Search

BackgroundSesame (Sesamum indicumL., 2n = 2x = 26) is an important oilseed crop with high oil content but small seed size. To reveal the genetic loci of the quantitative seed-related traits, we constructed a high-density single nucleotide polymorphism (SNP) linkage map of an F2population by using specific length amplified fragment (SLAF) technique and determined the quantitative trait loci (QTLs) of seed-related traits for sesame based on the phenotypes of F3progeny.ResultsThe genetic map comprised 2159 SNP markers distributed on 13 linkage groups (LGs) and was 2128.51 cM in length, with an average distance of 0.99 cM between adjacent markers. QTL mapping revealed 19 major-effect QTLs with the phenotypic effect (R2) more than 10%, i.e., eight QTLs for seed coat color, nine QTLs for seed size, and two QTLs for 1000-seed weight (TSW), using composite interval mapping method. Particularly, LG04 and LG11 contained collocated QTL regions for the seed coat color and seed size traits, respectively, based on their close or identical locations. In total, 155 candidate genes for seed coat color, 22 for seed size traits, and 54 for TSW were screened and analyzed.ConclusionsThis report presents the first QTL mapping of seed-related traits in sesame using an F2population. The results reveal the location of specific markers associated with seed-related traits in sesame and provide the basis for further seed quality traits research.

SiDWF1 encodes a gibberellin receptor GID1B-like protein controlling the internode length and plant height in sesame. Sesame is a high-height crop. Here we systematically analyzed the morphological and genetic characters of the sesame dwarf mutant dw607 (dwf1 type). The plant height and the internode length of dw607 significantly declined, while the thousand seed weight (TSW) significantly increased (P

BackgroundBoth photosynthetic pigments and chloroplasts in plant leaf cells play an important role in deciding on the photosynthetic capacity and efficiency in plants. Systematical investigating the regulatory mechanism of chloroplast development and chlorophyll (Chl) content variation is necessary for clarifying the photosynthesis mechanism for crops.ObjectiveThis study aims to explore the critical regulatory mechanism of leaf color mutation in a yellow–green leaf sesame mutantSiyl-1.MethodsWe performed the genetic analysis of the yellow-green leaf color mutation using the F2population of the mutantSiyl-1. We compared the morphological structure of the chloroplasts, chlorophyll content of the three genotypes of the mutant F2progeny. We performed the two-dimensional gel electrophoresis (2-DE) and compared the protein expression variation between the mutant progeny and the wild type.ResultsGenetic analysis indicated that there were 3 phenotypes of the F2population of the mutantSiyl-1, i.e.,YYtype with light-yellow leaf color (lethal);Yytype with yellow-green leaf color, andyytype with normal green leaf color. The yellow-green mutation was controlled by an incompletely dominant nuclear gene,Siyl-1. Compared with the wild genotype, the chloroplast number and the morphological structure inYYandYymutant lines varied evidently. The chlorophyll content also significantly decreased (P 0.05). The 2-DE comparison showed that there were 98 differentially expressed proteins (DEPs) amongYY, Yy,andyylines. All the 98 DEPs were classified into 5 functional groups. Of which 82.7% DEPs proteins belonged to the photosynthesis and energy metabolism group.ConclusionThe results revealed the genetic character of yellow-green leaf color mutantSiyl-1. 98 DEPs were found inYYandYymutant compared with the wild genotype. The regulation pathway related with the yellow leaf trait mutation in sesame was analyzed for the first time. The findings supplied the basic theoretical and gene basis for leaf color and chloroplast development mechanism in sesame.

Background Leaf shape can affect plantlet development and seed yield in sesame. The morphological, histological and genetic analyses of a sesame mutant cl1 (cl) with curly leaf and indehiscent capsule traits were performed in this study. In order to clone the cl1 gene for breeding selection, genome re-sequencing of the 130 individuals of cl1 × USA (0)-26 F2 population and a bulked segregation analysis (BSA) pool was carried out. The genome re-sequencing data of the 822 germplasm with normal leaf shape were applied. Results For cl1 mutant, the adaxial/abaxial character of the parenchyma cells in the leaf blades is reduced. Results proved that the leaf curling trait is controlled by a recessive gene (Sicl1). Cross- population association of the F2 population of cl1 × USA (0)-26 indicated that the target cl locus was located on the interval C29 between C29_6522236 and C29_6918901 of SiChr. 1. Further regional genome variants screening determined the 6 candidate variants using genomic variants data of 822 natural germplasm and a BSA pool data. Of which, 5 markers C29_6717525, C29_6721553, C29_6721558, C29_6721563, and C29_6721565 existed in the same gene (C29.460). With the aid of the validation in the test F2 population of cl1 × Yuzhi 11 and natural germplasm, the integrated marker SiCLInDel1 (C29: 6721553–6721572) was determined as the target marker, and C29.460 was the target gene SiCL1 in sesame. SiCL1 is a KAN1 homolog with the full length of 6835 bp. In cl1, the 20 nucleic acids (CAGGTAGCTATGTATATGCA) of SiCLInDel1 marker were mutagenized into 6 nucleic acids (TCTTTG). The deletion led to a frameshift mutation and resulted in the earlier translation termination of the CL gene. The Sicl1 allele was shortened to 1829 bp. SiCL1 gene was expressed mainly in the tissues of stem, leaf, bud, capsule and seed. Conclusions SiCL1 encodes a transcription repressor KAN1 protein and controls leaf curling and capsule indehiscence in sesame. The findings provided an example of high-efficient gene cloning in sesame. The SiCL1 gene and the cl1 mutant supply the opportunity to explore the development regulation of leaf and capsule, and would improve the new variety breeding with high harvest mechanization adaption in sesame. Electronic supplementary material The online version of this article (10.1186/s12870-018-1503-2) contains supplementary material, which is available to authorized users.

Improving levels of yield potential, seed quality, resistance to biotic and abiotic stresses, and the adaptation to cultivation mechanization are still the main breeding objectives in sesame in the past decades. To understand the species-specific genetic characteristics of sesame, we review the progress of classical genetics of the key traits including the phenology characters related to the growth and development, yield-related traits, seed quality traits, stress tolerance, and other important morphological and agronomic traits in sesame in this chapter. Especially, plenty of classical genetic studies of the quantitative traits in different genotypes and environments presented by worldwide sesame scientists are reviewed. The results of the classical genetic analysis provide the theoretical basis for elite alleles collection and molecular marker-assisted selection (MAS) in sesame breeding.

Next-generation sequencing (NGS) technology has reinforced the development of the molecular genetic research in sesame in the recent two decades. In the early stage, most sesame scientists endeavored to develop more specific DNA markers with high polymorphism and to construct the molecular genetic maps for sesame with the aid of the limited expressed sequence tag (EST) and transcriptome information. In the recent decade, a lot of sesame genome information stimulated rapid progresses in the molecular genetics analysis of important agronomic traits in sesame. In this chapter, we overview the main achievements of the high-resolution molecular genetic map construction, quantitative trait loci (QTLs) mapping related to the key traits, map location of molecular markers, and identification of the key functional genes in sesame. Especially, several successful examples for gene location and detection of molecular markers associated with yield, seed quality, disease resistance, and other key agronomic traits in sesame are enumerated. The prospects and strategies for establishing the molecular breeding techniques in sesame are also discussed.