Search

Synthetic DNA molecules of 10-23 deoxyribozymes (Dz) are known to be efficient and site-specific agents for the RNA cleavage in a catalytic manner. To provide the penetration of Dz into cells, we have proposed the new delivery system for deoxyribozymes in the form of TiO 2 •PL-Dz nanocomposite. These nanocomposites consist of catalytically ac- tive Dz molecules noncovalently immobilized through the polylysine linker to TiO 2 nanoparticles, which provide the penetration of Dz into cells. Deoxyribozymes in the prepared TiO 2 •PL-Dz nanocomposites were shown to retain their ability to cleave RNA targets albeit at a slower rate but with the same site-specificity and similar efficiency as free Dz. Unlike free Dz, the proposed TiO 2 •PL-Dz nanocomposites penetrate into cells without auxiliary actions. more...

We have previously described nanocomposites containing conjugates or complexes of native oligodeoxyribonucleotides with poly-L-lysine and TiO2 nanoparticles. We have shown that these nanocomposites efficiently suppressed influenza A virus reproduction in MDCK cells. Here, we have synthesized previously undescribed nanocomposites that consist of TiO2 nanoparticles and polylysine conjugates with oligonucleotides that contain phosphoryl guanidine or phosphorothioate internucleotide groups. These nanocomposites have been shown to exhibit antiviral activity in MDCK cells infected with H5N1 influenza A virus. The nanocomposites containing phosphorothioate oligonucleotides inhibited virus replication ~130-fold. More potent inhibition, i.e., ~5000-fold or ~4600-fold, has been demonstrated by nanocomposites that contain phosphoryl guanidine or phosphodiester oligonucleotides, respectively. Free oligonucleotides have been nearly inactive. The antiviral activity of oligonucleotides of all three types, when delivered by Lipofectamine, has been significantly lower compared to the oligonucleotides delivered in the nanocomposites. In the former case, the phosphoryl guanidine oligonucleotide has appeared to be the most efficient; it has inhibited the virus replication by a factor of 400. The results make it possible to consider phosphoryl guanidine oligonucleotides, along with other oligonucleotide derivatives, as potential antiviral agents against H5N1 avian flu virus. more...

The published data on the preparation and the dispersion-structural properties of nano-sized TiO2 are considered. Attention is focused on its sol–gel synthesis from different precursors. The possibilities for the purposeful control and stabilization of properties of TiO2 nanopowders and sols are analyzed. Information on physicochemical methods used in studies of the particle size and the phase composition of nanodisperse TiO2 is presented. The prospects of using nano-sized TiO2 in medicine and nanobiotechnology are considered. more...

New conjugates of bleomycin A5 with oligonucleotides are synthesized. The bleomycin residue was attached to the 3'- or 5'- terminus of hexadecathymidilate via a hexaethylene glycol phosphate linker. Newly designed conjugates were shown to cleave site-specifically both strands of a dsDNA fragment within a triplex. The maximum extent of cleavage for individual strand amounts to 61%. more...

The effect of different non-nucleotide inserts incorporated into oligonucleotide chains on their hybridization properties was studied by the method of thermal denaturation. Various types of alkyldiols and oligoethylene glycols were used as inserts modifying oligonucleotide backbone. Such modification of oligonucleotides caused the destabilization of their complementary complexes. It was shown that the hybridization properties of the modified oligonucleotides depend on several features of inserts: the type, number, length of insertions, and positions of interrupted dinucleotide steps in oligonucleotide chain. more...

A fragment located downstream of the genes for DNA methyltransferases ofBacillus stearothermophilus F5 (M.BstF5I-1 and M.BstF5I-2) was sequenced. The fragment contains a gene for another methylase, M.BstF5I-3, structurally and functionally similar to the N-terminal domain of M.FokI. Thus, in contrast to other restriction-modification systems, theBstF5I system includes three methylases, two being homologous to the individual M.FokI domains. more...

The ability of short peptide nucleic acid (PNA) oligomers and oligonucleotides containing modified residues of 5-methylcitidine, 2-aminoadenosine and 5-propynyl-2'-deoxyuridine (strong binding oligonucleotides, SBO) to affinity capture the target double-stranded DNA fragment from mixture by means of the end invasion was compared. Both types of probes were highly effective at the conditions used. The SBO-based probes may represent a handy and easily prepared alternative to PNA for selection of target DNA fragments from mixtures. more...

Methods of noncovalent immobilization of DNA fragments onto titanium dioxide nanoparticles (TiO2) were developed, which led to TiO2-DNA nanocomposites capable of penetrating through cell membranes. TiO2 nanoparticles of different forms (amorphous, anatase, brookit) with enhanced agglomeration stability were synthesized. The particles were characterized by X-ray diffraction, small angle X-ray scattering, infrared spectroscopy and atomic force microscopy. Three approaches to the preparation of nanocomposites are described: (1) sorption of polylysine-containing oligonucleotides onto TiO2-nanoparticles, (2) the electrostatic binding of oligonucleotides to TiO2 nanoparticles bearing immobilized polylysine, and (3) sorption of oligonucleotides on TiO2 nanoparticles in the presence of cetavlon. All three methods provide an efficient and stable immobilization of DNA fragments onto nanoparticles, which leads to nanocomposites with a density for an oligonucleotide up to 40 nmol/mg. It is shown that DNA fragments in nanocomposites retain their ability to form complementary complexes and can be delivered into cells without transfection agents and other methods of exposure. more...

Influenza A viruses take a significant place in human and animal pathology causing epidemics and epizootics. Therefore, the development of new antiflu drugs has become more and more urgent. Deoxyribozymes can be considered as promising antiviral agents due to their ability to efficiently and highly specifically cleave RNA molecules. In this study, a number ofgenomic sequences of the most relevant influenza A virus subtypes, H5N1, H3N2, and H1N1, were analyzed. Conservative regions were revealed in five the least variable segments of the fragmented viral RNA genome, and potential sites of their cleavage with "10-23" deoxyribozymes were determined. 46 virus-specific 33-mer deoxyribozymes with the general structure of 5'N8AGGCTAGCTACAACGAN9 were designed and synthesized. Screening of the antiviral activity of these agents in conjugation with lipofectin on the Madin-Darby Canine Kidney cells infected with highly pathogenic avian influenza virus A/chicken/Kurgan/05/2005 (H5N1) revealed 17 deoxyribozymes, which suppressed the titer of virus cytopathicity by more than 2.5 IgTCID50/mL (i.e. the virus neutralization index was more than 300), with five of them suppressing the virus titer by a factor of 1000 and more. The most active deoxyribozymes appeared to be specific to segment 5 of the influenza A virus genome, which encoded nucleoprotein (NP). more...

Various aspects of interaction of the antitumour glycopeptide antibiotic bleomycin with nucleic acids are considered. Data on equilibrium binding parameters obtained by various physicochemical methods have been collected and compared. The contribution of N- and C-terminal domains of the glycopeptide molecule to the binding with DNA and sequence specificity of DNA cleavage are discussed. Data on a recently created new class of compounds — bleomycin — oligonucleotide conjugates — are presented. These compounds, like antibiotics, possess DNA-cleaving activity (also in a catalytic manner) together with high selectivity towards a selected nucleotide sequence. The bibliography includes 267 references. more...

Oligonucleotide derivatives carrying steroid and N-(2-hydroxyethyl)phenazinium (Phn) residues were synthesized, and tested for the ability to form complexes.

The published data on the preparation and the dispersion-structural properties of nano-sized TiO2 are considered. Attention is focused on its sol–gel synthesis from different precursors. The possibilities for the purposeful control and stabilization of properties of TiO2 nanopowders and sols are analyzed. Information on physicochemical methods used in studies of the particle size and the phase composition of nanodisperse TiO2 is presented. The prospects of using nano-sized TiO2 in medicine and nanobiotechnology are considered. more...

Oligonucleotide derivatives carrying steroid and N-(2-hydroxyethyl)phenazinium (Phn) residues were synthesized, and tested for the ability to form complexes.

The influence of fragmentation of analyzed DNA amplicon on the efficacy of specific sequence detection by means of heterophase hybridization analysis was investigated. The detection of DNA sequence was carried out colorimetrically after introduction of biotin label into the oligonucleotide probe immobilized on a solid support upon its limited elongation in the complex with the analyzed DNA using Taq polymerase. Two simple and reproducible approaches to DNA analyte fragmentation were suggested. They are based on the formation apurinic/apyrimidinic sites in DNA followed by their degradation upon the thermal treatment. Apurinization of DNA was achieved with a mild acidic treatment. The apyrimidinic sites were formed when DNA fragment containing dTMP and dUMP residues in various ratios was treated with uracil-DNA-glycosylase (UDG). DNA analytes pretreated by one of these approaches can be used without additional purification for hybridization analysis of DNA with the use of Taq polymerase. The efficacy of hybridization analysis is shown to be higher in the case of the fragmented DNA in comparison with the native DNA amplicon. The use of fragmented DNA analytes allows utilizing bridged oligonucleotides as highly selective probes with reduced hybridization properties. more...

A convenient and efficient method for three-dimensional immobilizing oligonucleotides on glass was developed using oligonucleotide derivatives bearing a polyamine linker (PA-oligo conjugates). Polyamine (polylysine, poly(lysine, phenylalanine), polyethyleneimine) residues stipulate durable fixation of such conjugates to the glass surface with a high yield (90-95%). A DNA fragment (414-mer) is hybridized specifically to an immobilized oligonucleotide. more...

A new approach to detection of point mutations in an amplified DNA was developed. The approach is based on highly selective ligation (T4 DNA ligase) of a tandem of short oligonucleotides one of which contains the biotin group. The ligation product is formed only when the hybridization complex DNA/tandem is formed and the tandem is perfect. The hybridization complex DNA/(biotinylated ligation product) was separated from the biotinylated component of the tandem by UV-immobilization of the reaction mixture on a nylon membrane. The immobilized hybridization complex was detected colorimetrically by a streptavidin-alkaline phosphatase cojugate with a chromogenic substrate. more...

A convenient and efficient method for three-dimensional immobilizing oligonucleotides on glass was developed using oligonucleotide derivatives bearing a polyamine linker (PA-oligo conjugates). Polyamine (polylysine, poly(lysine, phenylalanine), polyethyleneimine) residues stipulate durable fixation of such conjugates to the glass surface with a high yield (90-95%). A DNA fragment (414-mer) is hybridized specifically to an immobilized oligonucleotide. more...

The idea of applying reactive oligonucleotide derivatives on nucleic acids (NA) for the purpose of achieving specific reactive effects was already suggested more than 30 years ago (Belikova et al. 1967). Since then, various oligonucleotide derivatives have been created which are capable of damaging nucleic acids and thereby influencing their function (Knorre et al. 1994). However, such oligonucleotide conjugates have not yet been applied as artificial nucleases in either scientific or medical practice. A number of drawbacks hampering a wide application of these oligonucleotide derivatives have been revealed and not yet overcome. One of these drawbacks is insufficient interaction efficiency with a target NA; another, a low selectivity of this interaction. more...

Bleomycin displays clinical chemotherapeutic activity, but is so nonspecifically toxic that it is rarely administered. It was therefore of interest to determine whether bleomycin could be directed to cleave RNA or DNA at a specific site by conjugation to a complementary oligonucleotide. A 15 nt MYC complementary oligodeoxynucleotide (HMYC55) bearing a 5' bleomycin A5 (Blm) residue was designed to base-pair with nt 7047-7061 of human MYC mRNA. Reactivity of the Blm-HMYC55 conjugate (and mismatch controls) with a MYC mRNA 30-mer, a MYC DNA 30-mer, and a MYC 2'-O-methyl RNA 30-mer, nt 7041-7070, was analyzed in 100 microM FeNH(4)SO(4), 50 mM beta-mercaptoethanol, 200 mM LiCl, 10 mM Tris-HCl, pH 7.5, at 37 degrees C. Cleavage of the substrate RNA or DNA occurred primarily at the junction of the complementary DNA-target RNA duplex, 18-22 nt from the 5' end of the RNA. Reaction products with lower mobility than the target RNA or DNA also formed. Little or no reaction was observed with more than three mismatches in a Blm-oligodeoxynucleotide conjugate. Neither the short RNA or DNA cleavage fragments nor the low mobility products were observed in the absence of Fe(II), or the presence of excess EDTA. The target RNA was also cleaved efficiently by bleomycin within a hybrid duplex with a preformed single-nucleotide bulge in the RNA strand. New Blm-oligodeoxynucleotide conjugates containing long hexaethylene glycol phosphate based linkers between oligodeoxynucleotide and bleomycin were designed to target this bulge region. These conjugates achieved 8-18% cleavage of the target RNA, depending on the length of the linker. Blm-oligodeoxynucleotide conjugates thus demonstrated sequence specificity and site specificity against RNA and DNA targets. more...

Deletion delta F508 has been revealed in PCR-amplified regions of human gene CFTR by color detection of the hybridization complex obtained by ligation of a tandem of short oligonucleotides on a DNA template followed by UV immobilization on nylon. The method allows reliable detection of the three-nucleotide deletion (insertion). The nonspecific signal depends on the nucleotide composition of the biotinylated tandem component. A significant level of the specific signal was achieved by using the PCR-amplified DNA fragments of different length (200-400 bp) irrespective of the position of the tandem-binding site in their sequences. more...

The effect of the bleomycin A5 residue linked to four-, eight-, and twelve-mer oligodeoxyribonucleotides on the substrate properties of their tandem and continuous (with or without unmodified octanucleotide effectors) hybrid duplexes was studied using E. coli RNase H. The bleomycin derivatives of oligodeoxyribonucleotides were shown to form hybrid duplexes with practically the same thermostability as those formed by unmodified oligodeoxyribonucleotides. The RNA in the bleomycin-containing hybrid duplexes is cleaved by the E. coli RNase H; however, the initial hydrolysis rate (v0) is 2.6-3.4-fold reduced for the continuous duplexes. In the case of tandem hybrid complexes, the effect of bleomycin on v0 was less pronounced. We hypothesized that steric factors play a key role in the bleomycin inhibition and effectors probably determine the substrate properties of such hybrid complexes. Of all the tandem systems studied, the RNA duplex with the bleomycin-containing tetranucleotide flanked with two effectors displayed the best substrate properties. The English version of the paper: Russian Journal of Bioorganic Chemistry, 2002, vol. 28, no. 4; see also http://www.maik.ru. more...

A new approach was proposed for detecting amplified DNA fragments by hybridization with a highly selective oligonucleotide probe obtained by ligation of a tandem of three short oligonucleotides (pN8 + pN4 + pN8' Bio) in solution, with subsequent UV-immobilization of the hybridization product on a nylon membrane and its colorimetric detection with the streptavidin-alkaline phosphatase technique. Owing to the high selectivity of ligation, the 20-mer ligation product was detected on a membrane only when it was completely complementary to a template fragment. The results showed that any single-nucleotide substitution in the tetramer-binding site can be localized and identified with the use of all 12 possible tetramers. more...

The 20-mer bridged oligodeoxynucleotides containing short oligomers joined by the hexamethylenediol and hexaethylene glycol linkers were shown to form complementary DNA/DNA and RNA/DNA complexes whose thermostability depends on the length and number of the nonnucleotide linkers. Hybrid complexes of the bridged oligonucleotides proved to be substrates for the E. coli ribonuclease H. The presence of one-three nonnucleotide linkers in a 20-mer decreased the hydrolysis efficacy only 1.2-1.4-fold. It is the composition of the RNA cleavage products that was influenced the most significantly by the nonnucleotide linkers. RNase H simultaneously hydrolyzed the RNA 3'-ends of each hybrid duplex involving a bridged oligonucleotide. The presence of an inverted 3'-3'-phosphodiester bond at the 3'-end of the oligodeoxyribonucleotide only slightly affected the RNase H activity. more...

We studied the E. coli RNase H cleavage of a 5'-labeled RNA fragment within two hybrid duplexes with identical sequences, one of which is formed by RNA and a 20-mer oligodeoxyribonucleotide (RNA/p20), whereas the second, by RNA and a tandem of short oligodeoxyribonucleotides (octanucleotide: (RNA/tandem). It was shown that RNA in the RNA/p20 complex is hydrolyzed from the 3'-end to yield consecutively the 17-, 14-, 11-, 8-, and 5-mer 5'-labeled fragments. On hydrolysis of RNA in complex RNA/tandem, the same products were registered, but their accumulation rates in this case differed. Thus, the initial rates of accumulation of the 17- and 8-mer were close. Moreover, the accumulation of the final 5-mer differed considerably: in the RNA/tandem complex it appeared within first minutes of the reaction, but only after a considerable lag period in complex RNA/p20. These data testify that the tandem is involved not only in the consecutive accumulation of the shortened products (which is characteristic of complexes including extended oligonucleotides) but also in the parallel accumulation. This results from hydrolysis of each duplex segment formed by RNA and the short oligonucleotide of the tandem. Although the order of recognition and cleavage of RNA target by ribonuclease H depends on the type of the hybrid duplex, the destruction of RNA target within complex RNA/tandem and in complex with the full-size oligonucleotide occurs with a close effectiveness. more...

Alkylation of the 22-mer DNA target pTGCCTGGAGCTGCTTGATGCCC (I) by oligodeoxynucleotide phosphorothioate derivatives (PTAO) GpsCpsApsTpsCpsApsApsGpsCpsApsGpsCpN(CH3)CH2(RCl) (II-PS) and (RCl)CH2N(CH3)pGpsCpsApsTpsCpsApsApsGpsCpsApsGpsC (III-PS) bearing a residue of an aromatic analogue of nitrogen lost (RCl = C6H4N(CH3)(CH2CH2Cl) at the 3'- or 5'-end was studied. It was shown that the internucleotide phosphorothioate bonds do not affect the regiospecificity of the target modification. The maximum degree of the target modification (at t--infinity) at 20 degrees C was about 25% for both (II-PS) and (III-PS). The use of GCATCAAGCAGCpN(CH3)CH2(RCl) (II-PO), containing internucleotide phosphodiester bonds, under the same conditions gave about 65% of the modified DNA. Kinetics of the PTAO-induced complementarily addressed nucleic acid (NA) modification was analyzed. The rate constants of the reaction of the intermediate reactive ethylenimmonium ion with phosphorothioate groups of the reagents were evaluated both in solution and in duplex. The intramolecular alkylation of phosphorothioate groups considerably affected the DNA target modification by decreasing the effectiveness of the modification in a wide range of temperatures and changing the temperature dependence of the modification from a bell-like to an S-like profile. It was concluded that, in the course of the modification, the PTAO phosphorothioate groups are intramolecularly alkylated both in solution and in the complementary NA target-oligonucleotide duplex. more...

The modification of a target DNA by alkylating oligonucleotide derivatives possessing various capacities for complex formation was studied. The binding properties of oligonucleotides were changed either by increasing their length (tetra-, octa-, and dodecamers) or by introducing a point substitution and/or an N-(2-hydroxyethylphenazinium) residue. It was found that conformational changes occurring in the structure of the target.reagent complex upon elevating the reaction temperature affect the efficiency and site-specificity of the alkylation. In the case of complete saturation of the target with the reagent, an increase in the hybridization ability of the reagent reduced the efficiency of the target modification. It was found that the modification by the tetranucleotide reagent (in the presence of an effector adjacent to the 3' end) occurs exclusively at an intracomplex target base. In the case of the dodecamer, which forms a stable, highly cooperative complex with the target, several bases of the target undergo alkylation, and an increase in temperature changes the site-specificity of alkylation. In this process, the redistribution of the target modification sites toward stronger nucleophilic centers enhances alkylation at temperatures near the melting temperature of the target.dodecanucleotide complex despite a decrease in the extent of target association. more...

Heptadeoxynucleotides were obtained that contained an aliphatic amino group in position 8 of the deoxyadenosine residue: ALNH2 CTTTCT, CTCALNH2 CTT, and ACACTCALNH2 where L = NH(CH2)n, n = 3, 5, or 7. A 4-azidotetrafluorobenzoyl residue was attached to the amino group in the oligonucleotides, and photomodification of a DNA target by the resulting reagents was carried out. It was shown that the length of the spacer influences the photomodification extent of the target; a spacer with n = 5 is optimum. The maximum modification extent (65%) was reached when a reagent containing a photoreactive group at the 5'-terminal deoxyadenosine residue was used. more...

Triplex forming oligonucleotides (TFO) bearing reactive groups which can cause site-specific damage or direct cleavage of double-stranded DNA targets are the subject of this chapter.

The influence of effectors [octanucleotides and their 3',5'-di-N-(2-hydroxyethyl)phenazinium derivatives] on the modification of a target DNA by alkylating oligonucleotide derivatives forming duplexes of different stability with the target ws studied. It is shown that, being in tandem complexes immediately adjacent to the reactive group of an oligonucleotide reagent possessing a high hybridization capacity, the effector, on the one hand, enhances the stability of the reagent target duplex, and on the other hand, changes the site-specificity of alkylation and decreases the efficiency of the target modification at temperatures that provide a high extent of the target association with the reagent. Conversely, in the case of oligonucleotide reagents forming weak complexes with the target, effectors enhance both the stability of the target.reagent duplex and the extent of the target throughout the temperature range tested. The data indicate that the varying influence of effectors on the target modification by reagents with different hybridization capacities is due to conformational features of the target reagent duplexed regions. Increasing the rigidity of the target.reagent duplex reduces the efficiency of the target modification in tandem complexes. more...

The high ligation specificity of a tetranucleotide with a pair of flanking octanucleotides on DNA template by the action of T4 phage DNA ligase is shown. In a tetranucleotide-DNA template complex containing a mismatch, almost no ligation products are formed. The ligation of a tandem octanucleotide-tetranucleotide-octanucleotide makes it possible to identify accurately any single nucleotide substitution in a tetranucleotide binding site. more...

A tetranucleotide was highly specifically and quantitatively ligated with a pair of flanking octanucleotides carrying both radioactive and nonradioactive reporter groups. The sequence of the ligation of oligonucleotide components in a tandem on a complementary template was studied. The first stage was found to be the enzyme-catalyzed activation of the phosphate group of octanucleotide, a tandem component that possesses a higher hybridization capacity than the tetramer. It is shown that the introduction of terminal reporter groups into octanucleotides does not decrease the efficiency of their tandem ligation. more...

It was demonstrated that any mismatches in a complex formed by an ssDNA target and a tetranucleotide at 25 or 37 degrees C can be discriminated by alkylating the DNA with a tetranucleotide carrying a 4-[N-methyl-N-(2-chloroethyl)]aminobenzylethylamine residue at the 5'-terminal phosphate in the presence of a pair of flanking effectors, octanucleotide di-N-(2-hydroxyethyl)-phenazinium derivatives. The discrimination factor (ratio of the extent of the target modification in the perfect and mismatch-containing complexes) for a single mismatch in the tetranucleotide binding site at 25 degrees C varied between 4 and 500 depending on the type of mismatch and its location in the complex and exceeded 400 at 37 degrees C for all the investigated mismatches. The DNA target modification by the alkylating derivative of the 3'-estrone ester of tetranucleotide pCAGX (mean = C, T, A or G) was selective in the presence of a pair of hydrophobic effectors, octanucleotide 5'-cholesteryl-3'-phenazinium derivatives. The discrimination factors for 3'-terminal mismatches T.G, A.G, and G.G were 1,8,400, and 400, respectively. more...

A new approach for modification of target DNAs with tandems of derivatives of short oligonucleotides was suggested that allows highly selective modification of perfect duplexes only. At physiological temperatures, the efficiency of DNA modification by a dodecanucleotide alkylating agent was demonstrated to be the same for both perfect and mismatch-containing duplexes, whereas the tetranucleotide reagent in the presence of two flanking effectors alkylated with high selectivity the target DNA in the perfect duplex only. more...

The alkylating properties of the derivatives of phosphorothioate oligonucleotide analogues containing the alkylating 3'-[N-methyl-4-(N'-methyl-N'-2-chloroethylamino)benzyl]phosphamide group were studied using the alkylating 3'-phosphamide derivative of trithymidine phosphorothioate TpsTpsTpN(CH3)CH2RCl. It was shown by ion-exchange chromatography and 31P NMR spectroscopy that reagents of this type are able to alkylate, depending on the conditions, both their own internucleotide phosphorothioate residues and nucleophiles in the medium. In the absence of external nucleophiles in aqueous media, TpsTpsTpN(CH3)CH2RCl forms predominantly the products of intramolecular alkylation of ps-groups rather than the products of hydrolysis of the RCl-group. In the presence of a nucleophile (1 M aqueous ethylenediamine), the reagent alkylates mainly the aliphatic amino groups of the nucleophile. If the ethylenediamine concentration is reduced to 0.1 M, both processes take place, whereby the rate of reaction with EDA is twice as high as that of intramolecular alkylation. The rate constant of the limiting stage of alkylation (ionization of the C-Cl bond), k0, does not depend on the presence of the competitive nucleophile (ethylenediamine) and is 3.95 x 10(-4) s-1 at 37 degrees C. more...

The interaction of DNA and RNA with oligodeoxyribonucleotides and their 3'-terminal N-(2-hydroxyethyl)phenazinium derivatives carrying peptide residues with alternating basic and hydrophobic amino acids at the 5'-terminal phosphate was studied. It was found that the introduction of peptide residues (LeuArg)n-Gly-NH2 (n = 2-4) into an oligodeoxyribonucleotide enhances the latter's hybridization ability: each additional LeuArg pair increases the Tm value of the (5')pd(CACACACAAAAAAC).(3')d(TGTGTGTG)p(-LeuArg)n-Gly- NH2 complex by 1.3 degrees C. The reagents did not destort the DNA structure and were capable of site-specific hydrolysis of the phosphodiester bonds of RNA. It was shown that the location of the cleavage sites and the efficacy of the RNA hydrolysis at n = 2 and 4 and at n = 3 strongly differ. The maximum hydrolysis (80%) of tetradecaribonucleotide (5')p(GAUUGAAAAUCCCC) was achieved using peptidyloligodeoxyribonucleotide (3')d(CTAACT)p(LeuArg)4GlyNH2. The possibility of directed cleavage of phosphodiester bonds in tRNAPhe by peptidyloligodeoxyribonucleotides (3')d(CTAACT)p(LeuArg)nGlyNH2 (n = 3 and 4) was shown. more...

New restriction endonucleases, Bsp153AI and BspM39I, were isolated from Bacillus species strains 153A and M39, respectively. The enzymes recognize and cleave the nucleotide sequence [sequence: see text] and are true isoschizomers of restriction endonuclease PvuII. more...

The efficiency of site-specific interaction of target DNA with bleomycin derivatives of short nucleotides can be significantly increased using flanking effector oligonucleotides. The cleavage of a 20-mer single-stranded target DNA by a tetranucleotide containing a bleomycin A5 residue at the 5'-end was studied in the presence of effector oligonucleotides bearing phenazine residues at the 5'- and 3'-ends. In the presence of two effectors, the extent of the target DNA modification at 37 degrees C increased from 20 to 70%. Site-specific cleavage occurs, by up to 90%, at a single site of the target DNA. The melting temperature of the complementary complex formed by the bleomycin A5-modified tetranucleotide and target DNA in the presence of two effectors was 45 degrees C, whereas in the absence of the effectors, below 7 degrees C. more...

The localization of the covalent bond in the conjugates of bleomycin A5 and oligonucleotides was established by 13C NMR using the bleomycin derivative of uridine-5'-phosphate synthesized as a model compound. The phosphate group of the nucleotide was shown to form a phosphamide bond with the primary amino group of the spermidine moiety of bleomycin A5. The formation of the P-N bond causes the downfield shift of the signals of the neighboring carbon atoms of the spermidine fragment by 1.8 and 4.2 ppm and the splitting of the signal of the C-2 atom of the spermidine fragment with J 6.8 Hz due to vicinal spin-spin coupling with the phosphorous atom. more...

For the first time, reagents that are capable of catalytic site-specific cleavage of DNA were synthesized based on oligonucleotides. One molecule of reagent (Blm-R)pd(CCAAACA) containing bleomycin A5 residue (Blm-RH) could degrade three molecules of target DNA pd(TGTTTGGCGAAGGA). The reagent displayed maximum catalytic activity in a temperature range that was close to the melting temperature of the reagent-target DNA complex. The number of the target DNA molecules that could be degraded by the reagent was limited by the degradation of the antibiotic residue itself during the oxidative degradation of the target DNA. The reagent catalyzed the subsequent degradation of residues G7, T5, T4, and T3 of the target DNA at an equimolar reagent-target DNA ratio. When the tenfold excess of the target DNA was used, the reagent degraded primarily the single G7 residue of the target DNA by 30%. more...