Search

Hemophagocytic syndrome is a key point in the pathogenesis of severe forms of multisystem inflammatory syndrome associated with COVID-19 in children (MIS-C). The factors associated with hemophagocytosis in patients with MIS-C were assessed in the present study of 94 boys and 64 girls ranging in age from 4 months to 17 years, each of whose HScore was calculated. In accordance with a previous analysis, patients with HScore ≤ 91 (n = 79) and HScore > 91 (n = 79) were compared. Patients with HScore > 91 had a higher frequency of symptoms such as cervical lymphadenopathy, dry cracked lips, bright mucous, erythema/swelling of hands and feet, peeling of fingers, edematous syndrome, hepatomegaly, splenomegaly, and hypotension/shock. They also had a higher erythrocyte sedimentation rate (ESR), C-reactive protein (CRP) and D-dimer levels, and a tendency to anemia, thrombocytopenia, and hypofibrinogenemia. They more often needed acetylsalicylic acid and biological treatment and were admitted to ICU in 70.9% of cases. Conclusion: The following signs of severe MIS-C were associated with HScore > 91: myocardial involvement, pericarditis, hypotension/shock, and ICU admission.

Multisystem inflammatory syndrome associated with COVID-19 in children (MIS-C) is a life-threatening condition that often requires intensive care unit (ICU) admission. The aim of this study was to determine risk factors for severe/life-threatening course of MIS-C. The study included 166 patients (99 boys, 67 girls) aged 4 months–17 years (median 8.2 years). The criterion of severity was the fact of ICU admission. To conduct a comparative analysis, MIS-C patients were divided into two groups: patients hospitalized in the ICU (n = 84, 50.6%) and those who did not need ICU admission (n = 82, 49.4%). Patients with a more severe course of MIS-C were significantly older. They had a higher frequency of signs such as rash, swelling, hepatomegaly, splenomegaly, and neurological and respiratory symptoms. Hypotension/shock and myocardial involvement were much more common in patients with severe MIS-C. These patients had a more significant increase in CRP, creatinine, troponin, and D-dimer levels. Additionally, the presence of macrophage activation syndrome was higher in patients admitted to the ICU. Conclusion: Nineteen predictors of severe course of MIS-C were found, out of which hepatomegaly, splenomegaly, D-dimer > 2568 ng/mL, troponin > 10 pg/mL were mainly associated with the probability of being classified as early predictors of severe MIS-C requiring ICU admission.

ObjectiveMacrophage activation syndrome (MAS) is a life-threatening, potentially fatal condition associated with systemic juvenile idiopathic arthritis (sJIA). Interleukin-1 (IL-1) is a key cytokine in the pathogenesis of sJIA MAS. Many cases of MAS are medically refractory to traditional doses of biologic cytokine inhibitors and may require increased dosing. When MAS occurs in the setting of sJIA treated with the IL-1 receptor antagonist (IL-1Ra), anakinra, increased anakinra dosing may be beneficial. Increased dosing of another IL-1 inhibitor, canakinumab, a monoclonal antibody to IL-1β, has not been reported to treat refractory MAS in the setting of sJIA.MethodsRetrospective data collection extracted from the electronic medical record focused on canakinumab usage and dosing in 8 children with sJIA who developed MAS at a single academic center from 2011 to 2020.ResultsEight sJIA children (five girls) with median age 8.5 years (range, 0.9–14.2 years) were included in the present study. Five children developed MAS at disease onset and three during ongoing canakinumab therapy. MAS resolved in all eight children with canakinumab treatment. When the canakinumab dosing was insufficient or MAS developed during canakinumab therapy, the dosing was temporally up-titrated (four patients, maximum 300 mg per dose) without observed side effects.ConclusionThis report provides evidence for the efficacy and safety of short-term increased doses (2–3-times normal) of canakinumab in treating sJIA associated MAS. Further study of the efficacy and safety of increased doses of canakinumab for treatment of MAS in children with sJIA is warranted.

ObjectivesUveitis is the most frequent extra-articular manifestation of juvenile idiopathic arthritis (JIA). Our study is aimed to evaluate the possible difference in arthritis course depending on uveitis presence in patients with JIA, treated with biologics.MethodsFrom our database of patients with JIA treated with biologics, we extracted patients to whom the first agent was administrated with or without MTX. The exclusion criteria included treatment with current systemic corticosteroids, infliximab, rituximab, observation period

ObjectivesHeart involvement in multisystem inflammatory syndrome associated with COVID-19 in children (MIS-C) is a new challenging problem, requiring fast and reliable diagnostics and appropriate treatment. The aim of this study is to describe heart involvement in patients with MIS-C.Study DesignIn this retrospective, multicenter cohort study, data of 122 patients were included. All patients met WHO and CDC criteria of MIS-C.ResultsVarious types of heart involvement in MIS-C patients were observed. Patients with solely coronary artery lesions (CAL, n = 10, 8.2%) had typical features of Kawasaki disease: younger age, thrombocytosis and normal ferritin level, without giant CA aneurysms, thrombosis, myocardial infarction, shock, and ICU admission. Patients with solely myocardial involvement (MI, n = 30, 24.6%) had an older onset age, elevated ferritin, LDH, the highest D-dimer, H score, and thrombocytopenia level. The following clinical signs were associated with MI: gastrointestinal and central nervous system disorder, sore throat, swelling face, splenomegaly, shock, and treatment in the intensive care unit required. Patients with a combination of CAL and MI (n = 10, 8.2%) had symptoms similar to patients with solely MI, except for impressive thrombocytopenia. Shock and ICU admission were found in 34.7% of patients without heart involvement (n = 72, 59%). One major criterion [troponin > 32 pg/ml (52 points)] or at least two minor criteria [face swelling (32 points) and D-Dimer > 1,300 ng/ml (29 points)] were associated with MI (>32 points) with a sensitivity of 67.5% and a specificity of 88.9%.ConclusionThe above-suggested criteria can be added to routine diagnostic procedures to confirm MI in MIS-C patients.

JAK-inhibitors are small molecules blocking the JAK-STAT pathway that have proven effective in the treatment of different immune-mediated diseases in adults and juvenile idiopathic arthritis (JIA).Aim of StudyTo evaluate the safety and efficacy of tofacitinib in children with different rheumatic diseases.Material and MethodsWe extracted information from 24 children with the following diagnosis: JIA (n = 15), undifferentiated systemic autoinflammatory diseases (SAIDs) (n = 7), and juvenile dermatomyositis (JDM) (n = 2) who have been treated with tofacitinib for a period of longer than 6 months. The treatment outcomes were classified according to the opinion of the attending physicians as having a complete response (CR), i.e., the absence of disease activity, or a partial response (PR)—a significant improvement of symptoms and disease activity, or no response (NR)—no changes in disease activity.ResultsCR was achieved in 10/24 patients; 7/15 among JIA patients, 1/2 among JDM patients, 4/7 among SAID patients, and PR in 5/15 of JIA, 1/2 of JDM, and 3/7 of SAID patients. Three non-responders with JIA discontinued tofacitinib. Corticosteroids were successfully tapered off in 11/14 patients and discontinued in 2/14 patients. Four patients had side effects not requiring treatment discontinuation: liver enzyme elevation (n = 2), hypercholesterolemia (n = 1), lymphadenitis (n = 1).ConclusionJAK-inhibitors are effective new therapies for the treatment of multiple immune-mediated diseases. Our experience has shown the best results in patients with JIA and JIA-associated alopecia, and type I interferonopathies. More data from randomized controlled clinical trials are needed to use JAK-inhibitors safely in pediatric rheumatic diseases.

Background: Several cases of skin and central nervous system vasculopathy associated with COVID-19 in children have been published, but the information is rather limited. Our study aimed to describe these cases of vasculitis associated with COVID-19 in children. Methods: In the retrospective-prospective case series study we included information regarding four children with COVID-19-associated vasculitis. In every case, we had a morphological description and the etiology was confirmed via real-time polymerase chain reaction during a tissue biopsy. Results: The most involved systems were skin (4/4), respiratory (3/4), cardiovascular (2/4), nervous (1/4), eye (1/4), kidney (1/4), and inner year (1/4). All patients had increased inflammatory markers and thrombotic parameters (D-dimer). No patient met the criteria for multisystem inflammatory syndrome in children. Two patients met polyarteritis nodosa criteria, one met Henoch–Schonlein purpura criteria, and one met unclassified vasculitis criteria. All patients were treated with systemic glucocorticosteroids (two-pulse therapy). Non-biologic DMARDs were prescribed in all cases; 1/4 patients (25%) was treated with intravenous immunoglobuline, and 3/4 (75%) were treated with biologics (etanercept, tocilizumab, and adalimumab). Conclusions: Vasculitis associated with COVID-19 could be a life-threatening condition; SARS-CoV-2 might be a new trigger or etiological agent for vasculitis and other immune-mediated diseases. Further research and collection of similar cases are required.

Objectives: Diagnostic between multisystem inflammatory syndrome associated with COVID-19 in children (MIS-C) and Kawasaki disease (KD) can make difficulties due to many similarities. Our study aimed to create a Kawasaki/MIS-C differentiation score (KMDscore) allowing discrimination of MIS-C and KD.Study design: The retrospective multicenter cohort study included clinical, laboratory, and instrumental information about MIS-C (n = 72) and KD (n = 147). The variables allowed to discriminate both conditions used to construct and validate the diagnostic score called the KMDscore.Results: Patients with MIS-C were older, had earlier admission to the hospital, had a shorter time before fever resolution, two times frequently had signs of GI and CNS involvement observed, and had more impressive thrombocytopenia, higher level of CRP, ferritin, ALT, AST, LDH, creatinine, triglycerides, troponin, and D-dimer compared to KD patients. Respiratory signs in MIS-C were presented with pleuritis, acute respiratory distress syndrome, oxygen dependency, lung infiltration, and ground-glass opacities in CT. The heart involvement with fast progression of myocarditis provided the severity of MIS-C and ICU admission due to 12 times higher arterial hypotension or shock and required cardiotonic. No differences in the frequency of CA lesions were seen in the majority of cases. Five criteria, CRP >11 mg/dl (18 points), D-dimer >607 ng/ml (27 points), age >5 years (30 points), thrombocytopenia (25 points), and GI involvement (28 points), were included in the KMDscore. The summa >55 points allowed to discriminate MIS-C from KD with a sensitivity of 87.5% and specificity of 89.1%.Conclusion: The KMDscore can be used to differentiate the diagnostic of MIS-C from KD.

Background. Etanercept is a biological drug most commonly used in patients with juvenile idiopathic arthritis (JIA). The results of its use are showed in local studies.Objective. Our aim was to evaluate the efficacy and safety of the use of etanercept in children with non-systemic JIA, to determine the predictors of remission and the risk factors for the development of exacerbations.Methods. In a retrospective cohort study, the results of etanercept treatment (remission, exacerbations, adverse events) in children with non-systemic JIA were analyzed. The minimum follow-up period was 6 months.Results. The period of remission within 6–36 months occurred in 77/131 (58.8%), exacerbations developed in 18/129 (14.0%) patients. Predictors of achieving remission were the age of JIA onset < 8 years [relative risk (RR) 2.05; 95% confidence interval (CI) 1.27–3.23], the age of prescribing etanercept ≤ 10 years (RR 1.7, 95% CI 1.22–2.38), the time of the disease prior to etanercept prescription < 2.5 years (RR 2.4, 95% CI 1.4–4.4), the presence of HLA-B27 antigen (RR 2.15, 95% CI 0.98–4.75; p = 0.06). The risk of exacerbations was higher in children with polyarticular JIA (RR 2.7, 95% CI 0.9–8.2; p = 0.08), whereas methotrexate therapy reduced the risk of exacerbations (RR 0.32, 95% CI 0.1–1.15; p = 0.05). Etanercept was discontinued due to primary (improvement by the ACRpedi criteria after 3 months of therapy

Background. Patients with malignant oncohematological diseases (OHD) may have such symptoms as fever, lymphadenopathy, hepatosplenomegaly, joint pain, arthritis, elevated erythrocyte sedimentation rate (ESR) and C-reactive protein (CRP) concentration, anemia that require differentiation from clinical implications of systemic juvenile idiopathic arthritis (sJIA).Objective. Our aim was to determine diagnostic criteria that can differentiate rheumatic masks of OHD from sJIA.Methods. The retrospective study included 86 children with sJIA and 21 children with OHD who had rheumatic masks and were hospitalized in rheumatological departments with an initial diagnosis of sJIA. OHD were represented by acute lymphoblastic leukemia (n = 17), neuroblastoma (n = 1), and lymphomas (n = 3).Results. Blast cells in the peripheral blood test were detected in 9/17 (53%) patients with acute leukemia at different times from the appearance of complaints and hospitalization. Diagnostic criteria for differentiating OHD from sJIA were the number of active joints 3 (diagnostic odds ratio, OR, 4.4, 95% confidence interval, CI, 1.5–13.2), CRP concentration < 15 mg/L (OR 5.6, 95% CI 1.7–18.4), platelets 307 109/L (OR 22.9, 95% CI 4.9–107.0), white blood cells 8.9 109/L (OR 50.2, 95% CI 6.3–401.3), albumin > 43.3% (OR 28.8, 95% CI 5.6–149.2), absence of exanthema (OR 39.8, 95% CI 8.4–188.5). The most frequent symptoms with the greatest specificity were night pain (sensitivity 0.57, specificity 1.0), bone pain (sensitivity 0.95, specificity 1.0), pathological fractures (sensitivity 0.14, specificity 1.0).Conclusion. The identified diagnostic criteria can be used for differential diagnosis of OHD with rheumatic masks and sJIA.

The issue of a therapy of children with juvenile idiopathic arthritis (JIA) with intolerance or insufficient effectiveness of methotrexate remains actual.Objective: Our aim was to study the efficacy and safety of tocilizumab in patients with polyarticular JIA.Methods. In a retrospective study, we studied the results of the use of tocilizumab in patients with active polyarticular JIA ( 5 active joints) resistant to prior therapy with methotrexate or a combination of methotrexate with other nonbiologic disease-modifying antiinflammatory drugs.Results. The data of 40 children (83% girls) with the onset median of polyarticular JIA of 4.8 (2.9, 8.1) years and the interval between the disease onset and the initiation of tocilizumab therapy of 5.7 (1.8, 8.5) years was analyzed. Tocilizumab was used as an intravenous infusion of 8 mg/kg (with a weight 30 kg) or 10 mg/kg (with a weight < 30 kg) every 4 weeks. The duration of tocilizumab monotherapy in 5 (13%) children was 1,109 days (452; 1,542). The stages of inactive disease (according to the criteria of C. Wallace, 2004) in 6 months of tocilizumab therapy reached 6 (15%) patients, in 42 months — 32 (80%) patients. In 3 patients, tocilizumab was canceled due to persistent remission. After 6 months of treatment, there was a marked decrease in erythrocyte sedimentation rate, C-reactive protein concentration, number of leukocytes and platelets (in all cases, p < 0.001) to normal values, which persisted throughout the whole period of drug administration. Predictors for achieving inactive disease were the initial (at the onset of tocilizumab therapy) number of peripheral blood leukocytes < 9.0X109/l [relative risk (RR) 1.92; 95% confidence interval (CI) 0.9–4.6)] and the absence of prior biological therapy (RR 1.92, 95% CI 0.9–4.6). The most frequent side effects of tocilizumab therapy were transient hypercholesterolemia (in 13), hypertriglyceridemia (in 4), transient grade II neutropenia (in 1).Conclusion. The long-term efficacy and relative safety of tocilizumab in children with polyarticular JIA have been showed.

Differentiated Approach to Non-Bacterial Osteomyelitis Treatment in Children: the Retrospective Study Results Background. Low efficacy of the therapy of children with non-bacterial osteomyelitis remains a topical problem of modern pediatrics and rheumatology. Objective: Our aim was to assess the efficacy and safety of non-bacterial osteomyelitis treatment in children. Methods. A retrospective study of the case records of children with non-bacterial osteomyelitis has been carried out. The therapy efficacy (remission) was assessed by the following criteria: absence of fever, pain, clinically active lesions, laboratory disease activity. Laboratory and radiological methods were carried out during diagnosis of the pathological process, and subsequently every 3–6–12 months to assess disease activity depending on the initial injury extent of the skeleton. Clinical activity assessment was carried out by means of a visual analogue scale. Results. We analyzed treatment results of 52 children (68 therapy courses) with non-bacterial osteomyelitis. Nonsteroidal anti-inflammatory drugs were administered to 19 patients, sulfasalazine — to 7, methotrexate — to 9, pamidronic acid — to 18, inhibitors of tumour necrosis factor (TNF) α — to 15. Remission was achieved in 10 (53%) 4 (57%) 4 (44%), 16 (89%), and 11 (73%) patients (p = 0.001), respectively. Adverse events during treatment occurred in 21 (40%) children. No serious adverse events were reported. Conclusion. The efficacy of different regimens has been shown. It was found that pamidronic acid drug and TNF inhibitors were the most effective in treating children with non-bacterial osteomyelitis.

Juvenile Idiopathic Arthritis (JIA) is the commonest and most debilitating rheumatic disease occurring among children. Objective: To identify the frequency and nature of the menstrual disorders observed in girls affected with JIA. Material and Methods: The study included 147 patients of the Rheumatology department of St. Petersburg State Pediatric Medical University’s clinic, 58 of who were afflicted with JIA. We used anamnestic, clinical and laboratory methods as well as analysis of the medical records to diagnose this disease. Results: We examined 58 patients with JIA. Menstrual function was present in 40 girls in the age range of 12 to 17 years among the 58 patients with JIA selected for this study. The average age of menarche was 12.4±2.5 years. Menstrual irregularities were observed in 27 cases (67.5%). Excessive menstruation with regular cycle was observed in 44.4% of the cases; primary oligomenorrhoea and secondary amenorrhoea were detected in 29.6% of the girls and primary dysmenorrhoea in 29.6%. Conclusions: • The frequency of the menstrual disorders in girls with JIA is 67.5%. The form associated with excessive menstruation with regular cycle occurs most often. • The most frequent menstrual disorders were observed in the polyarticular and systemic course of JIA. • The age at onset, disease duration and use of glucocorticoid therapy affected the nature of the menstrual disorders. • Menstruating girls suffering from JIA require gynecological control to determine the status of menstrual function with the purpose of prevention of reproductive disorders.

Background: Systemic lupus erythematosus (SLE) is the most frequent and serious systemic connective tissue disease. Nowadays there is no clear guidance on its treatment in childhood. There are a lot of negative effects of standard-of-care treatment (SOCT), including steroid toxicity. Rituximab (RTX) is the biological B-lymphocyte-depleting agent suggested as a basic therapy in pediatric SLE., Aim: To compare the benefits of RTX above SOCT., Methods: The data from case histories of 79 children from the Saint-Petersburg State Pediatric Medical University from 2012 to 2022 years, were analyzed. The diagnosis of SLE was established with SLICC criteria. We compared the outcomes of treatment of SLE in children treated with and without RTX. Laboratory data, doses of glucocorticosteroids, disease activity measured with SELENA-SLEDAI, and organ damage were assessed at the time of initiation of therapy and one year later., Results: Patients, treated with RTX initially had a higher degree of disease activity with prevalence of central nervous system and kidney involvement, compared to patients with SOCT. One year later the disease characteristics became similar between groups with a more marked reduction of disease activity (SELENA-SLEDAI activity index) in the children who received RTX [-19 points (17; 23) since baseline] compared to children with SOCT [-10 (5; 15.5) points since baseline, P = 0.001], the number of patients with active lupus nephritis, and daily proteinuria. During RTX therapy, infectious diseases had three patients; one patient developed a bi-cytopenia., Conclusion: RTX can be considered as the option in the treatment of severe forms of SLE, due to its ability to arrest disease activity compared to SOCT., Competing Interests: Conflict-of-interest statement: All the authors declare that they have no conflict of interest., (©The Author(s) 2022. Published by Baishideng Publishing Group Inc. All rights reserved.)

Background: Pediatric lupus nephritis (LN) is one of the most serious manifestations of systemic lupus erythematosus (SLE) in children, determining the outcomes of the disease. There are no standardized treatment protocols for pediatric LN, and the role of biologics has not yet been conclusively defined., Objectives: analyze the safety and efficacy of rituximab biosimilar BCD020 in pediatric patients with lupus nephritis., Methods: in a retrospective cohort study, the data from the case histories of 25 patients with LN (10 boys and 15 girls) with an onset age of 13 (9-16) years, who failed conventional non-biologic treatment or developed corticosteroid dependence/toxicity, were included. The diagnosis was made using Systemic Lupus International Collaborating Clinics (SLICC) classification criteria. Rituximab biosimilar BCD020 was prescribed in a dosage of 375 mg/m 2 every week (2-4 infusions) with repeated courses every 6-12 months (2-4 infusions) according to disease activity, B-cell depletion, and IgG levels. The dynamics of clinical and laboratory data, the activity of the disease by SLEDAI, and corticosteroid doses were assessed at the onset and during the rituximab trial., Results: The main patient's characteristics were: Pre-rituximab non-biologic conventional treatment included: cyclophosphamide 15 (60%), MMF 8 (32%), azathioprine 3 (12%), hydroxychloroquine 12 (48%), and pulse therapy of methylprednisolone followed by oral methylprednisolone 25 (100%). The time before rituximab was 7.0 (3.0-24.0) months, and the whole observation period was 7.0 (0; 24) months. The initial pre-rituximab treatment slightly reduced SLEDAI levels and the proportion of patients with LN. A significant reduction of SLEDAI, the anti-dsDNA level, proteinuria, hematuria, C4 complement, ESR, and the median corticosteroid dose by 80% from the initial value, as well as the proportion of patients without corticosteroids, was observed after rituximab administration. Two deaths were observed due to catastrophic SLE with macrophage activation syndrome, accompanied by a severe infection (invasive aspergillosis, n = 2). Three patients developed serious adverse events: pneumonia ( n = 2), transient agranulocytosis ( n = 1) after the third rituximab infusion, and meningitis, caused by Listeria monocytosis, after the first rituximab infusion. Eight patients received antibacterial treatment for different respiratory infections without hospital admissions., Conclusions: Rituximab biosimilar BCD020 showed effectiveness in LN, whereas previous non-biologic treatment was insufficiently effective. Randomized controlled trials are required to evaluate the efficacy and safety of rituximab and evaluate the benefits when compared with conventional SLE treatment.

Background/purpose: The CCR5 protein is a chemokine receptor, and is known to be expressed on T cells, macrophages, dendritic and microglia cells. It is believed that different prevalence of HLA and CCR5- delta32-a 32 base pair deletion in the coding region-in various ethnic groups is associated with the severity and prevalence of chemokine-mediated autoimmune diseases, systemic-onset Juvenile Idiopathic Arthritis (soJIA) being among them (Del Rincon et al., 2003). Since the end of the last century the protective role of the CCR5-delta32 mutation against JIA is discussed (Hinks et al., 2010), though it seems the role of this mutation is less simple than was hitherto thought. The purposes of the study was to compare the prevalence of the CCR5-delta32 mutation in children with and without soJIA, to assess the association of this mutation with the severity of the disease and thus to evaluate its protective role., Methods: 234 children (193 of European origin, 25-Hispanic or Latino, 14-Afro-Americans, 3-of Asian origin) with soJIA living in the USA and in the Northwestern part of Russia were enrolled in the study. Genomic DNA was isolated from blood samples using QIAamp Mini Kit and amplified by PCR. The following oligonucleotide primers were used to detect CCR5 d32: CCR5- Δ32-F: 5'CTTCATTACACCTGCAGTC3', CCR5-Δ32-R: 5'TGAAGATAAGCCTCACAGCC3' by following condition: 95°-5'×1; 95°-15″→55°-15″→72°-60″×40; 72°-10'×3→4°-∞; the resulting PCR products were separated on 2% agarose gel by electrophoresis and visualized by Gel Doc XR Plus., Results: Mutation was revealed only in children of European origin. Though the prevalence of the heterozygous CCR5-delta32 mutation being 16% and 21% in the USA and in Russia correspondingly didn't excel from its prevalence in populations in total (10-18% for Northwestern Russia, Kofiady, 2008; 11,8%- for white American group, Downer et al, 2002), some laboratory and clinical signs of soJIA proved to be related to the mutation (see ). Heterozygous CCR5-delta32 genotype was associated with milder so-JIA course and predominance of the articular features over systemic. [Table: see text], Conclusion: The results of the study may be considered rather not supporting the idea of the protective role of the CCR5-delta32 mutation against soJIA, though the revealed associations-most of them related to the signs of the Macrophage Associated Syndrome-can be the basis for a more sophisticated research., (Copyright © 2014 by the American College of Rheumatology.)