Search

Cultural distortion risk (CDR) threatens and challenges the cultural sustainability of heritage sites. This study adopted a sequential exploratory mixed-method design comprising grounded theory and fuzzy-set qualitative comparative analysis (fsQCA) to analyze the influencing factors, formation process, and avoidance paths of cultural distortion risk. The results indicate that CDR is caused by the "institution-market-production" framework, which involves eight influencing factors and 21 indicators. There are no necessary conditions for CDR formation, but weak cultural production plays a universal core role in forming high CDR. Moreover, our study highlights that the generation logic of CDR consists of four configurations and that the avoidance paths cover three configurations. These findings clarify the generation mechanism of CDR and expand the theoretical system of cultural sustainability research from a risk perspective. Heritage sites can use 21 indicators to reduce the cultural distortion risks by establishing institutional guarantee mechanisms and strengthening multiparty collaborative governance. [ABSTRACT FROM AUTHOR]

Environmental barrier coatings (EBCs) are indispensable for the service of SiC‐based turbine engines. The Si‐bond coating is a critical layer that prevents oxidants from penetrating SiC substrates and determines the service lifetimes of EBCs. In this study, the oxidation behaviors and failure mechanisms of Si‐based bond coatings were reviewed. The large growth rate and phase transformation of thermally grown oxides (TGOs, SiO2) seriously deteriorate the service of Si‐bond coatings. The low melting point of Si further limits its application in next‐generation engines above 1 427°C. The results show that an isolated particle healing (IPH) treatment decreased the oxidation rate of the Si‐bond coating by ∼24% at 1 300°C. Moreover, the Si–HfO2 and Si‐stabilizer (Si–Al2O3 or Si‐mullite) composite/duplex bond coatings can eliminate SiO2 phase transitions, thus improving the service lifetime. In addition, rare earth silicide (RESi), SiC and SiO2–HfO2 composite show potential for use in next‐generation EBCs above 1 427°C. This review provides guidance for designing Si‐based bond coatings with improved service lifetime. [ABSTRACT FROM AUTHOR]

AbstractIn the current study, bioinformatics analysis of the hepatocellular carcinoma (HCC) dataset was conducted with the hepatoprotective effect of the Fuzheng Huayu (FZHY) capsule against the diethylnitrosamine-induced HCC progression analyzed. Eight cell clusters were defined and tanshinone IIA, arachidonic acid, and quercetin, compounds of the FZHY capsule, inhibit HCC progression-related fibrosis by regulating the expression of PLAU and IGFBP3. Combined with the ameliorative effect of the FZHY capsule against liver dysfunctions and expression of PLAU and IGFBP3, our study confirmed the effect of the FZHY capsule on inhibiting the fibrosis-associated HCC progression via regulating the expression of PLAU and IGFBP3. [ABSTRACT FROM AUTHOR]

Objective: To investigate the effects of combination therapy with and without batroxobin, and the frequency of batroxobin use on the prognosis of profound sudden sensorineural hearing loss. Methods: Hearing recovery in the batroxobin group (231 patients) and non-batroxobin group (56 patients) was compared. The correlation between the number of times batroxobin was used and hearing recovery was analysed. Results: The decrease in hearing threshold and overall improvement rate in the batroxobin group with hearing loss exceeding 100 dB HL was significantly higher than that in the non-batroxobin group. There was no linear correlation between the number of times batroxobin was used and the overall improvement rate. Using batroxobin two to three times achieved a therapeutic effectiveness plateau. Conclusion: Batroxobin can improve the efficacy of combination therapy for profound sudden sensorineural hearing loss exceeding 100 dB HL, and using batroxobin two to three times yields the maximum overall improvement rate. [ABSTRACT FROM AUTHOR]

Fluid manipulation is an important foundation of microfluidic technology. Various methods and devices have been developed for fluid control, such as electrowetting-on-dielectric-based digital microfluidic platforms, microfluidic pumps, and pneumatic valves. These devices enable precise manipulation of small volumes of fluids. However, their complexity and high cost limit the commercialization and widespread adoption of microfluidic technology. Shape memory polymers as smart materials can adjust their shape in response to external stimuli. By integrating shape memory polymers into microfluidic chips, new possibilities for expanding the application areas of microfluidic technology emerge. These shape memory polymers can serve as actuators or regulators to drive or control fluid flow in microfluidic systems, offering innovative approaches for fluid manipulation. Due to their unique properties, shape memory polymers provide a new solution for the construction of intelligent and automated microfluidic systems. Shape memory microfluidic chips are expected to be one of the future directions in the development of microfluidic technology. This article offers a summary of recent research achievements in the field of shape memory microfluidic chips for fluid and droplet manipulation and provides insights into the future development direction of shape memory microfluidic devices. [ABSTRACT FROM AUTHOR]

Magnetars are the neutron stars with the highest magnetic fields up to 1015–1016 G. It has been proposed that they are also responsible for a variety of extra‐galactic phenomena, ranging from giant flares in nearby galaxies to fast radio bursts. Utilizing a relativistic mean field model and a variable magnetic field configuration, we investigate the effects of strong magnetic fields on the equation of state and anisotropy of pressure of magnetars. It is found that the mass and radius of low‐mass magnetars are weakly enhanced under the action of the strong magnetic field, and the anisotropy of pressure can be ignored. Unlike other previous investigations, the magnetic field is unable to violate the mass limit of the neutron stars. [ABSTRACT FROM AUTHOR]

The pulsar magnetic inclination angle is a key parameter for pulsar physics. It influences the observable properties of pulsars, such as the pulse beam width, braking index, polarization, and emission geometry. In this study, we give a brief overview of the current state of knowledge and research on this parameter and its implications for the internal physics of pulsars. We use the observed pulsar data of magnetic inclination angle and braking index to constrain the star's number of precession cycles, ξ$$ \xi $$, which reflects the interaction between superfluid neutrons and other particles inside a neutron star (NS). We apply the method proposed by Cheng et al. (Cheng, Q., Zhang, S. N., Zheng, X. P., & Fan, X. L., 2019, Phys. Rev. D, 99, 083011) to analyze the data of PSR J2013 + 3845 and obtain the constraints for ξ$$ \xi $$ ranging from 2.393×105$$ 2.393\times 1{0}^5 $$ to 1.268×106$$ 1.268\times 1{0}^6 $$. And further analysis suggests that the internal magnetic field structure of PSR J2013 + 3845 is likely dominated by toroidal components. This study may help us understand the process of internal viscous dissipation and the related evolution of the inclination angles of pulsars, and may have important implications for the study of continuous gravitational wave emissions from NS. [ABSTRACT FROM AUTHOR]

Background: Dyclonine hydrochloride mucilage is a topical anaesthetic formulated for mucosal surfaces. It is employed frequently for topical anaesthesia of the pharynx prior to endoscopic examinations such as electronic gastroscopy, and few adverse reactions have been reported. This article describes a patient who experienced a transient but severe disturbance of consciousness following oral dyclonine hydrochloride mucilage administration. Case presentation: A 75-year-old female presenting with gastrointestinal bleeding was examined by electronic gastroscopy. Six minutes after oral dyclonine hydrochloride mucilage administration, the patient entered a comatose-like state accompanied by loss of limb muscle tone and profuse perspiration. This response was not accompanied by changes in cardiac rhythm, blood pressure, or respiration rate, suggesting an effect on higher brain centres. After ten minutes, the patient's symptoms were alleviated. Conclusion: We suggest that sites of dyclonine hydrochloride mucilage use be equipped with appropriate rescue devices for these rare events. [ABSTRACT FROM AUTHOR]

With the rapid development of information technology, online public opinion on major sports event emergencies occurs frequently. However, the causal mechanisms and governance strategies for the evolution of online public opinion on major sports event emergencies have not been sufficiently explored; thus, this study examines public sentiment and the drivers of major sports event emergencies using Python and the grounded theory method. The results reveal that the evolution of online public opinion on major sports event emergencies is characterized by three stages: "outbreak period, repetition period and fading period." Furthermore, online public opinion on major sports event emergencies demonstrates a dynamic trend of "triggering-deepening-extending." Moreover, the evolution of online public opinion on major sports event emergencies is mainly influenced by emotional resonance, accident review and extended reflection. These findings have implications for the response, control and governance of online public opinion about sports event emergencies. [ABSTRACT FROM AUTHOR]

The phosphatase and tensin congeners (Pten) gene affects cell growth, cell proliferation, and rearrangement of connections, and it is closely related to cellular senescence, but it remains unclear the role of muscle‐Pten gene in exercise against age‐related deterioration in skeletal muscle and mortality induced by a high‐salt diet (HSD). In here, overexpression and knockdown of muscle Pten gene were constructed by building MhcGAL4/PtenUAS‐overexpression and MhcGAL4/PtenUAS‐RNAi system in flies, and flies were given exercise training and a HSD for 2 weeks. The results showed that muscle Pten knockdown significantly reduced the climbing speed, climbing endurance, GPX activity, and the expression of Pten, Sirt1, PGC‐1α genes, and it significantly increased the expression of Akt and ROS level, and impaired myofibril and mitochondria of aged skeletal muscle. Pten knockdown prevented exercise from countering the HSD‐induced age‐related deterioration of skeletal muscle. Pten overexpression has the opposite effect on skeletal muscle aging when compared to it knockdown, and it promoted exercise against HSD‐induced age‐related deterioration of skeletal muscle. Pten overexpression significantly increased lifespan, but its knockdown significantly decreased lifespan of flies. Thus, current results confirmed that differential expression of muscle Pten gene played an important role in regulating skeletal muscle aging and lifespan, and it also affected the adaptability of aging skeletal muscle to physical exercise since it determined the activity of muscle Pten/Akt pathway and Pten/Sirt1/PGC‐1α pathway.Muscle Pten knockdown inhibited Akt pathway and Sirt1/PGC‐1α pathway, and it also impaired myofibril and mitochondria, which promoted to the age of skeletal muscle and mortality. Pten knockdown prevented exercise from countering the HSD‐induced age‐related deterioration of skeletal muscle by inhibiting Akt pathway and Sirt1/PGC‐1α pathway. Muscle Pten overexpression delays the age of skeletal muscle and prolonged the lifespan, and overexpression promoted exercise against HSD‐induced age‐related deterioration of skeletal muscle by activating Akt pathway and Sirt1/PGC‐1α pathway. [ABSTRACT FROM AUTHOR]

The processing method of fuzzy information is a critical element in multi-criteria group decision-making (MCGDM). The hesitant Pythagorean fuzzy set (HPFS) has a higher capacity in express the uncertainty of human inherent preference. A composite weighted mathematical programming model with prospect theory and best-worst method (BWM) is proposed to solve the uncertainty of criterion weight acquisition and decision-makers (DMs) psychological behavior under the HPF environment. The decision-making process is as follows: Firstly, a novel spatial distance measurement method is designed which considers the extension space of HPFSs space by five parameters under the HPF environment. Secondly, the optimal criteria weights model minimizes the total distance between the alternatives and the HPF positive ideal solution (HPFPIS), as well as minimizes the consistency ratio of BWM. Thirdly, we propose the prospect decision matrix by the prospect theory and optimal weights, then use the ordered weighted average operator under the normal distribution to calculate the weight of DMs and rank the decision alternatives. Finally, an example is illustrated here, sensitivity and reliability, and comparative analysis are conducted to verify the effectiveness of the proposed method. [ABSTRACT FROM AUTHOR]

Compliant constant-force mechanisms (CCFMs) are compliant mechanisms that provide nearly constant forces over prescribed deflection ranges. This study proposes a topology optimization method for designing hinge-free compliant constant-output-force mechanisms. Bifurcation cause the objective function to oscillate, leading to convergence failure. Therefore, a constraint for preventing bifurcation in constant-output-force mechanisms is proposed. Moreover, a minimum scale constraint method that extends the design domain is utilized in the proposed optimization algorithm. The relationship between the minimum length scale and the force variation in the optimized CCFM is obtained and discussed, and an optimized CCFM is fabricated and tested. The optimized CCFM exhibits a force variation of 0.7% over a constant-force stroke of 26% of the CCFM length and is thus competitive among recently proposed CCFMs. [ABSTRACT FROM AUTHOR]

Objective: Age-related cataract (ARC) is an eye disease characterized by lens opacity. This study analyzed the correlation between 25 hydroxyvitamin D [25 (OH) D] levels and Interleukin 6 (IL-6) levels in aqueous humor from the patients with ARC, as well as between 25 (OH) D levels and lens opacity, and explored the effect of 25 (OH) D on the pathogenesis of ARC. Methods: A retrospective analysis was performed, which included the clinical data from 120 ARC patients and 40 healthy individuals. They were divided into three groups based on the objective scattering index (OSI): 40 healthy individuals (control group), 84 patients with the early cataract (EC group), and 36 patients with the mature cataract (MC group). An electrochemical luminescence method was used to detect the levels of 25 (OH) D and IL-6 in aqueous humor, the OSI of the eye was measured using a visual quality analysis system. The correlation between the changes in the above indicators and ARC was analyzed. Results: The OSI and IL-6 levels in the control group, EC group, and MC group increased sequentially (all p <.001), while the levels of 25 (OH) D showed an opposite trend (all p <.001). Conclusion: The decrease in 25 (OH) D levels is related to the occurrence and development of ARC, and the relationship between 25 (OH) D deficiency and the pathological mechanism of ARC needs further research. [ABSTRACT FROM AUTHOR]

This article described an unprecedented synthesis of trifluoromethylthiophosphonium salts from allyl trifluoromethyl sulfoxide and phosphines in the presence of trimethylsilyl trifluoromethanesulfonate (TMSOTf) through Mislow-Evans-type rearrangement. The resulting trifluoromethylthiophosphonium salts were firstly isolated and fully characterized. These fluoroalkylphosphonium salts, as exemplified by trifluoromethylthio triphenylphosphonium salt (6a), exhibited unique and versatile reaction with nucleophiles and deoxygenative trifluoromethylthiolation reaction of carboxylic acids. Furthermore, the photoredox catalytic tunable radical hydrotri-fluoromethylation and hydrotrifluoromethythiolation of unactivated alkenes with 6a was successfully developed. [ABSTRACT FROM AUTHOR]

Abstract Although large numbers of robot chefs have entered the restaurant industry, most restaurants using robot chefs do not disclose this information to consumers. Traditionally, human chefs are not identified. Since previous studies have demonstrated that consumers are reluctant to accept food cooked by robot chefs, not disclosing the identity of robot chefs seems to be a strategy for restaurants to increase customer patronage. However, the long-term impact of non-disclosure chef identity before consumption decisions on robotic restaurant development remains unclear. This study focuses on an important sustainability metric—business ethics. The results show that although the disclosure timing of human chefs has no effect, disclosing robot chef identity after (vs. before) consumption decisions reduces consumer perceived ethicality and thus decreases continuance patronage intention (Study 1), even if consumers are satisfied with the quality of food consumed (Study 2). Deception feeling plays a mediating role (Study 2). In addition, when consumers’ certainty of food quality before purchase is high, the robot chef identity disclosure timing will not affect consumer perceived ethicality (Study 3). This study extends research on robot chefs, robot ethics and signaling theory, and also provides implications for restaurant managers and policymakers. [ABSTRACT FROM AUTHOR]

In this paper, ultra-thin nanofiber PDI was obtained by self-assembly dispersion of commercial PDINH. A novel Co/Ni-MOF-74@PDI Z-scheme heterojunction photocatalyst material was constructed by a simple solvothermal method. XRD, SEM, TEM, FT-IR and other characterization techniques proved the successful preparation of the Co/Ni-MOF-74@PDI Z-scheme heterojunction photocatalyst material. By degrading chlortetracycline hydrochloride, it was found that the photocatalytic activity of Co/Ni-MOF-74@PDI was much higher than that of pure Co/Ni-MOF-74 and PDI. Subsequently, Co/Ni-MOF-74@PDI was used to activate H2O2 to further improve the degradation efficiency of chlortetracycline hydrochloride. It was found that the photocatalytic performance was greatly improved after the addition of 19.6 mM H2O2 to the system, and the degradation rate of chlortetracycline hydrochloride was 87% within 90 min. The electron transfer pathway and H2O2 activation mechanism of the Co/Ni-MOF-74@PDI composite photocatalyst were proved by free radical quenching experiments, electron paramagnetic resonance analysis and X-ray electron spectroscopy. Finally, the easy exfoliation point and degradation pathway of chlortetracycline hydrochloride were studied using density functional theory, UPLC-MS and toxicity evaluation software. It was found that the main active substances were h+, ˙O2, 1O2 and ˙OH, and the toxicity of chlortetracycline hydrochloride and its intermediates was evaluated. [ABSTRACT FROM AUTHOR]

Acoustic vortices carrying orbital angular momentum are significant in wave-matter interactions, allowing for versatile devices with promising applications. However, current metasurface-based vortex generators have limited bandwidth, operating within a narrow frequency range. Here, we propose a broadband acoustic metasurface with four space-coiling-cavity units through the bottom-up topology optimization. These units have constant phase differences with high-efficiency transmission (>0.8) over a desired frequency range [3.0, 4.0] kHz, indicating the unique wideband vortex response of their assembled metasurfaces. Our simulations and experiments further demonstrate this excellent performance. This breakthrough in broadband vortices allows for the development of devices like acoustic tweezers, antennas, and spanners. [ABSTRACT FROM AUTHOR]

BACKGROUND: Whole-process management is a novel approach widely applied in industry and commerce; however, it is not widely used in the management of medical records in hospitals. OBJECTIVE: The purpose of this study is to investigate the application of whole-process control in the administration of a hospital's medical records department to achieve refined management of medical records. METHODS: Whole-process control is a management measure that begins with process conception and implementation and includes control over all processes. The control group included medical records that were created prior to the implementation of whole-process control, i.e., those created between June 1 and December 31, 2020. The observation group included medical records that were created after the implementation of whole-process control. The behavior of the medical records staff (in terms of medical record collection, sorting, entry, inquiry, and supply) and the final quality of the medical records (the number of grade-A medical records and their front-page quality) were compared between the two groups, and subjective judgments related to staff satisfaction were reviewed. RESULTS: The implementation of whole-process control improved the behavior of the medical records staff. The final quality of the medical records was also improved, as was the job satisfaction of the medical records staff. CONCLUSION: Implementing whole-process control improved the management of medical records and quality of medical records. [ABSTRACT FROM AUTHOR]

Summary: We aimed to identify the efficacy of haploidentical related donor (HID) haematopoietic stem cell transplantation (HSCT) in adolescent and young adults (AYAs) with acute myeloid leukaemia (AML) in a large cohort. Consecutive AML AYAs (15–39 years old, n = 599) receiving HID HSCT in complete remission (CR) were included. The 3‐year cumulative incidence of measurable residual disease occurrence, relapse and non‐relapse mortality after HID HSCT was 28.6% (95% CI: 25.0–32.2), 11.6% (95% CI: 9.0–14.2) and 6.7% (95% CI: 4.7–8.7) respectively. The 3‐year probability of event‐free survival, leukaemia‐free survival (LFS) and overall survival (OS) after HID HSCT was 60.7% (95% CI: 56.9–64.8), 81.7% (95% CI: 78.7–84.9) and 85.6% (95% CI: 82.8–88.4) respectively. In multivariable analysis, AML risk category at diagnosis and comorbidity burdens before HID HSCT were independently associated with LFS and OS. Compared to the older adults (≥ 40 years, n = 355) with AML receiving HID HSCT in CR during the same time period, AYAs have a lower incidence of non‐relapse mortality and higher probabilities of LFS and OS. Thus, we firstly confirmed the safety and efficacy of HID HSCT in AYAs with AML‐CR. [ABSTRACT FROM AUTHOR]

Using network analysis, this study investigated how family communication patterns (Conversation and Conformity) were related to and predictive of adolescent overall depression severity and specific symptoms. A community sample of adolescents (10–17 years, n = 1327) completed the Children's Depression Inventory and the Revised Family Communication Pattern Instrument. Depressive symptoms were also re‐assessed 6 months later. Results showed that Conversation orientation protected against, whereas Conformity orientation increased the risk of adolescent depression. Family communication particularly influenced the child's feeling of being unloved, and feeling unloved was the only symptom prospectively predicted by two communication orientations at baseline. These findings revealed the path linking family factors to adolescent depression and may have implications for future family‐based interventions. [ABSTRACT FROM AUTHOR]

Parapneumonic pleural effusion (PPE) is a common complication in patients with pneumonia. Timely and accurate diagnosis of PPE is of great value for its management. Measurement of biomarkers in circulating and pleural fluid have the advantages of easy accessibility, short turn-around time, objectiveness and low cost and thus have utility for PPE diagnosis and stratification. To date, many biomarkers have been reported to be of value for the management of PPE. Here, we review the values of pleural fluid and circulating biomarkers for the diagnosis and stratification PPE. The biomarkers discussed are C-reactive protein, procalcitonin, presepsin, soluble triggering receptor expressed on myeloid cells 1, lipopolysaccharide-binding protein, inflammatory markers, serum amyloid A, soluble urokinase plasminogen activator receptor, matrix metalloproteinases, pentraxin-3 and cell-free DNA. We found that none of the available biomarkers has adequate performance for diagnosing and stratifying PPE. Therefore, further work is needed to identify and validate novel biomarkers, and their combinations, for the management of PPE. [ABSTRACT FROM AUTHOR]

This paper presents a numerical study on the progressive collapse response of concrete-filled steel tube (CFST) composite joint. A novel beam-column connection by using corrugated web and cover plate is proposed to enhance the collapse resistance of the joint. The simulated response is evaluated in terms of the ultimate load and deformation capacity of the joints for column removal scenario and cyclic loading. The results indicate that the corrugated web and cover plates connection can effectively delay the local buckling and fracture of the steel beam. Those configuration details have a significantly positive effect on the development of internal force, especially in the catenary mechanism stage to provide tensile force. Moreover, only after the fracture of the bottom flange, the corrugated web of the beam begins to contribute to the anti-collapse capacity of the joint. Compared with the CFST column-steel beam joint with flat beam web, the anti-collapse capacity and the vertical displacement of the joint are increased by 75.9% and 92.8%, respectively. Furthermore, a simplified calculation method for the anti-collapse capacity of the joint is proposed according to the resistance mechanism analysis. In addition, the seismic evaluation of the novel joint based on anti-collapse design indicates that the novel connection details can significantly improve the collapse resistance of the joint, without impairing its seismic resistance. [ABSTRACT FROM AUTHOR]

Polyglucosan body myopathy type 1 (PGBM1, OMIM #615895.) is a rare autosomal recessive disorder caused by RBCK1 mutations. The patients displayed polyglucosan accumulation in skeletal and cardiac muscles, giving rise to loss of ambulation and heart failure with or without immune system dysregulation. So far, only 24 patients have been reported, all of whom exhibited symptoms before adulthood. Here, we reported the first case of an adult‐onset PGBM1 patient with a novel compound heterozygous RBCK1 gene mutation consisting of a nonsense and synonymous variant affecting splicing. [ABSTRACT FROM AUTHOR]

Open microfluidics has attracted increasing attention over the last decade because of its flexibility and simplicity with respect to cell culture and clinical diagnosis. However, traditional valves and pumps are difficult to integrate on open-channel microfluidic chips, in which a liquid is usually driven by capillary forces. Poor fluid control performance is a common drawback of open microfluidics. Herein, we proposed a method for controlling the liquid flow in open channels by controlling the continuous Laplace pressure induced by the deformation of the shape memory microstructures. The uniformly arranged cuboidal microcolumns in the open channels have magnetic/light dual responses, and the bending angle of the microcolumns can be controlled by adjusting Laplace pressure using near-infrared laser irradiation in a magnetic field. Laplace pressure and capillary force drove the liquid flow together, and the controllable fluid transport was realized by adjusting the hydrophilicity of the channel surface and the bending angle of the microcolumns. We demonstrated the controllability of the flow rate and the directional transport of water along a preset path. In addition, the start and stop of water transport were realized via local hydrophobic modification. The proposed strategy improves poor fluid control in traditional open systems and makes fluid flow highly controllable. We tried to extract and detect rhodamine B in tiny droplets on the open microfluidic chip, demonstrating the advantages of the proposed strategy in the separation and analysis of tiny samples. [ABSTRACT FROM AUTHOR]

In recent years, GaSb-on-Si direct heteroepitaxy has been highly desirable to extend the operating wavelength range into mid-infrared and high-mobility applications, such as free-space communications, gas sensing, and hyperspectral imaging. High-quality GaSb films on Si remain challenging due to the high density of defects generated during the growth. For this purpose, epitaxial GaSb films were grown by molecular beam epitaxy on on-axis Si(001). Due to the large lattice mismatch (12.2%) between GaSb and Si, here, we proposed a radical design and growth strategy with the primary objective of achieving the annihilation of antiphase boundaries (APBs) and the reduction of threading dislocation density (TDD). Benefitting from a V-grooved Si hollow structure, we demonstrated the growth of emerging-APB-free GaSb film on Si(001) with low mosaicity. Moreover, by introducing InGaSb/GaSb dislocation filtering layers, the atomically flat surface root mean square roughness is improved to 0.34 (on Si) and 0.14 nm (on GaAs/Si). Moreover, the corresponding TDD can be reduced to 3.5 × 107 and 2 × 107 cm−2, respectively, one order of magnitude lower than the minimum value found in the literature. These reported results are a powerful lever to improve the overall quality of epitaxial Si-based antimonide, which is of high interest for various devices and critical applications, such as laser diodes, photo-detectors, and solar cells. [ABSTRACT FROM AUTHOR]

Identifying the cause of pleural effusion is challenging for pulmonologists. Imaging, biopsy, microbiology and biochemical analyses are routinely used for diagnosing pleural effusion. Among these diagnostic tools, biochemical analyses are promising because they have the advantages of low cost, minimal invasiveness, observer independence and short turn-around time. Here, we reviewed the past, present and future of pleural fluid biochemical analysis. We reviewed the history of Light's criteria and its modifications and the current status of biomarkers for heart failure, malignant pleural effusion, tuberculosis pleural effusion and parapneumonic pleural effusion. In addition, we anticipate the future of pleural fluid biochemical analysis, including the utility of machine learning, molecular diagnosis and high-throughput technologies. Clinical Chemistry and Laboratory Medicine (CCLM) should address the topic of pleural fluid biochemical analysis in the future to promote specific knowledge in the laboratory professional community. [ABSTRACT FROM AUTHOR]

Chemical warfare agents (CWAs) are toxic chemicals that have been intentionally developed for targeted and deadly use on humans. Although intended for military targets, the use of CWAs more often than not results in mass civilian casualties. To prevent further atrocities from occurring during conflicts, a global ban was implemented through the chemical weapons convention, with the aim of eliminating the development, stockpiling, and use of CWAs. Unfortunately, because of their relatively low cost, ease of manufacture and effectiveness on mass populations, CWAs still exist in today's world. CWAs have been used in several recent terrorist-related incidents and conflicts (e.g., Syria). Therefore, they continue to remain serious threats to public health and safety and to global peace and stability. Analytical methods that can accurately detect CWAs are essential to global security measures and for forensic analysis. Small molecule fluorescent probes have emerged as attractive chemical tools for CWA detection, due to their simplicity, ease of use, excellent selectivity and high sensitivity, as well as their ability to be translated into handheld devices. This includes the ability to non-invasively image CWA distribution within living systems (in vitro and in vivo) to permit in-depth evaluation of their biological interactions and allow potential identification of therapeutic countermeasures. In this review, we provide an overview of the various reported fluorescent probes that have been designed for the detection of CWAs. The mechanism for CWA detection, change in optical output and application for each fluorescent probe are described in detail. The limitations and challenges of currently developed fluorescent probes are discussed providing insight into the future development of this research area. We hope the information provided in this review will give readers a clear understanding of how to design a fluorescent probe for the detection of a specific CWA. We anticipate that this will advance our security systems and provide new tools for environmental and toxicology monitoring. [ABSTRACT FROM AUTHOR]

In recent years, low-dimensional organic–inorganic hybrid metal halides have attracted great attention in the field of solid-state optical materials due to their outstanding luminescence properties. Here, one new zero-dimensional (0D) hybrid zinc bromide [N-EPD]2ZnBr4 (N-EPD = N-ethylpyridinium) was prepared through a conventional solvothermal reaction method. The crystal structure of [N-EPD]2ZnBr4 consists of a discrete [ZnBr4]2− tetrahedron and organic [N-EPD] cation. It is noteworthy that [N-EPD]2ZnBr4 displays strong yellow broadband luminescence with a promising photoluminescence quantum yield (PLQY) of 8.28%. Based on temperature-dependent, time-resolved spectroscopy characterization and theoretical studies, the broadband yellow emission can be attributed to radiative recombination of self-trapping excitons (STEs). To the best of our knowledge, this is the first report about yellow light emission in 0D hybrid zinc halides. [ABSTRACT FROM AUTHOR]

Objective: Age-related cataract (ARC) is an eye disease characterized by lens opacity. This study analyzed the correlation between 25 hydroxyvitamin D [25 (OH) D] levels and Interleukin 6 (IL-6) levels in aqueous humor from the patients with ARC, as well as between 25 (OH) D levels and lens opacity, and explored the effect of 25 (OH) D on the pathogenesis of ARC. Methods: A retrospective analysis was performed, which included the clinical data from 120 ARC patients and 40 healthy individuals. They were divided into three groups based on the objective scattering index (OSI): 40 healthy individuals (control group), 84 patients with the early cataract (EC group), and 36 patients with the mature cataract (MC group). An electrochemical luminescence method was used to detect the levels of 25 (OH) D and IL-6 in aqueous humor, the OSI of the eye was measured using a visual quality analysis system. The correlation between the changes in the above indicators and ARC was analyzed. Results: The OSI and IL-6 levels in the control group, EC group, and MC group increased sequentially (all p < .001), while the levels of 25 (OH) D showed an opposite trend (all p < .001). Conclusion: The decrease in 25 (OH) D levels is related to the occurrence and development of ARC, and the relationship between 25 (OH) D deficiency and the pathological mechanism of ARC needs further research. [ABSTRACT FROM AUTHOR]

AP2S1 is the sigma 2 subunit of adaptor protein 2 (AP2) that is essential for endocytosis. In this study, we investigated the potential role of AP2S1 in intracellular processing of amyloid precursor protein (APP), which contributes to the pathogenesis of Alzheimer disease (AD) by generating the toxic β‐amyloid peptide (Aβ). We found that knockdown or overexpression of AP2S1 decreased or increased the protein levels of APP and Aβ in cells stably expressing human full‐length APP695, respectively. This effect was unrelated to endocytosis but involved lysosomal degradation. Morphological studies revealed that silencing of AP2S1 promoted the translocalization of APP from RAB9‐positive late endosomes (LE) to LAMP1‐positive lysosomes, which was paralleled by the enhanced LE‐lysosome fusion. In support, silencing of vacuolar protein sorting‐associated protein 41 (VPS41) that is implicated in LE‐lyso fusion prevented AP2S1‐mediated regulation of APP degradation and translocalization. In APP/PS1 mice, an animal model of AD, AAV‐mediated delivery of AP2S1 shRNA in the hippocampus significantly reduced the protein levels of APP and Aβ, with the concomitant APP translocalization, LE‐lyso fusion and the improved cognitive functions. Taken together, these data uncover a LE‐lyso fusion mechanism in APP degradation and suggest a novel role for AP2S1 in the pathophysiology of AD. [ABSTRACT FROM AUTHOR]

Three common types of reversible inhibitors, namely competitive, noncompetitive and uncompetitive inhibitors, were designed and constructed by using enzymes with different surface charges and gold nanoparticles with different surface ligands and particle sizes. To our knowledge, it is the first time that an uncompetitive nano inhibitor has been discovered. [ABSTRACT FROM AUTHOR]

A Tesla valve is a kind of micro-valve without moving parts. Due to the great difference between the reverse and forward flow, the Tesla valve is often used in passive fluid control devices. However, most of the current Tesla valve components are optimized and designed based on asymmetric structures. In this study, a Tesla valve pipe system model with symmetric structure is proposed. The characteristics of fluid flow and pressure drop were studied by finite element method and dimensional analysis. First, the pressure drop characteristics of symmetric and asymmetric Tesla valves with different Reynolds number are considered. The results show that the better the symmetry, the better the one-direction flow characteristics of Tesla valve system. Afterwards, through parametric analysis, computational fluid dynamics was used to verify flow characteristics of completely symmetrical Tesla valve system. The shunt angle, shunt pipe diameter and number of valves have significant effects on the pressure drop characteristics of the system. Eventually, based on numerical simulation results, by using the dimensional analysis method, the modification parameter α (α = α (θ , d , N)) was introduced to obtain the scaling law Δ p ∼ (1 + ln ⁡ (1 + N 3 / 5 R e 1 / 3 )) ρ V 2 L D − 1 R e − 1 / 4 between the pressure drop and other parameters of the completely symmetrical Tesla valve piping system. [ABSTRACT FROM AUTHOR]

To reduce the receiver's energy loss at high temperatures for the next-generation concentrating solar power plant, a novel multi-scale receiver is proposed by combing fin-like structures in the macroscale and light-trapping coatings in the nanoscale. The fin-like structure can reabsorb the reflected solar energy while the light-trapping nanostructured coating can increase solar absorption and reduce infrared emissivity. A multi-scale numerical model is developed to evaluate the receiver's optical and thermal performance. It is found that the multi-scale solar receiver can achieve a receiver efficiency of 0.904 at the solar time of 12:00 on spring equinox. However, it is also found that the maximum film temperature of the leading-edge tube will exceed 800 °C, which may decompose the current nitrate salt. To solve this problem, a white coating is used for leading-edge tubes to reduce the temperature by decreasing the maximum heat flux. The results show that this method can effectively regulate the overheating of the leading-edge tube. The maximum film temperature was successfully reduced to less than 800 °C at nearly no expenses of the absorbed solar energy. The study provides a new sight to achieve a receiver efficiency of more than 0.9 for the next generation concentrating solar power plants. [ABSTRACT FROM AUTHOR]

This study analyzes the spatiotemporal evolution and effects of regional functions in rural China and summarizes the spatiotemporal characteristics of rural Chinese regional functions from 2005 to 2015. The results of this study are as follows. (a) The values of the regional functions of rural China generally exhibit a "V‐shaped" distribution such that these values are high in eastern and western China and low in central China, and are high in northern China and low in southern China. (b) The overall functions of rural Chinese regions vary distinctly by region across northeastern China, eastern China, central China, and western China. (c) The spatial variation of regional production function values in rural China also exhibits a gradually declining trend, with the highest values in eastern China, followed by northeastern, central, and western China. This pattern exhibits a relatively strong coupling relationship with the spatial variation principles governing China's natural environment, resource carrying capacity, and economic development level. Overall, regional ecological function values do not exhibit any significant variation, but they do exhibit a gradually declining trend, starting from western and northern China and moving to eastern and southern China. (d) The degree of spatial spillover received by a given region from a neighboring region's production, living, or ecological function is stronger than the effect of the error shock from the corresponding function of the neighboring region. The effects of influencing factors on different regions exhibit significant variation. [ABSTRACT FROM AUTHOR]

Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND. [ABSTRACT FROM AUTHOR]

This study investigates the current status and attitudes towards academic e-book publishing by mainland Chinese academic publishers through an online survey. This study collected survey data from 49 authoritative academic publishers in China, focusing on their e-book sales profiles and their perceptions of how e-book sales affect publishers and libraries. The data reveals that China's academic e-book industry is still at an early development stage and has a relatively small market. The findings show significant differences in the willingness and attitudes towards e-book publishing between SSH publishers and STEM publishers, and also demonstrate that the enhancement of the demand for e-books by academic libraries promotes the process of the digital transformation of academic publishers. This study then argues that Chinese academic publishers need to further improve the quality of academic e-books, accelerate the transition from academic content providers to academic content service providers, and strengthen their cooperation with stakeholders. [ABSTRACT FROM AUTHOR]

Aims: To examine the prevalence and health correlates of depressive and anxiety symptoms among adults living in Guangdong province of China with a large population and rapid urbanization.Methods: The Guangdong Sleep and Psychosomatic Health Survey was conducted from September to November in 2019, which was a population-based study with a representative sample of adults aged 18-85 years. Multistage stratified cluster sampling was used. A total of 13,768 inhabitants were included and face-to-face interviewed using standardized assessment tools. Depressive and anxiety symptoms were evaluated using the Patient Health Questionnaire (PHQ-9) and Generalized Anxiety Disorder Scale (GAD-7), respectively.Results: The weighted prevalence rates of depressive and anxiety symptoms were 8.6% (95% confidence interval [CI]: 8.0%-9.3%) and 6.0% (95%CI, 5.4%-6.5%) respectively. People who have never married, irregular diet rhythm, hardly exercise, poorer sleep, alcohol consumption, chronic diseases and being unemployment and retirement were more likely to suffer depressive and anxiety symptoms. Moreover, the prevalence of depressive symptoms was significantly higher in those suffering from cardiovascular disease (Odds ratio[OR]:3.89, 95%CI: 1.77-8.54), chronic nephrosis (OR:3.89, 95%CI: 1.52-9.94), hyperlipidemia (OR:2.68, 95%CI: 1.57-4.59), anemia (OR:1.96, 95%CI: 1.33-2.89) and arthritis (OR:1.93, 95%CI: 1.17-3.16). The prevalence of anxiety symptoms was evidently greater within patients with cardiovascular disease (OR:3.15, 95%CI: 1.39-7.14), chronic nephrosis (OR: 2.89, 95%CI: 1.22-6.83), hyperlipidemia (OR:2.27, 95%CI: 1.20-4.29) and diabetes (OR:1.99, 95%CI: 1.15-3.44).Conclusions: Depressive and anxiety symptoms are commonly found in patients with chronic diseases. Given these adverse outcomes on health, health professionals should pay more attention to depressive and anxiety problems in health care for high-risk population. [ABSTRACT FROM AUTHOR]

It is a general principle of administrative law that the courts will not compel a decision-maker to perform a public duty in a particular manner by way of a mandatory order. However, in CBB v Law Society of Singapore [2021] SGCA 6, the Singapore Court of Appeal notably accepted that an exception could be made to this general principle where there was only one reasonable way to perform the public duty in question. Beyond the decision's obvious ramifications for the law relating to public law remedies in Singapore, this note argues that the Court of Appeal's reasoning has significant implications for administrative law in Singapore more broadly. Indeed, the Court's ruling is indicative of a shift in attitude towards the legality-merits distinction, a foundational principle of administrative law in Singapore. [ABSTRACT FROM AUTHOR]

Objectives: Endoscopic ultrasound‐guided gastroenterostomy (EUS‐GE) has recently been employed as a novel treatment for gastric outlet obstruction (GOO). The aim of this study was to evaluate the safety and efficacy of EUS‐GE for GOO at different sites. Methods: Consecutive hospitalized patients who underwent EUS‐GE for GOO at the Department of Gastroenterology, Nanjing Drum Tower Hospital from March 2017 to April 2020 were recruited in this retrospective study. Patients were divided into three groups depending on the obstruction site. The primary outcomes included technical success and clinical success. The secondary outcomes were operation time, post‐procedure length of stay (LOS), hospitalization cost, and complications such as peritonitis, bleeding, pneumoperitoneum, abdominal pain, and infection. Results: A total of 51 patients were included. Technical success achieved in 100% patients with proximal GOO and in 88.9% with distal GOO (P = 0.176). Clinical success declined from the oral side to the anal side (P = 0.510). Operation time, hospitalization costs, and post‐procedural LOS were similar among groups (P = 0.532, 0.520, and 0.144, respectively). Complications were observed in 28 (54.9%) patients. In approaching the mature phase of the endosopist, clinical success improved, while the secondary outcomes showed no statistically significant difference compared with the initial phase. Conclusions: EUS‐GE may be challenging for distal GOO; however, it is safe and effective when carried out by experienced endoscopists. A complete preoperative evaluation to assess the difficulty of the procedure is necessary. Prospective studies with large sample size are needed to further validate our findings. [ABSTRACT FROM AUTHOR]

A lattice hydrodynamic traffic model considering the average optimal flow of multiple grids downstream as a feedback control is proposed. The energy dissipation and fuel consumption are investigated under the feedback control based on the lattice hydrodynamic traffic model. Through linear stability analysis, the stability condition of the model is obtained. The mKdV equation and its kink-antikink density wave solution are derived by using the reduced perturbation method of nonlinear analysis. The variation trends of density wave, energy dissipation, and fuel consumption under traffic control are studied by numerical simulations. The research shows that exerting the feedback control can effectively suppress traffic congestion and improve the stability of traffic system. Meanwhile, it can also reduce the energy dissipation and fuel consumption of traffic system. [ABSTRACT FROM AUTHOR]

Two conceptual convolutional neural network (CNN) schemes are proposed, developed and analysed for directly decoding nonlinear frequency division multiplexing (NFDM) signals with hardware implementation taken into consideration. A serial network scheme with a small network size is designed for small user applications, and a parallel network scheme with high speed is designed for places such as data centres. The work aimed at showing the potential of using CNN for practical NFDM-based fibre optic communication. In the numerical demonstrations, the serial network only occupies 0.5 MB of memory space while the parallel network occupies 128 MB of memory but allows parallel computing. Both network schemes were trained with simulated data and reached more than 99.9% accuracy. [ABSTRACT FROM AUTHOR]

Neurogenetic diseases are neurological conditions with a genetic cause (s). There are thousands of neurogenetic diseases, and most of them are incurable. The development of bioinformatics and elucidation of the mechanism of pathogenesis have allowed the development of gene therapy approaches, which show great potential in treating neurogenetic diseases. Viral vectors delivery, antisense oligonucleotides, gene editing, RNA interference, and burgeoning viroid delivery technique are promising gene therapy strategies, and commendable therapeutic effects in the treatment of neurogenetic diseases have been achieved (Fig. 1). This review highlights a sampling of advances in gene therapies for neurogenetic disorders. [ABSTRACT FROM AUTHOR]

Coal resources have always been an important driving force for macroeconomic growth and GDP growth in resource‐rich regions. However, this growth has also caused inequality of household income in developing regions. Using survey data on rural household livelihoods in Shenmu county, Shaanxi Province, in northwestern China, this paper analyzes the relationship between coal exploitation and income inequality. Four multivariate econometric analyses are developed. We find evidence for the resource curse theory of natural resource exploitation leading to inequality: the Gini coefficient for household revenue is discovered to be markedly related with the location of and participation in coal exploitation. Nevertheless, this correlation is not linear. Rather, household income inequality primitively rises with environmental and resource subsidies. We analyze the impacts of household income inequality and contrast the characteristics of household livelihood and location characteristics in the coal exploitation site of northern Shenmu with those in the whole survey site. Our statistical analysis shows that out‐migration, the level of total household income, and convenience of household transportation are the important elements devoting to household income in northern Shenmu, the coal resources endowment region. However, the environmental damage and pollution caused by coal exploitation has substantial negative impacts upon household income, especially for households not participating in coal activities. Overall, we found that coal exploitation did not develop local industries. Adversely, the ecological environment problem and the high subsidy for coal mining caused by the exploitation of coal resources have aggravated the inequality of household income in the sample areas. Additionally, the development of coal resources attracted youth labor from agriculture to the coal industry, which exacerbated the lack of labor force and weakened village agricultural productivity. [ABSTRACT FROM AUTHOR]

Although the government contributes to the tourism recovery, the influence of the government on the micro-perceptions of tourism managers remains limited. The results of 415 samples demonstrate that government crisis management restores managers' confidence through different mediation of the sense of gain. Information and communication management improve only their sense of spiritual gain, while human resource development enhance merely their sense of material gain. Moreover, environmental uncertainty shows no moderation on restoring the managers' confidence. This study develops a theoretical framework for tourism crisis management and provides policy implications for the development of small tourism enterprises in times of crisis. [ABSTRACT FROM AUTHOR]

Background: Subjective cognitive decline (SCD) may be the early screening signal to distinguish susceptible population with Alzheimer's disease (AD) and mild cognitive impairment (MCI). Subjective cognitive complaints (SCCs) have been proved strongly associated with SCD. This study aimed to explore the association between sleep duration and SCCs in the Chinese elderly. Methods: We conducted a cross-sectional study involving 688 participants aged 60 years and older in Guangdong Province, China. SCCs were assessed by the Subjective Cognitive Decline questionnaire 9 (SCD-Q9), which contained 9 items with two dimensions, including the overall memory function and time comparison (OMTC) and daily activity ability (DAA). Restricted cubic splines and generalized additive model (GAM) were used to fit the association between sleep duration and SCD-Q9 score. Results: There were significant U-shaped associations between sleep duration and overall score of SCD-Q9 (EDF = 3.842, P < 0.001), as well as the OMTC dimension (EDF = 4.471, P < 0.001) in the age- and gender-adjusted GAM. The lowest points on the overall score of SCD-Q9 and OMTC score were observed in those sleeping 8 h per night. After further adjusting for other demographic characteristics, lifestyle behaviors, hypertension and diabetes, the U-shaped associations between sleep duration and the overall score of SCD-Q9 (EDF = 3.575, P = 0.004), sleep duration and the OMTC score (EDF = 4.478, P = 0.010) were still found. The daily activity ability (DAA) score was also non-linear associated with sleep duration both in the age- and gender-adjusted GAM (EDF = 2.314, P < 0.001) and further adjusted GAM (EDF = 2.080, P = 0.010). Conclusions: Both longer sleep duration (> 8 h) and shorter duration (< 8 h) were linked to worse SCCs. Future studies should explore the protective effect of managing sleep duration on SCD and its progression to dementia. [ABSTRACT FROM AUTHOR]

Deep-red (λem ∼ 710 nm) thiolated Ag@Au nanoclusters with a quantum yield of ∼18% were rapidly (∼12 min) prepared in aqueous solutions. The effects of pH and silver ions were demonstrated. The surface modification further resulted in nanoclusters with a quantum yield of ∼38%, the highest value ever reported for water-soluble red Au nanoclusters. This will highly facilitate their applications in sensing, bioimaging, etc. [ABSTRACT FROM AUTHOR]

To improve the receiver's solar-thermal conversion efficiency at high temperature for the next-generation concentrating solar power (CSP), a receiver with the light-trapping nanostructured coating is proposed herein. However, for the CSP plant with the light-trapping nanostructure coated receiver, the scale of the heliostat field is on the order of meters (∼10m), the solar receiver tube on the order of millimeters (∼10 mm), and the light-trapping coating on the order of nanometers (∼100 nm). The whole system spans nine orders of magnitude, which makes it extremely complicated and difficult to evaluate the receiver's optical and thermal performance. To solve this problem, a multi-scale model is proposed by combining Monte Carol Ray tracing method (MCRT), finite difference time domain (FDTD) method, and finite volume method (FVM). Then, the influences of three typical light-trapping nanostructured coatings, including pyramid nanostructure, moth-eye nanostructure, and cone nanostructure, on the receiver's optical-thermal performance are studied. Among these three typical nanostructures, the cone nanostructure can maximize the receiver's optical-thermal performance, with a receiver efficiency more than 88%, which is higher than that of the commercial Pyromark2500 coating by 6–10% points. The study demonstrates that the receiver with light-trapping nanostructured coatings can achieve high receiver efficiency for the next-generation CSP. [ABSTRACT FROM AUTHOR]

We propose a neural network for both forward and inverse continuous nonlinear Fourier transforms, NFT and INFT respectively. We demonstrate the network's capability to perform NFT and INFT for a random mix of NFDM-QAM signals. The network transformations (NFT and INFT) exhibit true characteristics of these transformations; they are significantly different for low and high-power input pulses. The network shows adequate accuracy with an RMSE of 5 × 1 0 − 3 for forward and 3 × 1 0 − 2 for inverse transforms. We further show that the trained network can be used to perform general nonlinear Fourier transforms on arbitrary pulses beyond the training pulse types. • A neural network is designed for nonlinear Fourier transforms based communication. • The design can work as either forward or inverse nonlinear Fourier transforms. • The designed network responses differently depending on input pulse energy. • It accepts varying pulse width, bandwidth, carrier wave types and modulation format. [ABSTRACT FROM AUTHOR]

• 3 novel biomimetic surrounding heliostat field layouts are proposed for solar tower. • Parameters of new layouts are optimized, and optimal results are obtained. • Biomimetic layout with linear increasing factor has the best optical performance. • Receiver's annual incident energy is raised by 1.5% compared with staggered layout. • Receiver's peak heat flux and stress are decreased by 4.2% and 4.3%, respectively. Three gradually sparse biomimetic (GSB) heliostat field layouts, which gradually extend from the inside to the outside, are proposed herein. Annual optical performance is compared with the standard biomimetic (SB) layout and the widely used staggered layout. In the end, the receiver's optical-thermal–mechanical performance is analyzed with the above five heliostat fields for the next-generation solar power tower (SPT) with the receiver's outlet temperature at 720 °C. The results show that the GSB layout with a linear increasing factor (Linear-GSB) has the best optical performance. Compared with the staggered layout and the SB layout, the Linear-GSB layout can increase the annual intercepted energy (E ann) by 1.5% and 1.3% under the same heliostat number, respectively. Moreover, GSB layouts can simultaneously reduce the receiver's maximum heat flux (q max), maximum thermal stress (σ w,max) and improve its heat flux distribution homogeneity. Compared with the staggered layout, q max , σ w,max , and heat flux maldistribution index of the receiver under the Linear-GSB layout at noon of spring equinox are decreased by 4.2%, 4.3%, and 19.8%, respectively. Meanwhile, the Linear-GSB layout can achieve slightly higher receiver efficiency compared with the staggered layout. [ABSTRACT FROM AUTHOR]

A novel nanosecond transient electric field (E-field) measurement system is developed in this paper to measure the E-field pulse caused by the operation of the high-voltage switch (switching E-field pulse) in the substation. An electrically small rod antenna is used as the receiving antenna and is matched by the operational amplifier with high input impedance to achieve broadband frequency response and stable working performance. A broadband analog optical fiber transmission system is further designed based on the high-frequency circuit model of the electronic components. Unlike the traditional frequency domain E-field measurement methods, the developed measurement system can directly output the time domain waveform of the switching E-field pulse. It also has the advantages of adjustable sensitivity, portability, and anti-electromagnetic interference. The calibrated measurement bandwidth ranges from 200 Hz to 680 MHz. Furthermore, the switching E-field pulse in an ultra-high voltage substation is measured and analyzed to verify the effectiveness of the fabricated measurement system. [ABSTRACT FROM AUTHOR]