Search

Synthetic riboswitches mediating ligand-dependent RNA cleavage or splicing-modulation represent elegant tools to control gene expression in various applications, including next-generation gene therapy. However, due to the limited understanding of context-dependent structure–function relationships, the identification of functional riboswitches requires large-scale-screening of aptamer-effector-domain designs, which is hampered by the lack of suitable cellular high-throughput methods. Here we describe a fast and broadly applicable method to functionally screen complex riboswitch libraries (~1.8 × 104 constructs) by cDNA-amplicon-sequencing in transiently transfected and stimulated human cells. The self-barcoding nature of each construct enables quantification of differential mRNA levels without additional pre-selection or cDNA-manipulation steps. We apply this method to engineer tetracycline- and guanine-responsive ON- and OFF-switches based on hammerhead, hepatitis-delta-virus and Twister ribozymes as well as U1-snRNP polyadenylation-dependent RNA devices. In summary, our method enables fast and efficient high-throughput riboswitch identification, thereby overcoming a major hurdle in the development cascade for therapeutically applicable gene switches., Riboswitches can mediate ligand-dependent RNA cleavage and splicing to control gene expression. Here the authors present a method to functionally screen large libraries and identify functional variants.

In patients with breast cancer, metastases of cancer cells to the axial skeleton may cause excruciating pain, particularly in the advanced stages. The current drug treatments available to alleviate this debilitating pain condition often lack efficacy and/or produce undesirable side effects. Preclinical animal models of cancer-induced bone pain are key to studying the mechanisms that cause this pain and for the success of drug discovery programs. In a previous study conducted in our laboratory, we validated and characterised the rat model of Walker 256 cell-induced bone pain, which displayed several key resemblances to the human pain condition. However, gene level changes that occur in the pathophysiology of cancer-induced bone pain in this preclinical model are unknown. Hence, in this study, we performed the transcriptomic characterisation of the Walker 256 cell line cultured in vitro to predict the molecular genetic profile of this cell line. We also performed transcriptomic characterisation of the Walker 256 cell-induced bone pain model in rats using the lumbar spinal cord and lumbar dorsal root ganglia tissues. Here we show that the Walker 256 cell line resembles the basal-B molecular subtype of human breast cancer cell lines. We also identify several genes that may underpin the progression of pain hypersensitivities in this condition, however, this needs further confirmatory studies. These transcriptomic insights have the potential to direct future studies aimed at identifying various mechanisms underpinning pain hypersensitivities in this model that may also assist in discovery of novel pain therapeutics for breast cancer-induced bone pain.

The arrival of next-generation sequencing (NGS) technologies has led to novel opportunities for expression profiling and genome analysis by utilizing vast amounts of short read sequence data. Here, we demonstrate that expression profiling in organisms lacking any genome or transcriptome sequence information is feasible by combining Illumina's mRNA-seq technology with a novel bioinformatics pipeline that integrates assembled and annotated Chinese hamster ovary (CHO) sequences with information derived from related organisms. We applied this pipeline to the analysis of CHO cells which were chosen as a model system owing to its relevance in the production of therapeutic proteins. Specifically, we analysed CHO cells undergoing butyrate treatment which is known to affect cell cycle regulation and to increase the specific productivity of recombinant proteins. By this means, we identified sequences for >13,000 CHO genes which added sequence information of approximately 5000 novel genes to the CHO model. More than 6000 transcript sequences are predicted to be complete, as they covered >95% of the corresponding mouse orthologs. Detailed analysis of selected biological functions such as DNA replication and cell cycle control, demonstrated the potential of NGS expression profiling in organisms without extended genome sequence to improve both data quantity and quality.

Increase in both productivity and product yields in biopharmaceutical process development with recombinant protein producing mammalian cells can be mainly attributed to the advancements in cell line development, media, and process optimization. Only recently, genome-scale technologies enable a system-level analysis to elucidate the complex biomolecular basis of protein production in mammalian cells promising an increased process understanding and the deduction of knowledge-based approaches for further process optimization. Here, the use of gene expression profiling for the analysis of a low titer (LT) and high titer (HT) fed batch process using the same IgG producing CHO cell line was investigated. We found that gene expression (i) significantly differed in HT versus LT process conditions due to differences in applied chemically defined, serum-free media, (ii) changed over the time course of the fed batch processes, and that (iii) both metabolic pathways and 14 biological functions such as cellular growth or cell death were affected. Furthermore, detailed analysis of metabolism in a standard process format revealed the potential use of transcriptomics for rational media design as is shown for the case of lipid metabolism where the product titer could be increased by about 20% based on a lipid modified basal medium. The results demonstrate that gene expression profiling can be an important tool for mammalian biopharmaceutical process analysis and optimization.

The US-2 DNA-binding element (ggaatgattactcagctaga) in the promoter of the human oxytocin receptor (OTR) gene has been shown to bind specifically nuclear proteins from human myometrium at parturition. To elucidate the molecular mechanisms involved in OTR gene upregulation at term, the US-2 element was used in a yeast one-hybrid system to screen a cDNA library derived from term human myometrium. Positive clones were further screened by electrophoretic mobility shift assay for their ability to bind the human OTR gene promoter, containing the US-2 motif. A 2.3-kb full-length cDNA encoding a human homologue of chicken MafF (hMafF) was isolated. hMafF represents an 18-kDa protein and contains an extended leucine zipper structure, but lacks a transactivation domain. Furthermore, Northern hybridization showed strong hMafF mRNA expression in the kidney and in term myometrium only, but not in nonpregnant myometrium. The hMafF protein is also preferentially expressed in term myometrium, as shown by specific binding to the OTR promoter. The highly specific binding of hMafF to the US-2 motif in the human OTR gene, together with its pattern of expression, supports a role for hMafF in OTR gene upregulation at term.

Cyclooxygenase 1 and 2 (COX-1 and COX-2) mRNA were measured by ribonuclease protection assays in total RNA extracted from intercaruncular and caruncular endometrium, myometrium, cotyledons, and cervical mucosa of pregnant cows. Tissues were obtained at gestational ages of 150 days and 275 days and at term not in labor, at term in labor, and 6-12 h postpartum. Additionally, the effect of oxytocin (OT) on COX-2 expression was determined in intercaruncular endometrium of six third-trimester cows (between 230 and 270 days of pregnancy), three of which were injected with OT (200 IU) and three with saline 2 h before tissues were harvested. Prostaglandin F2alpha (PGF2alpha) metabolite was measured in plasma samples taken at 15-min intervals before and after the injections. Results showed that COX-2 mRNA was expressed in every type of tissue examined, although in different concentrations and beginning at different stages. Other than in seminal vesicular and prostate glands used as positive controls, low concentrations of COX-1 mRNA were detected only in myometrium and caruncles. Cotyledons had the highest concentration of COX-2 transcripts at all stages studied. Caruncles had about half the concentration of COX-2 transcripts that was seen in cotyledons, and on Day 150 even less. COX-2 mRNA expression in both tissues increased with advancing gestation, but there was no difference between samples from term-no-labor and term-in-labor cows. COX-2 mRNA concentrations in endometrium and myometrium were low; they varied randomly during pregnancy with no significant increase until postpartum, when COX-2 transcripts in endometrium had increased severalfold whereas those in myometrium were similar to values before parturition. Cervical mucosa expressed COX-2 mRNA weakly until term but had increased markedly at parturition. Injection of 200 IU of OT induced a substantial increase in endometrial COX-2 mRNA concentration within 2 h; this was associated with linearly increasing plasma concentrations of 13, 14-hydroxy-15-keto-prostaglandin F2alpha, which were still rising at termination of the experiment. The results suggest that endogenous OT is a major factor in induction of COX-2 expression and PGF2alpha release at term and during parturition in cows.

The nucleotide and derived amino acid sequences of tammar preprorelaxin were established by combined reverse transcriptase polymerase chain reaction and 3'- and 5'-rapid amplification of cDNA ends methods, using RNA from the corpus luteum of late pregnancy as template. Relaxin gene expression was then investigated in tissues at various stages of the 26-day pregnancy and in adult males. The full-length tammar relaxin preprohormone is 579 base pairs. The derived amino acid sequence contains a probable signal peptide of 26 amino acids, a B-domain of 31 amino acids, a C-domain of 111 amino acids, and an A-domain of 24 amino acids, with sequence homologies of 49%, 38%, 47%, and 47%, respectively, to dogfish, pig, and both human relaxins, for the combined A- and B-domains of the functional peptides. The conserved amino acid residues in the B-domain confirm a region shown to be essential for binding of the peptide to its receptor. A relaxin gene is expressed in several other tissues of pregnant tammars including the placenta, follicle, and hypothalamus. Northern analysis showed a 1-kilobase relaxin transcript in the corpus luteum and placenta. Using RNase protection assays, relaxin gene expression in the corpus luteum was greater in early and mid pregnancy, reduced at term, and absent postpartum. These data demonstrate relaxin biosynthesis in both the corpus luteum and placenta in this marsupial and suggest that a relaxin physiology has been conserved during mammalian evolution.

Background The past decade has seen an abundance of transcriptional profiling studies of preclinical models of persistent pain, predominantly employing microarray technology. In this study we directly compare exon microarrays to RNA-seq and investigate the ability of both platforms to detect differentially expressed genes following nerve injury using the L5 spinal nerve transection model of neuropathic pain. We also investigate the effects of increasing RNA-seq sequencing depth. Finally we take advantage of the “agnostic” approach of RNA-seq to discover areas of expression outside of annotated exons that show marked changes in expression following nerve injury. Results RNA-seq and microarrays largely agree in terms of the genes called as differentially expressed. However, RNA-seq is able to interrogate a much larger proportion of the genome. It can also detect a greater number of differentially expressed genes than microarrays, across a wider range of fold changes and is able to assign a larger range of expression values to the genes it measures. The number of differentially expressed genes detected increases with sequencing depth. RNA-seq also allows the discovery of a number of genes displaying unusual and interesting patterns of non-exonic expression following nerve injury, an effect that cannot be detected using microarrays. Conclusion We recommend the use of RNA-seq for future high-throughput transcriptomic experiments in pain studies. RNA-seq allowed the identification of a larger number of putative candidate pain genes than microarrays and can also detect a wider range of expression values in a neuropathic pain model. In addition, RNA-seq can interrogate the whole genome regardless of prior annotations, being able to detect transcription from areas of the genome not currently annotated as exons. Some of these areas are differentially expressed following nerve injury, and may represent novel genes or isoforms. We also recommend the use of a high sequencing depth in order to detect differential expression for genes with low levels of expression.

The gene for the bovine oxytocin receptor has been sequenced using a combination of clones derived from a bovine endometrial cDNA library from estrus and a bovine genomic DNA library, with confirmation of structure using reverse transcription PCR programmed by term myometrial RNA. The receptor belongs to the seven transmembrane domain family and predicts a protein of 391 amino acids. A comparison of the genomic sequence with the cDNA structure, as well as reverse transcription polymerase chain reaction (RT-PCR) analysis, shows there are two introns, one in the 5'noncoding region that appears to be differentially spliced in the bovine uterus and a conserved intron within the open reading frame between the regions encoding the transmembrane domains VI and VII. Northern blot analysis indicated three major transcripts in myometrium and endometrium in vivo at approximately 6.5 kb, 3.5 kb, and 2.0 kb. In situ hybridization analysis of uterine tissue at term showed highest mRNA concentrations in the endometrial epithelium, particularly in the deep glands, a pattern confirmed also at the immunohistochemical level by monoclonal antibodies raised against a human amino-terminal peptide. Further confirmation of the identity of the receptor was obtained by transient transfection of a reconstituted receptor construct into COS-7 cells. The expressed receptor was shown to have identical pharmacological properties in respect to various oxytocin analogs to the natural bovine endometrial receptor.

Differential screening was used to select clones from a bovine luteal cDNA library, which were specifically expressed in late luteal stages. One of these clones encoded the bovine homologue of the Steroidogenic Acute Regulatory protein (StAR). The bovine StAR gene is transcribed as 3kb and 1.8kb transcripts, which differ in their sites of 3′polyadenylation. Both transcripts are highly expressed in corpora lutea of mid to late cycle and through pregnancy, but only at low levels in the early cycle. Northern analysis showed expression only in the corpus luteum and in the adrenal gland, but not in any other tissue examined. Within the protein coding region of the bovine StAR gene, there is a marked 124 base homology to the 5′non-coding region of another luteal transcript, TIMP-1, suggesting a possible common regulatory function for this sequence.

The peptide hormone oxytocin is produced both in the hypothalamus and in certain peripheral organs. The extent of extra-hypothalamic hormone synthesis in the pregnant cow has not previously been examined. In this study we have analyzed different tissues from the pregnant bovine reproductive tract and corpus luteum for the presence of mRNA encoding the oxytocin peptide as well as the oxytocin receptor. In uterine tissues oxytocin mRNA could only be detected sporadically with the help of a reverse transcription-polymerase chain reaction method, implying only very low levels of expression. The caruncles showed a consistently low level of oxytocin gene expression, which appeared up-regulated at term. However, in the corpus luteum there was a significant level of oxytocin gene expression at term, particularly following the onset of labor. The transcript levels were sufficiently high to be measurable by both RNase protection assay and by Northern hybridization; these levels imply a rescue of the oxytocin gene expression seen in the corpora lutea of cyclic and early pregnant cows. At the peptide level this expression was confirmed by immunohistochemistry. A sensitive RNase protection assay was developed to detect transcripts encoding the oxytocin receptor. Transcripts were detected in most uterine tissues, including the caruncles, with highest levels in the endometrium and myometrium at term. No transcripts could be detected in the corpus luteum at any stage of pregnancy, nor in the amnion. The results suggest the possibility of local, paracrine effects of oxytocin within the uterus of the pregnant cow. The rescue of luteal oxytocin at term could act to supplement the circulating hormone of pituitary origin.

BackgroundIn humans and mice naturally occurring CD4(+)CD25(+) regulatory T cells (nTregs) are a thymus-derived subset of T cells, crucial for the maintenance of peripheral tolerance by controlling not only potentially autoreactive T cells but virtually all cells of the adaptive and innate immune system. Recent work using Dicer-deficient mice irrevocably demonstrated the importance of miRNAs for nTreg cell-mediated tolerance.Principal findingsDNA-Microarray analyses of human as well as murine conventional CD4(+) Th cells and nTregs revealed a strong up-regulation of mature miR-155 (microRNA-155) upon activation in both populations. Studying miR-155 expression in FoxP3-deficient scurfy mice and performing FoxP3 ChIP-Seq experiments using activated human T lymphocytes, we show that the expression and maturation of miR-155 seem to be not necessarily regulated by FoxP3. In order to address the functional relevance of elevated miR-155 levels, we transfected miR-155 inhibitors or mature miR-155 RNAs into freshly-isolated human and mouse primary CD4(+) Th cells and nTregs and investigated the resulting phenotype in nTreg suppression assays. Whereas miR-155 inhibition in conventional CD4(+) Th cells strengthened nTreg cell-mediated suppression, overexpression of mature miR-155 rendered these cells unresponsive to nTreg cell-mediated suppression.ConclusionInvestigation of FoxP3 downstream targets, certainly of bound and regulated miRNAs revealed the associated function between the master regulator FoxP3 and miRNAs as regulators itself. miR-155 is shown to be crucially involved in nTreg cell mediated tolerance by regulating the susceptibility of conventional human as well as murine CD4(+) Th cells to nTreg cell-mediated suppression.

The bovine gene for the steroidogenic acute regulatory protein (StAR) was cloned and sequenced, including 2 kb of the upstream control region of the gene. The gene comprises seven exons arranged similarly to those of the human and mouse gene sequences. The sequence analysis identified three cis elements corresponding to the binding motif for the transcription factor SF-1/Ad4BP, at - 100, - 240 and - 1190 from the transcription start site. Electrophoretic mobility shift analysis (EMSA) using nuclear proteins from bovine corpus luteum and bovine adrenal as well as in vitro transcribed/translated SF-1/Ad4BP consistently showed that only the site at -1190 bound the transcription factor significantly. Very weak binding was detectable also at the - 240 site, but none at the -100 site. Heterologous transfection of StAR promoter deletion-reporter constructs into Hela cells cotransfected with an expression vector for bovine SF-1/Ad4BP, showed that this transcription factor can specifically act on the bovine StAR gene promoter, but preferentially in regions corresponding to the two proximal SF-1/Ad4BP elements at - 100 and - 240, though with only low relative effect. Furthermore, additional cotransfection of a construct expressing a constitutive protein kinase A catalytic subunit to mimic the effects of cAMP stimulation, led to a small SF-1/Ad4BP-dependent increase in reporter activity mediated only by the same proximal sites. Since the bovine StAR gene promoter does not appear to have a functional cAMP responsive element (CRE), either this effect is mediated in this system directly by SF-1/Ad4BP, or by other factors interacting with this transcription factor, but which do not involve CRE-mediated gene activation. Taken together, the results show that there is a discrepancy between the results of the EMSA experiments and those using transfection of promoter-reporter constructs, which needs to be resolved before a clear understanding of SF-1/Ad4BP-mediated regulation of the StAR gene is attained.

In the male mammal, the small peptide hormone oxytocin is produced in similar quantities within the hypothalamo-pituitary magnocellular system as in the female, yet for the male little is known about the physiology associated with this hormone. The present review summarizes what is known about the function of oxytocin in the male mammal and tries to take account of both central and systemic effects, and those linked with a local production of oxytocin within the male reproductive organs. In several species a pulse of systemic oxytocin, presumably of hypothalamic origin, appears to be associated with ejaculation. The systemic hormone could act peripherally stimulating smooth muscle cells of the male reproductive tract, but could also reflect central effects in the brain modulating sexual behaviour. In addition to systemic oxytocin, the peptide is also made locally within the testis, and possibly also the epididymis and prostate. In the former tissue it appears to have an autocrine/paracrine role modulating steroid metabolism, but may in addition be involved in contractility of the seminiferous tubules. However, the latter function may involve the mediacy of Sertoli cells which under some circumstances can also exhibit the components of a local oxytocin system. In the prostate of the rat and the dog oxytocin is linked again to steroid metabolism and may also act as a growth regulator. Finally, oxytocin in seminal fluid is discussed and its possible role in respect to the fate of the semen following ejaculation.