGAGCCGAATTAGGTCATCCAGG-BHQ-1). PCR conditions were optimized using CFX96TM Real-Time PCR System (Bio-Rad, USA) and Rotor-Gene Q (QIAGEN, Germany) amplifiers by empirical selection of primer and probe concentrations and amplification of the time/temperature profile. Specificity and limit of detection were evaluated as part of method validation. Results and discussion . The optimized reaction mixture included 2.5-fold of Master Mix B [KCl, TrisCl (pH 8.8), 6.25 mM MgCl2], SynTaq DNA-polymerase, dNTP, glycerol, Tween 20, of each primers - 550 nM, probe - 100 nM. The time/temperature profile of the reaction: 95 °C - 180 s (95 °C - 15 s, 57 °C - 60 s), 40 cycles. The detection limit of the method was 0.19 ng of H. illucens DNA per reaction. The specificity of primer system and probe were experimentally confirmed in studies with DNA of other insects, animals, plants and microorganisms. Conclusion . A protocol of a monoplex TaqMan-PCR assay for the taxon-specific DNA of insect Hermetia Illucens' detection and identification in food raw materials and foods has been developed. Validity of the method has been confirmed by laboratory tests which allows to recommend it for use in surveillance of Hermetia Illucens-derived raw materials., Competing Interests: The authors have no conflict of interest to declare., (Copyright© GEOTAR-Media Publishing Group.)

This study aimed to evaluate the long-term low-dose effects of exposure to a mixture of 6 pesticide active substances (diquat, imazamox, imazethapyr, tepraloxydin, bentazone, acifluorfen) and to elucidate if chronic vitamin deficiency can influence their toxicity. Two hundred Wistar rats were divided in 4 groups: a vitamin-sufficiency control group, a vitamin-deficiency control group, a vitamin sufficiency test group and a vitamin-deficiency test group. The test groups were treated with the aforementioned pesticides at doses 100 times lower than the corresponding NOAEL. After 6 months, ten rats from each group were sacrificed and a complete evaluation of blood and urine biochemistry, biomarkers of oxidative stress, xenobiotic detoxification enzymes and lysosomal enzymes and organ histopathology was performed. The pesticides mixture and vitamin deficiency determined an increase in alkaline phosphatase levels and urinary calcium levels, abnormal serum lipid profile, and a decrease of total blood proteins levels, red blood cells, haematocrit and haemoglobin. The combination of the two stressors up-regulated CYP1A1, CYP1A2, CYP2B1 and GST levels. This study provides a new proof for the need to move forward from single chemical testing to a more complex approach to account for the multitude of stressors that can challenge the setting of real safety levels., (Copyright © 2021 Elsevier Ltd. All rights reserved.)

A high protein content in the insect biomass allows to classify this product as a very promising source of protein, comparable in nutritional and biological value with proteins of animal origin. Despite a long history of safe use, in some countries insects are considered a new type of food which safety must be proven before entering the food market. The long-term Russian experience in novel food's research allows to identify the crucial stages, among which, along with toxicological and allergological tests, the protein's biological value determination takes an important place. The conclusion about the biological value of protein is formed on the basis of integrated use of chemical and biological methods, which gist comes down to the study of the nitrogen balance in the growing organism (biological method) and the calculation of the amino acid score (chemical method). The aim of the research was the comprehensive assessment of Black soldier fly (Hermetia illucens) larvae protein's biological value using chemical and biological methods. Material and methods . Biological studies based on measuring of net protein ratio/net protein utilization were performed on 28 growing (between 25-50 days of life) male Wistar rats, with an initial body weight of ~65.5±1.2 g. Rats in the control group (n=14) received a semi-synthetic casein diet with a protein content of ~12% in calories, the test group (n=14) received a diet including an equivalent amount of H. illucens protein. The diet's ingredients were replaced with the consideration of the proteins, fats, and carbohydrates content in the included product following the principle of isocaloricity and isonitrogenicity (by mass fraction of total nitrogen). H. illucens biomass and casein in the test and control groups, respectively, were the main significant sources of nitrogen in the diet. Body weight, feed intake, and fecal and urine nitrogen losses were measured during the experiment. The biological value and digestibility of protein were judged by coefficients of protein efficiency ratio, net protein ratio, true protein digestibility, true protein biological value, true net protein utilization. Chemical studies included studies of the amino acid composition of H. illucens biomass protein and calculation of the digestible indispensable amino acid score (DIAAS). Results . The general condition of animals of the both groups during the whole experiment was satisfactory, the weekly body weight increase corresponded to the level of growth typical for Wistar rats, intergroup differences were not detected. Despite the fact that in a number of indicators the test group animals differed from the control [there were noted a decrease of the net protein ratio (by 5%, p>0.05), true protein digestibility (by 11%, p<0.05), net protein utilization (by 13%, p<0.05), caused by increased excretion of nitrogen with urine (by 8%, p>0.05) and feces (by 186%, p<0.05), with the same amount of nitrogen intake], the test rats' growth rate and the nitrogen's retention degree indicate a relatively high biological value of insect protein. According to the DIAAS, H. illucens protein is characterized by high content of histidine, threonine, valine, isoleucine and leucine (DIAAS=100 and more), and is also a source of sulfur-containing amino acids - methionine and cysteine (DIAAS=86) and lysine (DIAAS=97). Conclusion . The comprehensive studies of Hermetia illucens larvae protein's biological value demonstrated a high protein content, its balanced amino acid composition and high biological value, which allows to consider Hermetia illucens as a potential source of complete dietary protein., Competing Interests: The authors declare no overt and potential conflict of interest related to the publication of this article., (Copyright© GEOTAR-Media Publishing Group.)

The modeling of adaptation potential decrease in rats due to modification of the diet's vitamin-mineral composition allows to increase animals' sensitivity to toxic load in reprotoxicological experiments. The threshold values of vitamins B1, B2, B3, and B6 and mineral substances Fe 3+ and Mg 2+ in the diet, which lead to a considerable reduction of laboratory animals' adaptation potential, have been determined as 19% (from the basic level in the diet) for males and 18% for females. The efficiency of this model has been confirmed in a reprotoxicological experiment with glyphosate as a toxic factor: the action of the toxic factor against the background of reduced availability of B vitamins and salts Fe 3+ and Mg 2+ led to significant changes in such indicators of reproductive function as mating efficiency, postimplantation loss, and the total number of alive pups, while the toxic effect of glyphosate was not so pronounced against the normal level of essential substances. The obtained results prove that this adaptation potential reduction model can be recommended for the research of the low-toxicity objects reproductive toxicity in rats and for the safety assessment of novel food, in particular., Competing Interests: The authors state that there are no conflicts of interest regarding the publication of this paper., (Copyright © 2020 Nadezhda V. Tyshko et al.)

The article presents the results of rats' immune status evaluation in conditions of different levels of B vitamins (B 1 , B 2 , B 3 , B 6 ) and minerals (Fe 3+ and Mg 2+ ) supplying. Male Wistar rats (with initial body weight 90-110 g) within 65 days received model diets with 75, 30 and 19% content of the essential substances, females (with initial body weight 56-76 g) received diets with 75, 28 and 18% content. Some indicators of humoral and cellular immunity, including leukocyte count, lysozyme serum activity, IgG and IgE level, cytokine profile of blood serum and of the masses of the immune system internal organs have been examined. It has been shown that the decrease in the content of B vitamins, iron and magnesium in the diet didn't cause complex changes of the rats' immune status, therefore, the proposed model of adaptive potential change is not optimal for studying of immune system condtion. The extensive research of the immune status of rats (18 studied indicators, a sample of 90 males and 90 females) allows to set the range of physiological fluctuations of these indexes in Wistar rats of the corresponding gender and age., (Copyright© GEOTAR-Media Publishing Group.)

This publication presents the results of research that was aimed at elaboration of adaptive potential reducing model, intended for toxicological experiments. Two series of research (with a duration of 70 days each) were conducted on Wistar rats. In the 1st series five groups of animals received diets with 100, 75,50,25 and 0% of vitamins B1, B2, B3, B6 and minerals(Fe3+ and Mg2+); in the 2nd series four groups of animals received diets with 21.37, 9.94, 4.62, 2.15% of this vitamins and minerals. In the 1st series of studies the intervals of maximum, medium and minimum content of essential nutrients in the diet was established; in the 2nd series the range of the lowest possible concentrations of these elements that provided the lowest level of adaptive potential and not causing the pathology development was determined. The certain set of hematological, biochemical, immunological and other indicators were investigated, this article analyzes the results of zoometric studies, mortality of animals, as well as the results of antioxidant status (activity of superoxide dismutase, catalase, glutathione peroxidase, glutathione reductase and malondialdehyde content in red blood cells) studies. Based on the evaluation of the data which were obtained in the 1st series, it follows that a dose reduction of relevant essential nutrients to 25% didn't significantly affect the values of the studied indicators, and the complete elimination of these substances resulted in massive death of animals. In the 2nd series a significant differences between the groups were observed from the range of increased mortality (groups with 2.15 and 4.62% content of essential nutrients) to the range of deviations from central tendency of some parameters (group with 21.37% content). The data allowed to trace the dependence of these differences on the levels of vitamins and minerals in the diet. The results were used to determine threshold values of vitamins and minerals that provided the necessary reduction of the adaptive potential level in male and female rats. Taking into account the risk of pathology development, three dosages of essential substances have been established - optimal, marginal and submarginal, which provide consistent decline of adaptive potential of laboratory animals: 75, 30 and 19% for males and 75, 28 and 18% for females, respectively. The modification of vitamin and mineral composition of the diet can be used as a model of adaptive potential reduce in toxicological research.