Search

BACKGROUND: Oral cancer is a malignant tumor that usually occurs within the tissues of the mouth. This type of cancer mainly includes tumors in the lining of the mouth, tongue, lips, buccal mucosa and gums. Oral cancer is on the rise globally, especially in some specific risk groups. The early stage of oral cancer is usually asymptomatic, while the late stage may present with ulcers, lumps, bleeding, etc. OBJECTIVE: The objective of this paper is to propose an effective and accurate method for the identification and classification of oral cancer. METHODS: We applied two deep learning methods, CNN and Transformers. First, we propose a new CANet classification model for oral cancer, which uses attention mechanisms combined with neglected location information to explore the complex combination of attention mechanisms and deep networks, and fully tap the potential of attention mechanisms. Secondly, we design a classification model based on Swim transform. The image is segmented into a series of two-dimensional image blocks, which are then processed by multiple layers of conversion blocks. RESULTS: The proposed classification model was trained and predicted on Kaggle Oral Cancer Images Dataset, and satisfactory results were obtained. The average accuracy, sensitivity, specificity and F1-Socre of Swin transformer architecture are 94.95%, 95.37%, 95.52% and 94.66%, respectively. The average accuracy, sensitivity, specificity and F1-Score of CANet model were 97.00%, 97.82%, 97.82% and 96.61%, respectively. CONCLUSIONS: We studied different deep learning algorithms for oral cancer classification, including convolutional neural networks, converters, etc. Our Attention module in CANet leverages the benefits of channel attention to model the relationships between channels while encoding precise location information that captures the long-term dependencies of the network. The model achieves a high classification effect with an accuracy of 97.00%, which can be used in the automatic recognition and classification of oral cancer. [ABSTRACT FROM AUTHOR]

Acute kidney injury (AKI) is a syndrome characterized by an accelerating decrease in renal function in a short time. Thymol is one of the main components of thyme species and has a variety of pharmacological effects. Here, we investigated whether thymol could ameliorate rhabdomyolysis (RM)-induced AKI and its related mechanism. Glycerol was used to induce RM-associated AKI in rats. Rats received thymol (20 mg/kg/day or 40 mg/kg/day) gavage 24 h before glycerol injection until 72 h after injection daily. Kidney injury was identified by measuring serum creatinine (Scr) and urea levels and by H&E and PAS staining and immunohistochemistry (the expression of proliferating cell nuclear antigen (PCNA)). Renal superoxide dismutase (SOD), malondialdehyde (MDA), and oxidative stress-related Nrf2/HO-1 signaling pathways were measured. The expression of the inflammatory markers TNF-α, IL-6, MCP-1, and NF-κB was assessed by ELISA and western blotting. Finally, the expression of the PI3K/Akt signaling pathway was detected by western blotting. Glycerol administration induced obvious renal histologic damage and increased Scr, urea, and PCNA expression. Notably, thymol treatment attenuated these structural and functional changes and prevented renal oxidative stress, inflammatory damage and PI3K/Akt pathway downregulation associated with glycerol-induced AKI. In conclusion, thymol might have potential applications in the amelioration of AKI via its antioxidant and anti-inflammatory effects and upregulation of the PI3K/Akt signaling pathway. [ABSTRACT FROM AUTHOR]

Peritoneal fibrosis caused by long-term peritoneal dialysis (PD) is the main reason why patients withdraw from PD treatment. Lipid accumulation in the peritoneum was shown to participate in fibrosis, and klotho is a molecule involved in lipid metabolism. GSK343 (enhancer of zeste 2 polycomb repressive complex 2 subunit (EZH2) inhibitor) has been verified to inhibit epithelial mesenchymal transdifferentiation (EMT) and peritoneal fibrosis, but its related mechanism remains unclear. This study aimed to investigate whether lipid accumulation was involved in the effect of GSK343 and its related mechanism. First, the expression of EZH2, klotho and EMT indices in human peritoneal mesothelial cells (HMrSV5) incubated with high glucose (HG) levels was detected. After EZH2 was inhibited by GSK343, Western blot (WB), wound healing and Transwell assays were used to explore the effect of GSK343. EZH2 and klotho expression was also detected. Oil red O and Nile red staining and triglyceride (TG) detection kits were used to detect lipid accumulation. A rescue experiment with small interfering RNA specific for klotho (si-klotho) on the basis of GSK343 was also conducted to verify that GSK343 exerted its effect via klotho. In in vivo experiments, rats were administered GSK343, and the related index was assessed. In our study, we revealed that the expression of EZH2 was significantly upregulated and klotho was significantly downregulated in HMrSV5 cells induced by high glucose. With the aid of GSK343, we found that lipid deposition caused by HG was significantly decreased. In addition, EMT and fibrosis were also significantly alleviated. Moreover, GSK343 could also restore the downregulation of klotho. To further verify whether klotho mediated the effect of EZH2, a rescue experiment with si-klotho was also conducted. The results showed that si-klotho could counteract the protective effect of GSK343 on high glucose-induced lipid accumulation and fibrosis. In vivo experiments also revealed that GSK343 could relieve peritoneal fibrosis, lipid deposition and EMT by mitigating EZH2 and restoring klotho expression. Combining these findings, we found that EZH2 regulated lipid deposition, peritoneal fibrosis, and EMT mediated by klotho. To our knowledge, this is the first study to demonstrate the effect of the EZH2-klotho interaction on peritoneal fibrosis. Hence, EZH2 and klotho could act as potential targets for the treatment of peritoneal fibrosis. [ABSTRACT FROM AUTHOR]

Objectives: Oral squamous cell carcinoma (OSCC) is one of the most aggressive head and neck cancers with high incidence. Multiple studies have revealed that long non‐coding RNAs (lncRNAs) play pivotal roles in tumorigenesis. However, the role of long intergenic non‐protein coding RNA 664 (LINC00664) on the progression of OSCC was still unclear. Subjects and methods: In this study, the expression of LINC00664 in OSCC tissues and cell lines was detected by quantitative real‐time polymerase chain reaction (qRT‐PCR). The functional role of LINC0664 was estimated by cell counting kit‐8 (CCK‐8), transwell assays, Western blot in vitro, and xenograft tumor model in vivo. The regulatory mechanism was investigated by RNA‐binding protein immunoprecipitation (RIP), chromatin immunoprecipitation (ChIP), and luciferase reporter assays. Results: LINC00664 was found to be upregulated in OSCC tissues and cell lines and was associated with poor prognosis of OSCC patients. LINC00664 knockdown suppressed OSCC cell proliferation, migration, invasion, and epithelial‐mesenchymal transition (EMT). Moreover, Kruppel like factor 9 (KLF9) enhanced LINC00664 expression at transcription level. Interestingly, LINC00664 upregulated KLF9 expression by sponging miR‐411‐5p. In addition, knockdown of LINC00664 restrained tumor growth of OSCC in vivo. Conclusion: Our study identified the oncogenic roles of LINC00664 in OSCC tumorigenesis and EMT via KLF9/LINC00664/miR‐411‐5p/KLF9 feedback loop, which provides new perspectives of the potential therapeutic target for OSCC. [ABSTRACT FROM AUTHOR]

Background: Radiocephalic arteriovenous fistula (RCAVF) is the best access modality to be considered initially when planning arteriovenous fistula (AVF) for maintenance hemodialysis. Considering the higher incidence of RCAVF failed maturation (M), it is important to perform proper preoperative evaluation and identification of high-risk patients. There has been no study on the influence of preoperative cardiac function on the M and patency of AVFs. The purpose of this investigation is to determine whether preoperative cardiac index (CI) is a predictor of M and primary patency of RCAVF. Method: A total of 365 end-stage renal disease patients undergoing RCAVF surgery were consecutively enrolled with a median follow-up time of 20 months in this prospective cohort study. Demographics, vascular diameters measured by duplex ultrasound examination, and CI measured by echocardiography, were analyzed for effect on RCAVF primary functional M and primary patency. Result: Patients in the group achieving primary RCAVF functional M had a significantly larger mean CI than the group with early RCAVF failure (2.93 ± 0.77 vs. 3.57 ± 0.76 L/min/m2, p < 0.001). The receiver operating characteristic curve was plotted and demonstrated that preoperative vein diameter and CI can predict failure of RCAVF M. The AUC of CI was higher (0.745 vs. 0.666). Multivariate regression analysis, adjusted for age, sex, diabetes, preoperative dialysis status and vessel diameters, showed that decreased CI remained associated with increased risk of failure of M (FM) and worse primary unassisted patency. The Kaplan-Meier survival analysis suggested that patients with CI <3 L/min/m2 had a worse primary unassisted patency rate at all time points compared with patients with CI ≥3 L/min/m2. Conclusion: This study demonstrated that preoperative CI was associated with RCAVF M and long-term patency. A decreased CI may be a possible predictor of an increased risk of FM and a shorter primary patency time. [ABSTRACT FROM AUTHOR]

Transition metal dichalcogenide (TMD) dots exhibit excellent photoluminescence performance due to the quantum confinement effect and edge effect, and are extensively applied in electronic and optical devices, sensors, catalysis, and bioimaging. In this work, WS2 quantum dots (WS2 QDs) were prepared under a simple one-step hydrothermal method by optimizing the reaction conditions, and a quantum yield of 11.23% was achieved. The as-prepared WS2 QDs possess good photo-bleaching resistance, salt tolerance, and pH stability. The fluorescence investigations showed that the WS2 QDs acted as a highly efficient fluorescent sensor to detect hemoglobin (Hb) and cardiac biomarker myoglobin (Myo). The linear range was 1–600 μg/mL for Hb and 0.01–120 μg/mL for Myo, with detection limits as low as 260 and 7.6 ng/mL, respectively. Importantly, the WS2 QDs were used to determine the Hb/Myo content in human blood/serum samples, with satisfactory results, indicating that this technique holds promise for application in clinical diagnosis associated with Hb/Myo levels. To the best of our knowledge, this is the first example of TMD QDs without any modification as a fluorescent sensor for detecting Hb and Myo simultaneously. [ABSTRACT FROM AUTHOR]

[Display omitted] • The dehydrogenation reaction kinetic model for perhydro-benzyltoluene was proposed. • The effect of the intermediate H6-BT was considered for the first time. • The catalytic distillation dehydrogenation process of perhydro-benzyltoluene was simulated accurately. • The dehydrogenation process yielded an optimal degree of dehydrogenation value of 0.8. • There was an approximate 23.8% reduction in the unit cost at the optimal condition. Catalytic distillation is an effective and important technology for low-temperature dehydrogenation of perhydro-benzyltoluene (H12-BT). However, current researches have unfortunately failed to comprehensively understand the reaction and separation processes, hindering the broader application of catalytic distillation dehydrogenation technology. Therefore, in the study, a comprehensive dehydrogenation reaction kinetic model that accounts for the influence of the intermediate H6-BT was established firstly. Subsequently, the vapor–liquid equilibrium data for the binary systems H12-BT + H6-BT and H6-BT + H0-BT was estimated by utilizing the UNIFAC model, so as to obtain the azeotropes. By developing a modified catalytic distillation model, the catalytic distillation dehydrogenation process was examined. Our exploration revealed the existence of an optimal degree of dehydrogenation value, namely 0.8, within the catalytic distillation dehydrogenation process, yielding an approximate 23.8 % reduction in unit H 2 production cost in comparison to the fully dehydrogenation case. Our findings contribute valuable insights that have the potential to promote the overall development of the hydrogen energy economy. [ABSTRACT FROM AUTHOR]

Objective: To investigate the occurrence rate of the prelacrimal recess (PLR) and its medial bony wall dimensions based on the radiological analysis to help surgeons enhance the understanding of anatomic structures for the endoscopic prelacrimal recess approach. Methods: Cone-beam computed tomography images of 255 patients were evaluated retrospectively. The prevalence of the PLR in maxillary sinus was investigated and the thickness of its medial bony wall was measured and statistically assessed. Meanwhile, the width of the PLR was measured. The correlation between the width of the PLR and its medial bony wall thickness was assessed. The data were compared between the left side and right side, male and female. Results: The PLR was present in 82.5% of the maxillary sinus, with no significant differences between the left and right sides, as well as different gender groups. The mean thickness of the medial bony wall of the PLR was 2.84 ± 1.41 mm, without statistical difference between the left and right sides but significantly larger in males than in females. The mean width of the PLR was 4.62 ± 1.74 mm and it had a significant negative correlation with the thickness of the medial bony wall of the PLR. Conclusion: A large individual variation exists in the anatomy of PLR, including its prevalence and dimensions of its medial bony wall. When considering the intranasal endoscopic prelacrimal recess approach, the surgeons should carefully evaluate the anatomical structure of the PLR preoperatively so as to minimize the risks of surgical complications. [ABSTRACT FROM AUTHOR]

Keywords: citrus; Huanglongbing; viable CLas; pollen; distribution; cross-pollination; dissemination EN citrus Huanglongbing viable CLas pollen distribution cross-pollination dissemination 247 249 3 01/17/22 20220201 NES 220201 Huanglongbing (HLB), also known as citrus greening, is the most severe pandemics in citrus in more than 50 countries in Asia, Africa, and America, causing serious economic losses worldwide (Gottwald,2020 2020; Wang, 2019). The distribution of I C i Las in pollen grains and pollen tubes opened a new possible dissemination pathway through pollination which should be also taken into account for the integrated control of HLB. After cross-pollination, I C i Las were firstly detected on the stigma in 4 hpp, and then moved from stigma to stylet via pollen tubes. [Extracted from the article]

miRNA156 family members (miR156s) participate in regulating the transition of plant vegetative and reproductive growth, flower development, and formation of berry skin color by negatively modulating their target gene SPLs. However, the evolution and functional diversification of miR156s in plants remain elusive. Phylogenetic analysis on 310 miR156s from 51 plant species on miRBase 21.0 showed that only miR156a could be conserved in the 51 plant species, but their sequences exhibited variation; another set of miR156s, such as miR156m/n/o/p/q/r/s/t/u/v/w/x/y/z, was identified only in certain special plant species (Glycine max and Malus); also, all base variations in the sequences of 310 miR156s occurred within one miR156 seed sequence, "TGACAGAAGAGAGTGAGCAC," and the changed base sites were mainly located at the 11th and 14th bases from the 5′ end of the miR156 seed sequence, in which some base variations of miR156s resulted in a difference in miR156 targeting modes; by contrast, miR156 precursor sequences are highly divergent across diverse species. Similarly, cis-regulatory motifs on the promoter sequence of MIR156s in various plants also exhibited significant discrepancy. The intragenic MIR156 genes overlapped their target SBP genes, thereby suggesting that some microRNAs (miRNAs) originate from duplication of target genes. These traits might be the reasons of the conservation and diversification of miR156 gene family. This study identified the conserved seed sequence "TGACAGAAGAGAGTGAGCAC," and the sequence variation characterization, of miR156 family evolution, also investigated the varied traits of their promoters, precursors, and mature sequences in sequence evolutions and found some miRNAs might originate from duplication of target genes. Our findings will contribute to our understanding of the functional diversification of miRNAs and the interactions of miRNA/target pairs based on the evolutionary history of miRNA genes. [ABSTRACT FROM AUTHOR]

• Mass transport mechanism in samples with hierarchical pore structure was studied. • Surface and pore diffusivities increase with the rise of d meso / d macro at a fixed ε. • Higher ε results in greater increase of pore diffusivity than surface diffusivity. • Catalyst performance was improved by controlling crosslinker and porogen contents. Catalyst performance is highly relevant to its mass transport performance. In the present study, seven styrene-co-divinylbenzene polymer samples were synthesized by varying the amounts of crosslinker and porogen, so as to elucidate mass transport mechanism in poly (styrene-co-divinylbenzene) microspheres with hierarchical pore structure. Correspondingly, pore structure parameters of seven samples were characterized by BET and MIP. By choosing toluene as probe molecule, surface diffusion coefficient and pore diffusion coefficient of toluene inside the microspheres were measured. The experimental results indicated that both surface diffusion coefficient and pore diffusion coefficient increase with the rise of the ratio of average mesopore diameter to average macropore diameter under a certain porosity. Moreover, the rise of porosity results in greater enhancement of pore diffusion coefficient than surface diffusion coefficient. Finally, sulfonic acid groups were anchored onto polymer microspheres to investigate the relative importance of mass transport performance and catalytic performance by virtue of methyl acetate hydrolysis. [ABSTRACT FROM AUTHOR]

Thymol is one of the most important dietary constituents in the thyme species and has been shown to possess anti-inflammatory properties both in vivo and in vitro. We investigated the protective effects of thymol on the lipopolysaccharide (LPS)-induced inflammatory responses in the human peritoneal mesothelial cell line (HMrSV5) to clarify the potential mechanism. HMrSV5 cells were stimulated with LPS in the presence or absence of thymol. Our results showed that thymol markedly suppressed the production of cytokines such as tumour necrosis factor α (TNF-α), interleukin (IL)-6, monocyte chemoattractant protein 1 (MCP-1) and α-smooth muscle actin (α-SMA) in a dose-dependent manner. Western blot analysis indicated that RhoA and ROCK activation; Toll-like receptor 4 (TLR4) expression; and Nuclear factor -kappa B (NF-κB) p65, IKK and IκBα phosphorylation were also inhibited by thymol. Moreover, siRNA knockdown of RhoA suppressed the expression of pro-inflammatory cytokines and phosphorylation of NF-κB p65 and IκBα proteins in LPS-stimulated HMrSV5 cells, but did not affect TLR4 expression. In conclusion, thymol inhibits LPS-induced inflammation in HMrSV5 cells by suppressing TLR4-mediated RhoA-dependent NF-κB signalling pathway. Our study suggests that thymol may be a promising therapeutic agent against peritonitis. [ABSTRACT FROM AUTHOR]

Objective. Over decades, numerous inconsistent studies are reported on the relationship between soluble α-Klotho and renal function in patients with chronic kidney disease (CKD). This study aims to perform a meta-analysis to figure out the correlations between soluble α-Klotho and renal function in patients with CKD. Materials and Methods. We searched medical and scientific literature databases, PubMed and EMBASE (from the inception to October 2017), for publications that reported studies on associations between soluble α-Klotho and renal function in patients with CKD. Only publications in English were extracted. Summary correlation coefficient (r) values were extracted from each study, and 95% confidence intervals (CIs) were calculated. Publication bias was tested, and sensitivity and subgroup analyses were performed to investigate potential heterogeneity. Results. Of 611 studies, 9 publications with 1457 patients were included into the analysis. The following data were extracted from the literature: first author, year of publication, research region, research index, sample size, average age and Pearson or Spearman correlation coefficient, study design, the αKlotho/FGF23 assays utilized, full length, or the C-terminal fragment of FGF23. The pooled r between α-Klotho and estimated glomerular filtration rate (eGFR), FGF-23 were 0.35 (95%CI, 0.23~0.46, and P<0.05), -0.10 (95%CI, -0.19~-0.01, and P<0.05) with remarkable significance, indicating moderate heterogeneity. There was no significant heterogeneity between subgroups in analyses of α-Klotho and eGFR stratified by research region, mean age, and eGFR, but heterogeneity exists in analyses of α-Klotho and FGF-23 stratified by research region. There was no significant correlation between a-klotho and Ca and PTH and PHOS. There was no evidence of publication bias with Egger’s test (p=0.360) or with Begg’s test (p=0.902) and the distribution of funnel plots was symmetrical in all of our analysis. Conclusions. There exists a significant positive correlation between soluble α-Klotho and eGFR in patients with CKD. Also, a significant negative correlation between α-Klotho and FGF23 levels is proven. This raises hope to employ αKlotho and FGF23 as early biomarkers of CKD. However, further large prospective follow-up researches are needed to validate this hypothesis and to explore whether maintaining or elevating the Klotho level could improve renal function and complications in CKD patients. [ABSTRACT FROM AUTHOR]

A novel two-way coupling multi-scale model was proposed to investigate the catalytic distillation process. In the model, a microscopic model that focuses on the reactive performance of structure catalytic packing was used to calculate actual rate for catalytic distillation process, which is the basic parameter for process simulation. Furthermore, the traditional process simulation was used to provide proper boundary conditions for microscopic model. In order to validate the multi-scale model, heterogeneously catalyzed hydrolysis of methyl acetate was employed as a test system. The simulated final conversions of methyl acetate and catalyst layer efficiency factors were in good agreement with experimental results. The results indicated that as the equivalent diameter of catalyst layer decreases from 25.4 mm to 8.1 mm, the catalyst layer efficiency factor rises to 200% approximately. This study could provide a theoretical guide for the optimization of catalytic packing structure. [ABSTRACT FROM AUTHOR]

The upscaling process of multicomponent mass transfer and reaction in a rigid and homogeneous porous media was carried out using the method of volume averaging. The first-order reversible reaction which occurs at the solid-fluid interface was considered in this paper. The corresponding macroscopic governing equations were derived from the system dynamics at the pore scale. The effective coefficients were obtained by solving the associated closure problems. This study shows that if the backward reaction rate constant at the microscale is small enough, i.e. k - → 0 , the obtained upscaled model is in accordance with the macroscopic model derived from the first-order irreversible heterogeneous reaction case which was extensively investigated in the literature. The influence of reaction rates on the effective parameters in the macroscopic equations was also investigated. It has been found that both forward and backward reaction rates have significant influence on the effective diffusivities and effective reaction rates in the macroscopic equations. The established equations were successfully verified by the comparison of the direct numerical calculations. [ABSTRACT FROM AUTHOR]

• The efficiency factor that considers the catalyst layer structure was obtained. • A multi-scale and multi-objective model was proposed for catalytic distillation. • The parameters of column, and the structure of catalyst layer were optimized. This work aims to establishing a multi-scale and multi-objective optimization strategy for the catalytic distillation process. Firstly, the catalyst layer efficiency factor correlation that embraces the influence of the catalyst layer structure was obtained and then coupled with the process simulation to establish a multi-scale model for the catalytic distillation process. On this basis, genetic algorithm was employed to realize the multi-objective optimization. The hydrolysis process of methyl acetate in the reactive dividing wall column was investigated. The equipment parameters and operational conditions of the catalytic distillation column, and the structure parameters of the catalyst layer are optimized simultaneously. The results indicated that the minima of the total annual cost, the gas emission cost and the exergy loss decrease by 19.26%, 23.11% and 67.27%, respectively, by comparing with the counterparts obtained from the single-factor sensitivity analysis. Furthermore, the catalyst cost decreases by 30.88% per year. [ABSTRACT FROM AUTHOR]

Darwin's theory of evolution by natural selection is based on a sound understanding of the causes of variability and the mechanism of inheritance. Of all the causes which induce variability, Darwin believed that food was probably the most powerful. He not only held that the amount and nature of food could affect the characters of the future offspring through the reproductive system, but also accounted for the inheritance of such environmentally induced variations by his Pangenesis hypothesis. He proposed that cells could “throw off” numerous, minute molecules called gemmules, which were capable of diffusion from cell to cell, circulation throughout the body, modification by changed conditions of life (food, climate, etc.), aggregation in the reproductive organs, and transmission from parent to offspring. Now there is accumulating evidence that parental diets influence the health and disease of subsequent generations through epigenetic changes in germ cells. Two major underlying mechanisms are DNA methylation and RNA-mediated inheritance. A comparison of Darwin's imaginary gemmules with circulating cell-free DNA and mobile RNAs reveals intriguing similarities. It will be a fascinating episode in the history of science if Darwin's Pangenesis should eventually be rediscovered. [ABSTRACT FROM AUTHOR]

In this paper, an attempt has been made to extend the modified Buongiorno model of nanofluids originally proposed by Yang et al. (2013a, J. Heat Transf. , 135, 054504) from the continuum flow regime to the slip flow regime, in consideration of the effects of both velocity slip and temperature jump near the wall. Since the use of velocity slip boundary condition has been extensively applied and well-understood in the literature, the focus of the present study is on the temperature jump boundary condition. Based on the theoretical results obtained using the Runge–Kutta–Gill method, one can conclude that the temperature jump near the wall has more significant influence on the dimensionless temperature than the dimensionless velocity and volume fraction of nanoparticles in the cross section of a channel. Moreover, the neglect of temperature jump leads to the overestimation of Nusselt number based on the bulk mean nanofluid thermal conductivity Nu B , especially in the slip flow regime. Subsequently, two key parameters of nanofluids, namely Knudsen number Kn and the ratio of Brownian and thermophoretic diffusivities N BT , were discussed in order to investigate their effects on the fluid flow and heat transfer characteristics of nanofluids. The results indicated that the increase of Kn not only enhances heat transfer performance, but also reduces pressure drop, demonstrating the promising prospect of nanofluids applications in micro and nano-scales devices. Furthermore, it is found that the maximum Nu B can be achieved when Kn is around 0.07 or when N BT is around 0.5, which is useful for optimizing nanoparticles for practical applications. [ABSTRACT FROM AUTHOR]

The present paper aims at an upscaled description of solute concentration transport processes in countercurrent dialyzer systems by means of a porous media approach based on the volume averaging theory. In consideration of solute diffusion and ultrafiltration processes, a general set of upscaled solute concentration transport equations has been derived for the three phases in a hollow fiber dialyzer, namely, the blood, membrane and dialysate phases. Moreover, the corresponding closure problems, which can be solved to obtain the effective properties in the upscaled model, are proposed. For the one-dimensional case, analytical expressions of solute concentrations in both blood and dialysate phases are achieved, so as to elucidate the influences of ultrafiltration flow rate and distribution coefficient on both clearance enhancement and solute concentration variations along the length of dialyzer. The results show that both ultrafiltration flow rate and distribution coefficient have no significant effects on solute concentration variations along the length of dialyzer. Nevertheless, the clearance enhancement are found to have linear relationship with both ultrafiltration flow rate and distribution coefficient. [ABSTRACT FROM AUTHOR]

Micro RNAs (mi RNAs) are small noncoding RNAs participating in versatile biological processes via post-transcriptionally gene regulation. However, how mi RNAs are modified or degraded remains unknown, despite years of studies have unravelled much details of mi RNA biogenesis and function. Here, we systematically investigated mi RNA modification using six small RNA sequencing libraries generated from cotton seedling as well as cotton fibre at five developmental stages. Our results show that 1-2-nt truncation and addition on both 5′ and 3′ ends of mi RNAs are the major modification forms. The 5′ and 3′ end mi RNA modification was almost equal in the six development stages. Truncation was more common than addition on both 5′ and 3′ end. Structure analysis of the 5′ and 3′ ends of mi RNAs and isomiRs shows that uridine is the preferential nucleotide at the first position of both 5′ and 3′ ends. According to analysis of nucleotides truncated and tailed from mi RNAs, both mi RNAs and isomiRs share a similar positional structure distribution at their 5′ and 3′ ends, respectively. Furthermore, opposite to previous reports, cytodine is more frequently truncated and tailed from the two ends of isomiRs, implying existence of a complex cytodine balance in isomiRs. Comparison of isomiR expression shows differential mi RNA modification amongst the six developmental stages in terms of selective modification form, development-dependent modification and differential expression abundance. Our results globally uncovered mi RNA modification features in cotton, which could contribute us to understanding mi RNA's postmature modification and its regulatory function. [ABSTRACT FROM AUTHOR]

A total of 155 drought/salinity-responsive miRNAs were identified in cotton; many of them target important stress-related genes, including APS, SOD, NAC, MYB, and MAPK, that are regulated upon abiotic stress.Drought and salinity are two major environmental factors adversely affecting plant growth and productivity. However, the regulatory mechanism is unknown. In this study, the potential roles of small regulatory microRNAs (miRNAs) in cotton response to those stresses were investigated. Using next-generation deep sequencing, a total of 337 miRNAs with precursors were identified, comprising 289 known miRNAs and 48 novel miRNAs. Of these miRNAs, 155 miRNAs were expressed differentially. Target prediction, Gene Ontology (GO)-based functional classification, and Kyoto Encyclopedia of Genes and Genomes (KEGG)-based functional enrichment show that these miRNAs might play roles in response to salinity and drought stresses through targeting a series of stress-related genes. Degradome sequencing analysis showed that at least 55 predicted target genes were further validated to be regulated by 60 miRNAs. CitationRank-based literature mining was employed to determinhe the importance of genes related to drought and salinity stress. The NAC, MYB, and MAPK families were ranked top under the context of drought and salinity, indicating their important roles for the plant to combat drought and salinity stress. According to target prediction, a series of cotton miRNAs are associated with these top-ranked genes, including miR164, miR172, miR396, miR1520, miR6158, ghr-n24, ghr-n56, and ghr-n59. Interestingly, 163 cotton miRNAs were also identified to target 210 genes that are important in fibre development. These results will contribute to cotton stress-resistant breeding as well as understanding fibre development. [ABSTRACT FROM AUTHOR]

MicroRNAs (miRNAs) are an extensive class of newly discovered endogenous small RNAs, which negatively regulate gene expression at the post-transcription levels. As the application of next-generation deep sequencing and advanced bioinformatics, the miRNA-related study has been expended to non-model plant species and the number of identified miRNAs has dramatically increased in the past years. miRNAs play a critical role in almost all biological and metabolic processes, and provide a unique strategy for plant improvement. Here, we first briefly review the discovery, history, and biogenesis of miRNAs, then focus more on the application of miRNAs on plant breeding and the future directions. Increased plant biomass through controlling plant development and phase change has been one achievement for miRNA-based biotechnology; plant tolerance to abiotic and biotic stress was also significantly enhanced by regulating the expression of an individual miRNA. Both endogenous and artificial miRNAs may serve as important tools for plant improvement. J. Cell. Physiol. 229: 1-15, 2014. © 2014 Wiley Periodicals, Inc. [ABSTRACT FROM AUTHOR]

• The rise of alkyl chain length led to different trend of mass transfer enhancement. • Biggest mass transfer enhancement by 36.8% was obtained under the C4H9 alkyl chain. • Interfacial mass transfer enhancement mechanisms by JNPs were elucidated. • Solute diffusion behaviors and molecule interaction energy are main mechanisms. Janus nanoparticles (JNPs) have drawn significant attention due to their unique surfaces with dual character. Herein, molecular dynamics simulation was conducted to investigate the molecular transfer characteristics across the hexane/water interface with amphiphilic JNPs, to elucidate the interfacial mass transfer enhancement mechanisms. The results manifested that the enhancement by JNPs first increases and then decreases with the rise of alkyl chain length, which is up to the biggest improvement under the C 4 H 9 alkyl chain (JNPs-4). The enhancement can be ascribed to the competitive balance between solute diffusion behaviors and molecule interaction energy. The self-diffusion coefficient of solute and the interaction between the solute and oil phases decreases, while the interaction between the solute and water phases increases with the rise of alky chain length. Moreover, maximum enhancement can be obtained by 5 vol% concentration JNPs-4 with 13.4 Å particle diameter, in which the mass transfer resistance is reduced by 36.8%. [ABSTRACT FROM AUTHOR]

Abstract: Reference genes are critical for normalization of the gene expression level of target genes. The widely used housekeeping genes may change their expression levels at different tissue under different treatment or stress conditions. Therefore, systematical evaluation on the housekeeping genes is required for gene expression analysis. Up to date, no work was performed to evaluate the housekeeping genes in cotton under stress treatment. In this study, we chose 10 housekeeping genes to systematically assess their expression levels at two different tissues (leaves and roots) under two different abiotic stresses (salt and drought) with three different concentrations. Our results show that there is no best reference gene for all tissues at all stress conditions. The reliable reference gene should be selected based on a specific condition. For example, under salt stress, UBQ7, GAPDH and EF1A8 are better reference genes in leaves; TUA10, UBQ7, CYP1, GAPDH and EF1A8 were better in roots. Under drought stress, UBQ7, EF1A8, TUA10, and GAPDH showed less variety of expression level in leaves and roots. Thus, it is better to identify reliable reference genes first before performing any gene expression analysis. However, using a combination of housekeeping genes as reference gene may provide a new strategy for normalization of gene expression. In this study, we found that combination of four housekeeping genes worked well as reference genes under all the stress conditions. [Copyright &y& Elsevier]

Abstract: MicroRNAs (miRNAs) are an important gene regulator, controlling almost all biological and metabolic processes, in both plants and animals. In this study, we investigated the effect of drought and salinity stress on the expression of miRNAs and their targets in cotton (Gossypium hirsutum L.). Our results show that the expression change of miRNAs and their targets were dose-dependent and tissue-dependent under salinity and drought conditions. The expression of miRNAs in leaf was down-regulated under higher salinity stress while shows variable patterns in other conditions. The highest fold-changes of miRNAs were miR398 in roots with 28.9 fold down-regulation under 0.25% NaCl treatment and miR395 in leaves with 7.6 fold down-regulation under 1% PEG treatment. The highest up-regulation of miRNA targets was AST in roots with 4.7 fold-change under 2.5% PEG and the gene with highest down-regulation was CUC1 in leaves with 25.6 fold-change under 0.25% NaCl treatment. Among seven miRNA-target pairs we studied, five pairs, miR156–SPL2, miR162–DCL1, miR159–TCP3, miR395–APS1 and miR396–GRF1, show significant regulation relationship in roots and leaves under salinity stress concentration. [Copyright &y& Elsevier]

The total proteins of four strawberry cultivars with differing resistance and/or susceptibility to grey mould were extracted by two different methods, phenol and sodium dodecyl sulphate (SDS). Compared to phenol extraction, SDS extraction produced higher protein yields but poor quality protein bands with a high degree of streaking indicating possible contamination. In contrast, the total proteins obtained by phenol extraction could be used in two-dimensional polyacrylamide gel electrophoresis (2-DE) because of their higher quality, and the protein spots were well separated for all tested genotypes. From all the cultivars studied in this research, we obtained 89 differential (unmatched) protein spots that may be related to fruit disease resistance or susceptibility. Using the SPSS 11.0 software, we obtained a cluster of the four strawberry cultivars. The cultivars “APF029-4” and “SJ8976-1” were in the same subcluster with the highest Pearson correlation coefficient (0.705). Afterwards, they were amalgamated into the second group with “Joliette”, a disease-resistant cultivar, which means that they might have a similar resistance to grey mould. [ABSTRACT FROM AUTHOR]

The agronomic characteristics and chemical composition of seven advanced day-neutral strawberry lines and a commercial cultivar 'Seascape' were evaluated for their horticulture and quality attributes. The results showed that the advanced strawberry lines had the best horticultural characteristics, such as more resistance to diseases, less weight and juice losses and better fruit glossiness during storage, compared to 'Seascape'. Among the advanced lines, FIN005-55 had the better fruit quality with higher soluble solids content (SSC)/titratable acidity (TA) ratio and highest SSC, FIN005-7 had the highest total phenolic content (TPC) and antioxidant capacity (AC), and both had potential for commercial trials. [ABSTRACT FROM AUTHOR]

Abstract: No study has been performed on identifying microRNAs (miRNAs) and their targets in cotton although cotton is one of the most important fiber and economic crops around the world. In this study, we found 30 potential cotton miRNAs using a comparative genomic approach based on genomic survey sequence analysis and miRNA secondary structure. These cotton miRNAs belong to 22 miRNA families. Expressed sequence tag (EST) analysis indicated that the predicted miRNAs were expressed in cotton plants. Based on the characteristic that miRNAs exhibit perfect or nearly perfect complementarity with their targeted mRNA sequences, a total of 139 potential miRNA targets were identified in cotton genome. A majority of these targets belong to transcriptional factors which regulate cotton growth and development, including leaf, root, stem, flower, and even fiber development. Those miRNAs may also be involved in other cellular and metabolic processes, such as stress response, signal transduction, and secondary wall synthesis and deposition. Some of the newly identified miRNA targets may be unique to cotton species. In this study, we found that at least 3 miRNA families (miR 396, 414, and 782) target callous synthase, fiber protein Fb23, and fiber quinone-oxidoreductase, suggesting that miRNAs play an important role in cotton fiber differentiation and development. [Copyright &y& Elsevier]

microRNAs (miRNAs) are an abundant class of newly identified endogenous non-protein-coding small RNAs. They exist in animals, plants, and viruses, and play an important role in gene silencing. Translational repression, mRNA cleavage, and mRNA decay initiated by miRNA-directed deadenylation of targeted mRNAs are three mechanisms of miRNA-guided gene regulation at the post-transcriptional levels. Many miRNAs are highly conserved in animals and plants, suggesting that they play an essential function in plants and animals. Lots of investigations indicate that miRNAs are involved in multiple biological processes, including stem cell differentiation, organ development, phase change, signaling, disease, cancer, and response to biotic and abiotic environmental stresses. This review provides a general background and current advance on the discovery, history, biogenesis, genomics, mechanisms, and functions of miRNAs. J. Cell. Physiol. 210: 279–289, 2007. © 2006 Wiley-Liss, Inc. [ABSTRACT FROM AUTHOR]

Diabetic nephropathy (DN), an important complication of diabetic microvascular disease, is one of the leading causes of end-stage renal disease (ESRD), which brings heavy burdens to the whole society. Podocytes are terminally differentiated glomerular cells, which act as a pivotal component of glomerular filtration barrier. When podocytes are injured, glomerular filtration barrier is damaged, and proteinuria would occur. Dysfunction of podocytes contributes to DN. And degrees of podocyte injury influence prognosis of DN. Growing evidences have shown that epigenetics does a lot in the evolvement of podocyte injury. Epigenetics includes DNA methylation, histone modification, and non-coding RNA. Among them, histone modification plays an indelible role. Histone modification includes histone methylation, histone acetylation, and other modifications such as histone phosphorylation, histone ubiquitination, histone ADP-ribosylation, histone crotonylation, and histone β-hydroxybutyrylation. It can affect chromatin structure and regulate gene transcription to exert its function. This review is to summarize documents about pathogenesis of podocyte injury, most importantly, histone modification of podocyte injury in DN recently to provide new ideas for further molecular research, diagnosis, and treatment. [ABSTRACT FROM AUTHOR]

• A multiphase flow and multicomponent reactive transport model was proposed. • Direct hydration of cyclohexene during reactive distillation process was studied. • Structural parameters of catalyst layer have trivial effect on efficiency factor. • Physical parameters of two-phase fluid affect the two-phase distribution highly. • A technical guide for the process-specific catalytic packing design is provided. Reactive distillation is an important intensification technology to overcome the unfavorable equilibrium conversion for the direct hydration of cyclohexene. In this work, a multiphase flow and multicomponent reactive transport model in the catalyst layer was established. By virtue of the model, the influences of structural parameters of the catalyst layer, physical parameters of two-phase fluid and reaction conditions on the catalyst layer efficiency factor were investigated. It was found that physical parameters of two-phase fluid can influence the two-phase distribution, thus affecting the catalyst layer efficiency factor. The catalyst layer efficiency factor decreases slightly with the rise of solubilities of cyclohexene and cyclohexanol, although concentration of cyclohexanol and reaction conversion can be improved by the addition of co-solvents. Furthermore, it was found that the catalyst layer efficiency factor is independent on structural parameters approximately. Therefore, the design of process-specific catalytic packings has remarkable difference between miscible and immiscible reaction systems. [ABSTRACT FROM AUTHOR]

Inflammation and fibrosis in peritoneal mesothelial cells caused by long-term peritoneal dialysis (PD) are the main reasons why patients withdraw from peritoneal dialysis treatment. However, the related mechanism is still unclear. In the current study, we revealed that the expression of EZH2 was positively related to EMT and fibrosis in an in vitro model using human peritoneal mesothelial cells (HPMCs) stimulated with high glucose. Moreover, EZH2 also exhibited a positive correlation with HIF-1α expression. Using an sh-RNA lentivirus specific to EZH2, the EZH2 inhibitor GSK343 and rescue experiments of HIF-1α, we showed that EZH2 was an inducer of inflammation and fibrosis mediated by HIF-1α. Mechanistically, we revealed that on the one hand, EZH2 could increase the trimethylation of H3K4 at the HIF-1α gene promoter and directly activate HIF-1α transcription, as demonstrated by co-IP and ChIP-RT-PCR experiments. On the other hand, we verified that EZH2 could increase the trimethylation of H3K27 at the miR-142 gene promoter, which repressed the expression of miR-142. Combining bioanalysis and dual-luciferase assays, we found that miR-142 could regulate HIF-1α expression by directly binding to its mRNA 3′-UTR. Inhibition of miR-142 could rescue the protective effect of GSK343 on inflammation and fibrosis. In conclusion, our current study revealed that EZH2 plays a vital role in peritoneal fibrosis mediated by HIF-1α and related mechanisms. To our knowledge, this is the first study to demonstrate the effect of the EZH2-HIF-1α interaction and miR-142 on peritoneal fibrosis and inflammation and to suggest EZH2 and miR-142 as potential targets for the treatment of peritoneal fibrosis in patients with PD. [ABSTRACT FROM AUTHOR]

• Vapor-liquid mass transfer layer performance was studied by the tracer method. • Mass transfer coefficients that consider four structure parameters were obtained. • The correlations of mass transfer coefficients exhibit good universality. • The correlations were used for the structure optimization of mass transfer layer. In order to implement the multi-scale model to optimize the structure of vapor-liquid mass transfer layer, vapor and liquid mass transfer coefficients that embrace the effects of structure parameters of mass transfer layer should be obtained in advance. In the study, the influences of four structure parameters on mass transfer performance were studied by the tracer method. Moreover, the corresponding mass transfer coefficients were correlated. By comparing with the experimental data of different types of structured catalytic packings, it has been found that the correlations exhibit good universality. Furthermore, the correlations were applied to the non-equilibrium model for the hydrolysis of methyl acetate (MA), so as to investigate the influences of four structure parameters on catalytic distillation process. The results indicated that wavy height and the area ratio of mass transfer layer to catalyst layer have more significant influences on the conversion of MA than inclined angle and base length. [ABSTRACT FROM AUTHOR]

3D flow field design usually improves the performance of proton exchange membrane fuel cell (PEMFC) with the penalty of a dramatically increasing pressure drop. To surmount this issue, a novel windward bend flow field that exhibits superior mass transfer performance under a constant pumping power is proposed in this study. The performance of PEMFC with windward bend flow field is numerically compared with two canonical 3D flow fields, namely 3D wave flow field and cutting cylindrical baffles flow field. Results demonstrated that compared with two canonical 3D flow fields, windward bend flow field gets a better water management capability. The optimal distance, tilt angle and direction for the windward bend structure embedded in channel are 2.0 mm, 15° (at the direction of the front section of the windward bend structure tilts towards membrane electrode assembly). Furthermore, the average enhancement rate of the maximum power density of PEMFC with optimal windward bend flow field is 7.6 % and 12.4 % compared with cutting cylindrical baffles flow field and 3D wave flow field owing to the larger Sherwood number of optimal windward bend flow field under the specified pumping power range. • A novel windward bend flow field was proposed and compared with two 3D flow fields. • Windward bend flow field obtains better water management. • Structure parameters of windward bend flow field were optimized. • Optimal flow field exhibits higher performance under the specified pumping power. • Sherwood number of optimal flow field is 1.23 and 1.52 times of two 3D flow fields. [ABSTRACT FROM AUTHOR]

Diabetic nephropathy (DN), one of the more prevalent microvascular complications in patients diagnosed with diabetes mellitus, is attributed as the main cause of end-stage renal disease (ESRD). Lipotoxicity in podocytes caused by hyperglycemia has been recognised as a significant pathology change, resulting in the deterioration of the glomerular filtration barrier. Research has demonstrated how dapagliflozin, a kind of SGLT2i, exhibits a multifaceted and powerful protective effect in DN, entirely independent of the hypoglycemic effect, with the specific mechanism verified. In this present study, we found that dapagliflozin has the potential to alleviate apoptosis and restore cytoskeleton triggered by high glucose (HG) in vivo and in vitro. We also discovered that dapagliflozin could mitigate podocyte cholesterol accumulation by restoring the expression of ABCA1, which is the key pathway for cholesterol outflows. This research also mechanistically demonstrates that the protective effect of dapagliflozin can be mediated by KLF-5, which is the upstream transcription factor of ABCA1. Taken together, our data suggest that dapagliflozin offers significant potential in alleviating podocyte injury and cholesterol accumulation triggered by high glucose. In terms of the mechanism, we herein reveal that dapagliflozin could accelerate cholesterol efflux by restoring the expression of ABCA1, which is directly regulated by KLF-5. [ABSTRACT FROM AUTHOR]

High yield has always been an essential target in almost all of the cotton breeding programs. Boll weight (BW) is a key component of cotton yield. Numerous linkage mapping and genome-wide association studies (GWAS) have been performed to understand the genetic mechanism of BW, but information on the markers/genes controlling BW remains limited. In this study, we conducted a GWAS for BW using 51,268 high-quality single-nucleotide polymorphisms (SNPs) and 189 Gossypium hirsutum accessions across five different environments. A total of 55 SNPs significantly associated with BW were detected, of which 29 and 26 were distributed in the A and D subgenomes, respectively. Five SNPs were simultaneously detected in two environments. For TM5655, TM8662, TM36371, and TM50258, the BW grouped by alleles of each SNP was significantly different. The ± 550 kb regions around these four key SNPs contained 262 genes. Of them, Gh_A02G1473, Gh_A10G1765, and Gh_A02G1442 were expressed highly at 0 to 1 days post-anthesis (dpa), − 3 to 0 dpa, and − 3 to 0 dpa in ovule of TM-1, respectively. They were presumed as the candidate genes for fiber cell differentiation, initiation, or elongation based on gene annotation of their homologs. Overall, these results supplemented valuable information for dissecting the genetic architecture of BW and might help to improve cotton yield through molecular marker-assisted selection breeding and molecular design breeding. [ABSTRACT FROM AUTHOR]

Background: The intranasal endoscopic prelacrimal recess approach (PLRA) to the maxillary sinus (MS) has been reported to treat many MS and skull base diseases. However, previous studies revealed that the width of the prelacrimal recess (PLR) shows a large individual variation. The purpose of this study was to ascertain the prevalence of the PLR in MS according to gender and age. Methods: A series of 701 maxillofacial cone beam computed tomography (CBCT) scans from adult patients were analyzed retrospectively. Patients were divided into five age groups (18–24 years, 25–34 years, 35–44 years, 45–54 years, and ≥ 55 years) and by sex. The frequencies of occurrence of the PLR in the MS were calculated and compared. Results: According to the findings obtained from our study, PLR was present in 81.5% of maxillary sinuses. No differences were found when the data distributions of right and left sides were compared. For individuals, the right and left sides were not always symmetrical. The probability of PLR was lesser among women than among men, but this differences was not significant. Another finding of our study was that the percentage of PLR decreased with increasing age among patients aged < 55 years, however, increased again among patients aged ≥ 55 years. Conclusion: The anatomy of PLR varies among individuals. Careful analysis of individual anatomical structure characteristic is recommended when considering intranasal endoscopic PLRA to the MS. Besides, the age variation of PLR should be considered in order to avoid complications. [ABSTRACT FROM AUTHOR]

Summary: The diploid wild cotton species Gossypium australe possesses excellent traits including resistance to disease and delayed gland morphogenesis, and has been successfully used for distant breeding programmes to incorporate disease resistance traits into domesticated cotton. Here, we sequenced the G. australe genome by integrating PacBio, Illumina short read, BioNano (DLS) and Hi‐C technologies, and acquired a high‐quality reference genome with a contig N50 of 1.83 Mb and a scaffold N50 of 143.60 Mb. We found that 73.5% of the G. australe genome is composed of various repeat sequences, differing from those of G. arboreum (85.39%), G. hirsutum (69.86%) and G. barbadense (69.83%). The G. australe genome showed closer collinear relationships with the genome of G. arboreum than G. raimondii and has undergone less extensive genome reorganization than the G. arboreum genome. Selection signature and transcriptomics analyses implicated multiple genes in disease resistance responses, including GauCCD7 and GauCBP1, and experiments revealed induction of both genes by Verticillium dahliae and by the plant hormones strigolactone (GR24), salicylic acid (SA) and methyl jasmonate (MeJA). Experiments using a Verticillium‐resistant domesticated G. barbadense cultivar confirmed that knockdown of the homologues of these genes caused a significant reduction in resistance against Verticillium dahliae. Moreover, knockdown of a newly identified gland‐associated gene GauGRAS1 caused a glandless phenotype in partial tissues using G. australe. The G. australe genome represents a valuable resource for cotton research and distant relative breeding as well as for understanding the evolutionary history of crop genomes. [ABSTRACT FROM AUTHOR]

Key message: In total, 17 QTLs for lint percentage in short-season cotton, including three stable QTLs, were detected. Twenty-eight differentially expressed genes located within the stable QTLs were identified, and two genes were validated by qRT-PCR. The breeding and use of short-season cotton have significant values in addressing the question of occupying farmlands with either cotton or cereals. However, the fiber yields of short-season cotton varieties are significantly lower than those of middle- and late-maturing varieties. How to effectively improve the fiber yield of short-season cotton has become a focus of cotton research. Here, a high-density genetic map was constructed using genome resequencing and an RIL population generated from the hybridization of two short-season cotton accessions, Dong3 and Dong4. The map contained 4960 bin markers across the 26 cotton chromosomes and spanned 3971.08 cM, with an average distance of 0.80 cM between adjacent markers. Based on the genetic map, quantitative trait locus (QTL) mapping for lint percentage (LP, %), an important yield component trait, was performed. In total, 17 QTLs for LP, including three stable QTLs, qLP-A02, qLP-D04, and qLP-D12, were detected. Three out of 11 non-redundant QTLs overlapped with previously reported QTLs, whereas the other eight were novel QTLs. A total of 28 differentially expressed genes associated with the three stable QTLs were identified using RNA-seq of ovules and fibers at different seed developmental stages from the parental materials. The two genes, Ghir_A02G017640 and Ghir_A02G018500, may be related to LP as determined by further qRT-PCR validation. This study provides useful information for the genetic dissection of LP and promotes the molecular breeding of short-season cotton. [ABSTRACT FROM AUTHOR]

Lint percentage is one of the most essential yield components and an important economic index for cotton planting. Improving lint percentage is an effective way to achieve high-yield in cotton breeding worldwide, especially upland cotton (Gossypium hirsutum L.). However, the genetic basis controlling lint percentage has not yet been systematically understood. Here, we performed a genome-wide association mapping for lint percentage using a natural population consisting of 189 G. hirsutum accessions (188 accessions of G. hirsutum races and one cultivar TM-1). The results showed that 274 single-nucleotide polymorphisms (SNPs) significantly associated with lint percentage were detected, and they were distributed on 24 chromosomes. Forty-five SNPs were detected at least by two models or at least in two environments, and their 5 Mb up- and downstream regions included 584 makers related to lint percentage identified in previous studies. In total, 11 out of 45 SNPs were detected at least in two environments, and their 550 Kb up- and downstream region contained 335 genes. Through RNA sequencing, gene annotation, qRT-PCR, protein–protein interaction analysis, the cis-elements of the promotor region, and related miRNA prediction, Gh_D12G0934 and Gh_A08G0526 were selected as key candidate genes for fiber initiation and elongation, respectively. These excavated SNPs and candidate genes could supplement marker and gene information for deciphering the genetic basis of lint percentage and facilitate high-yield breeding programs of G. hirsutum ultimately. [ABSTRACT FROM AUTHOR]

Sedoheptulose-1,7-bisphosphatase (SBPase, EC 3.1.3.37) is a key enzyme in the plant Calvin cycle and one of the main rate-limiting enzymes in the plant photosynthesis pathway. Many studies have demonstrated that the SBPase gene plays an important role in plant photosynthetic efficiency, yield, and stress responses; however, few studies have been conducted on the function and expression of the GhSBPase gene in upland cotton. In this study, our results showed that the coding sequence (CDS) of GhSBPase gene was 1182 bp, encoding a protein with 393 amino acids. The GhSBPase protein had adenosine monophosphate (AMP) binding site and a FIG (FBPase/IMPase/glpX) domain, and had six Cys residues and a CGGT(A/Q)C motif that were involved in redox regulation in plants. Evolutionarily, the GhSBPase protein clustered into the dicotyledon subgroup and was most closely related to the tomato SlSBPase protein. Western-blot analysis further indicated that the GhSBPase gene was indeed the gene encoding the SBPase protein in upland cotton. The GhSBPase protein was localized in chloroplast, which was consistent with its function as a key enzyme in photosynthesis. The GhSBPase gene was specifically highly expressed in leaves, and its expression level was significantly lower in a yellow-green leaf mutant than in the wild type. Moreover, the GhSBPase expression was in response to drought, salt, high- and low-temperature stress, and exhibits different expression patterns. The GhSBPase promoter had the cis-acting elements in response to abiotic stress, phytohormone, and light. In addition, the GhSBPase expression was positively correlated with the chlorophyll fluorescence parameters, suggesting that changes in the expression of the GhSBPase had potential applicability in breeding for enhanced cotton photosynthetic efficiency. These results will help to understand the function of the GhSBPase gene in photosynthesis and the adaptability of plants to external stress and provide important gene information for the high-yield breeding of crops in the future. [ABSTRACT FROM AUTHOR]

Cotton is one of the most important economic and fiber crops in the world. KNOX is one class of universal transcription factors, which plays important roles in plant growth and development as well as response to different stresses. Although there are many researches on KNOXs in other plant species, there are few reports on cotton. In this study, we systematically and comprehensively identified all KNOX genes in upland cotton and its two ancestral species; we also studied their functions by employing RNA-seq analysis and virus-induced gene silence (VIGS). A total of 89 KNOX genes were identified from three cotton species. Among them, 44 were from upland cotton, 22 and 23 were found in its ancestral species G. raimondii and G. arboreum , respectively. Plant polyploidization and domestication play a selective force driving KNOX gene evolution. Phylogenetic analysis displayed that KNOX genes were evolved into three Classes. The intron length and exon number differed in each Class. Transcriptome data showed that KNOX genes of Class II were widely expressed in multiple tissues, including fiber. The majority of KNOX genes were induced by different abiotic stresses. Additionally, we found multiple cis -elements related to stress in the promoter region of KNOX genes. VIGS silence of GhKNOX4-A and GhKNOX22-D genes showed significant growth and development effect in cotton seedlings under salt and drought treatments. Both GhKNOX4-A and GhKNOX22-D regulated plant tolerance; silencing both genes induced oxidative stresses, evidenced by reduced SOD activity and induced leave cell death, and also enhanced stomatal open and water loss. Thus, GhKNOX4-A and GhKNOX22-D may contribute to drought response by regulating stomata opening and oxidative stresses. • A total of 89 KNOX genes were identified from upland cotton and its two ancestral species • Plant polyploidization and domestication play a selective force driving KNOX gene evolution • VIGS silence of GhKNOX4-A Gh and GhKNOX22-D genes showed significant growth and development effect in cotton seedlings under salt and drought treatment • Silencing GhKNOX4-A and GhKNOX22-D induced oxidative and abiotic stresses • GhKNOX4-A and GhKNOX22-D may contribute to drought response by regulating stomata opening and oxidative stresses [ABSTRACT FROM AUTHOR]

CIPK (calcineurin B-like-interacting protein kinase) is a kind of serine/threonine protein kinase widely existing in plants, and it plays an important role in plant growth and development and stress response. To better understand the biological functions of the GhCIPK23 gene in upland cotton, the coding sequence (CDS) of the GhCIPK23 gene was cloned in upland cotton, and its protein sequence, evolutionary relationship, subcellular localization, expression pattern and cis-acting elements in the promoter region were analyzed. Our results showed that the full-length CDS of GhCIPK23 was 1368 bp, encoding a protein with 455 amino acids. The molecular weight and isoelectric point of this protein were 50.83 KDa and 8.94, respectively. The GhCIPK23 protein contained a conserved N-terminal protein kinase domain and C-terminal regulatory domain of the CIPK gene family member. Phylogenetic tree analysis demonstrated that GhCIPK23 had a close relationship with AtCIPK23, followed by OsCIPK23, and belonged to Group A with AtCIPK23 and OsCIPK23. The subcellular localization experiment indicated that GhCIPK23 was located in the plasma membrane. Tissue expression analysis showed that GhCIPK23 had the highest expression in petals, followed by sepals, and the lowest in fibers. Stress expression analysis showed that the expression of the GhCIPK23 gene was in response to drought, salt, low-temperature and exogenous abscisic acid (ABA) treatment, and had different expression patterns under different stress conditions. Further cis-acting elements analysis showed that the GhCIPK23 promoter region had cis-acting elements in response to abiotic stress, phytohormones and light. These results established a foundation for understanding the function of GhCIPK23 and breeding varieties with high-stress tolerance in cotton. [ABSTRACT FROM AUTHOR]

[Display omitted] • Ru/NC (PVP) with uniform Ru particles were fabricated by the polyol reduction method. • Catalytic hydrotreatment of PLs were carried out under both mild and deep conditions. • Ru/NC (PVP) with PVP as the protective agent showed better performance. • The H/C ratios of the product oils from both mild and deep conditions are the highest. • The MCRT values of the product oils from both mild and deep conditions are the lowest. Catalytic hydrotreatment is one of the promising routes for upgrading pyrolysis liquids (PLs) to intermediates that can be co-fed with vacuum gas oil for FCC refinery. Among all the factors, catalysts are always crucial in catalytic hydrotreatment of PLs as hydrogenation and repolymerization reactions occur in parallel. Therefore, catalysts with sufficient hydrogenation activity are generally required to enhance the hydrogenation reaction and to inhibit the repolymerization reaction of the thermally liable compounds in PLs. Among all noble metal catalysts tested, Ru/C catalysts showed a better performance than other catalysts in terms of the oil yield and deoxygenation level. However, a clear repolymerization was observed during catalytic hydrotreatment of PLs using Ru/C catalysts, especially during mild hydrotreatment, thus there is still ample room for their activity improvement. Here, a series of Ru-based catalysts supported on nitrogen-doped carbon materials (NC) and activated carbon (AC) were prepared. The catalytic performance was evaluated for hydrotreatment of PLs in a batch autoclave (250 °C, 8 MPa H 2 , 4 h for mild hydrotreatment; 340 °C, 6 MPa H 2 , 4 h for deep hydrotreatment). The Ru catalyst supported on nitrogen-doped carbon materials, obtained by the polyol reduction method with polyvinylpyrrolidone (PVP) as the protective agent (Ru/NC (PVP)), showed a better performance (in terms of product oil properties) than the other catalysts investigated in this work, due to a good distribution of the ruthenium nanoparticles. For mild hydrotreatment the H/C ratio, O/C ratio and MCRT value were 1.42, 0.37 and 9.9 wt%, respectively. For deep hydrotreatment the H/C ratio, O/C ratio and MCRT value were 1.26, 0.16 and 4.6 wt%. The comparison with results published earlier for other hydrotreatment catalysts is satisfactory but also shows room for further improvement. GC–MS and 1H NMR results showed that the contents of thermal liable components like aldehydes (16.7 %), ketones (24.3 %) and sugars (4.0 %) in PLs were quantitatively converted under mild hydrotreatment, while phenols and alkanes significantly increased from 35.9 %, 0 % to 49.1 %, 35.3 %, respectively, especially for deep hydrotreatment compared with PLs feed. The catalyst characterization revealed that Ru/NC (PVP) with the most uniform dispersion and the smallest average particle size (1.5 nm), rendered the best performance. These findings indicate that Ru/NC (PVP) catalyst is a promising candidate for the catalytic hydrotreatment of PLs. [ABSTRACT FROM AUTHOR]

[Display omitted] • Hydrogel rich in O, N and S active sites was synthesized through one-pot crosslinking and ion exchange methods. • Hydrogel (SLH-2) could effectively remove metal ions in NMP solutions. • The concentration of Cu (II) decreased from 12.3 μg/L to 5.39 μg/L. • The affinity of the functional groups for Cu (II) was: –COOH > –SO 3 H > –NH 2 > –OH. • The concentration of trace Zn, Fe, Mg and Ni metal ions reduced to less than 1 μg/L. The presence of a considerable quantity of metal ions in N-methylpyrrolidone (NMP) applied for the cleaning of electronic devices, especially chips, results in a breakdown effect, thus affecting their overall durability and performance. Here, hydrogel that rich in O, N, and S active sites was prepared, which can effectively remove trace amounts of Cu (II) from N-methylpyrrolidone. The material was synthesized through a one-pot crosslinking and ion exchange method and is named SLH. The physicochemical properties and adsorption experiments were conducted. It was found that SLH-2 exhibited outstanding Langmuir maximum adsorption capacity of 136.99 mg/g at an initial Cu (II) concentration of 200 mg/L. By utilizing SLH-2 in electronic grade adsorption experiments, concentration of trace Cu (II) decreased from 12.3 μg/L to 5.39 μg/L. Additionally, concentration of Zn, Fe, Mg, and Ni significantly reduced to less than 1 μg/L, with –NH 2 and –COOH playing crucial roles in the adsorption process. The research results indicate that predominant adsorption mechanisms are surface coordination and ion exchange. The adsorption energy between active functional groups and Cu (II) was calculated using density functional theory (DFT), revealing an affinity order of –COOH > –SO 3 H > –NH 2 > –OH. This work not only developed an adsorbent for capturing trace Cu (II), but also provided new strategies for the removal of metal ions in wet chemicals. [ABSTRACT FROM AUTHOR]

Significance Statement: Interspecific introgression from Gossypium hirsutum has reorganized the genomic architecture of Gossypium barbadense. In this study, the genetic basis of population differentiation and the genetic diversity were deciphered and the introgression events and haplotype selection affecting associated fiber quality and environmental adaptation traits were illuminated in Gossypium barbadense. This study provides new insights into the breeding history of Gossypium barbadense and will guard the breeding programs of modern cultivated Gossypium barbadense. [ABSTRACT FROM AUTHOR]

Micro RNAs (mi RNAs) have been found to be differentially expressed during cotton fibre development. However, which specific mi RNAs and how they are involved in fibre development is unclear. Here, using deep sequencing, 65 conserved mi RNA families were identified and 32 families were differentially expressed between leaf and ovule. At least 40 mi RNAs were either leaf or ovule specific, whereas 62 mi RNAs were shared in both leaf and ovule. q RT- PCR confirmed these mi RNAs were differentially expressed during fibre early development. A total of 820 genes were potentially targeted by the identified mi RNAs, whose functions are involved in a series of biological processes including fibre development, metabolism and signal transduction. Many predicted mi RNA-target pairs were subsequently validated by degradome sequencing analysis. GO and KEGG analyses showed that the identified mi RNAs and their targets were classified to 1027 GO terms including 568 biological processes, 324 molecular functions and 135 cellular components and were enriched to 78 KEGG pathways. At least seven unique mi RNAs participate in trichome regulatory interaction network. Eleven trans-acting si RNA (tasi RNA) candidate genes were also identified in cotton. One has never been found in other plant species and two of them were derived from MYB and ARF, both of which play important roles in cotton fibre development. Sixteen genes were predicted to be tasi RNA targets, including sucrose synthase and MYB2. Together, this study discovered new mi RNAs in cotton and offered evidences that mi RNAs play important roles in cotton ovule/fibre development. The identification of tasi RNA genes and their targets broadens our understanding of the complicated regulatory mechanism of mi RNAs in cotton. [ABSTRACT FROM AUTHOR]

Lint percentage is an important character of cotton yield components and it is also correlated with cotton fibre development. In this study, we used a high lint percentage variety, Baimian1, and a low lint percentage, TM-1 genetic standard for Gossypium hirsutum, as parents to construct a mapping populations in upland cotton ( G. hirsutum). A quantitative trait locus/loci (QTL) analysis of lint percentage was performed by using two mapping procedures; composite interval mapping (CIM), inclusive composite interval mapping (ICIM) and the F populations in 2 years. Six main-effect QTL (M-QTL) for lint percentage (four significant and two suggestive) were detected in both years by CIM, and were located on chr. 3, chr. 19, chr. 26 and chr. 5/chr. 19. Of the six QTL, marker intervals and favourable gene sources of the significant M-QTL, qLP-3(2010) and qLP-3(2011) were consistent. These QTL were also detected by ICIM, and therefore, should preferentially be used for marker-assisted selection (MAS) of lint percentage. Another M-QTL, qLP-19(2010), was detected by two mapping procedures, and it could also be a candidate for MAS. We detected the interaction between two M-QTL and environment, and 11 epistatic QTL (E-QTL) and their interaction with environment by using ICIM. The study also found two EST-SSRs, NAU1187 and NAU1255, linked to M-QTL for lint percentage that could be candidate markers affecting cotton fibre development. [ABSTRACT FROM AUTHOR]