Search

Yes-associated protein (YAP) and a transcriptional co-activator with PDZ-binding motif (TAZ) genes are crucial for regulating the size of mammalian tissues and organs as well as for many biological processes such as bone formation, cell lineage determination, tissue regeneration, and cell proliferation. The purpose of this study was to characterize the YAP and TAZ gene polymorphisms in 266 Guanzhong Dairy Goats and 299 Shanbei White Cashmere Goats and to explore their potential relationship with growth characteristics such as body weight and body length. After genotyping and using PCR amplification and Sanger sequencing to find polymorphisms in the YAP and TAZ genes, five InDels loci were found in the goat YAP gene and three InDels loci in the TAZ gene. The findings of the association analysis demonstrated that the goats' body weight, height, cannon circumference, chest depth, chest breadth, and chest circumference were all substantially influenced by five InDels loci in the YAP gene (p). Goat body height, trunk breadth, trunk length, body length, and body weight were all substantially impacted by three InDels loci in the TAZ gene (p). In conclusion, eight InDels loci of goat YAP and TAZ were found in this study, and their impacts on goat phenotype were disclosed. These results might offer fresh avenues for boosting goat molecular breeding.

LuTan-1 (LT-1) satellite constellation is used to conduct surface deformation monitoring. Following the successful launch of two satellites, we began to use the independently developed LandSAR software for differential interferometric data processing and application at the beginning of 2022. In this paper, we tested the LandSAR software by assessing the DInSAR and stacking modules. We used 21 LT-1 single look complex (SLC) images from December 2022 to May 2023 to conduct DInSAR and stacking processing of Datong City, Shanxi Province. DInSAR revealed more subsidence funnels and larger relative deformation values compared to stacking. We tested the DInSAR technology with different parameter combination. Results show that multi-looking factor is the most important to detect the deformation details because of the phase gradient limitation of DInSAR. Compared multi-looking ratios of 2×2 and 4×4, the subsiding funnels that were detected decreased from 60 to 47. After deep testing and assessment, we found that the linear model used by stacking affects the result severely, meaning that most of the subsidence of coal mines were not linear. Stacking only found 32 subsidence funnels which were active coal mines during our observation time. The test result show that LandSAR was compatible for DInSAR and stacking. And it is useful to observe linear and nonlinear deformation in the coal mine regions.

Collapse is one of the most destructive natural disaster, being sudden, frequent, and highly concealed, causing large-scale damage. On August 10, 2023, the slope of 108 national highway in Weinan, Shaanxi Province collapsed. The lower edge of the collapse slope body is the Luohe river, and the collapse body rushes into the river to form a barrier lake. Remote sensing technique can provide multiple dimensional information for disaster emergency and management. Lutan-1 SAR satellites are the first group L-band SAR constellation for multiple applications in China. Owing to the precise orbit control ability and high revisit characteristics for Lutan-1 SAR satellites, surface deformation monitoring with centimeter even millimeter accuracy may be achieved. Based on the multi-temporal pre-disaster and post-disaster Lutan-1 SAR data and high resolution optical data, the collapse information including the pre-disaster and post-disaster were extracted and analysed. From July 11 to 27, 2023, the pre-collapse deformation was obtained with the maximum value of 6 cm, and obvious deformation occurred before the collapse. Lutan-1 monitored results pre-collapse can provide certain information for disaster early identification. From July 27 to August 24, 2023, due to the serious incoherence caused by large deformation and ground changes, effective deformation information cannot be obtained based on the InSAR technique. In addition, the collapse information was clearly extracted by the high resolution optical data acquired pre-collapse and post collapse. After the collapse, significant deformation was extracted from August 24 to September 21 with the maximum value of 6 cm, indicating that obvious deformation still occurred over the collapse area. Through the analysis for the series results obtained by SAR and optical data, it is favourable for disaster emergency and management.

The presence of exceptionally old ice and relative ease of access make Antarctic blue-ice areas (BIAs) attractive paleoclimate archives. However, only a handful of BIAs, mostly situated in West Antarctica and along the Transantarctic Mountains, have been investigated for this purpose. Here, we present the age of surface ice from the Grove Mountains BIA in Princess Elizabeth Land, East Antarctica, determined by measuring 81Kr in the trapped air. Two samples yield an average age of 143-29+33 kyr. Together with the reported terrestrial age of a chondrite, we conclude that the Grove Mountains BIA holds considerable potential for paleoclimate studies.

Ice-penetrating radar (IPR) imaging is a valuable tool for observing the internal structure and bottom of ice sheets. Subglacial water bodies, also known as subglacial lakes, generally appear as distinct, bright, flat, and continuous reflections in IPR images. In this study, we use available IPR images from the Gamburtsev Subglacial Mountains to extract one-dimensional reflector waveform features of the ice–bedrock interface. We apply a deep-learning method to reduce the dimension of the reflector features. An unsupervised clustering method is then used to separate different types of reflector features, including a reflector type corresponding to subglacial lakes. The derived clustering labels are then used to detect features of subglacial lakes in IPR images. Using this method, we compare the new detections with a known-lakes inventory. The results indicate that this new method identified additional subglacial lakes that were not previously detected, and some previously known lakes are found to correspond to other reflector clusters. This method can offer automatic detections of subglacial lakes and provide new insight for subglacial studies.

Introduction Evidence regarding the link between insomnia and successful aging (SA) in the older generation remains scarce. Objectives The purpose of this study is to explore the relationship of insomnia with SA within a substantial sample of the community-dwelling Indian population. Methods Data were drawn from the Longitudinal Ageing Study in India (LASI), Wave 1, conducted during 2017-2018. Older participants aged 60 years and above who completed both the insomnia and SA surveys were included. Insomnia was determined by the presence of at least one of three symptoms: 1) difficulty in initiating sleep; 2) difficulty in maintaining sleep; or 3) early morning awakening, occurring 5 or more times per week. SA was assessed by five components: 1) absence of chronic diseases; 2) low probability of disability; 3) high cognitive functionality; 4) low probability of depression; and 5) active social engagement. The association between insomnia and SA was examined through survey-weighted multivariable logistic regression, with adjustments made for potential covariates. Subgroup analyses were carried out to evaluate interactions with age, sex, alcohol use, and smoking status. Results A total of 31362 participants met the eligibility criteria. The overall weighted prevalence was 9.91% for insomnia and 23.94% for SA. In fully adjusted models, insomnia exhibited a negative association with SA (OR 0.70; 95% CI 0.63-0.78, see Table 1) and with each of SA’s components, except for the absence of chronic diseases (OR 0.94; 95% CI 0.85-1.04, see Table 1). Subgroup analyses, stratified by age, sex, alcohol use, or smoking status, did not reveal any significant interactions between insomnia and SA (p for interaction = 0.098, 0.873, 0.704, 0.095, respectively).Table 1. Relationship between insomnia and successful aging. Insomnia ORs (95% CIs) Unadjusted model Model 1 Model 2 No Reference Reference Reference Yes Successful aging 0.50 (0.45, 0.55) 0.54 (0.49, 0.60) 0.70 (0.63, 0.78) Absence of chronic diseases 0.66 (0.61, 0.71) 0.65 (0.60, 0.70) 0.94 (0.85, 1.04) † Low probability of disability 0.43 (0.40, 0.46) 0.45 (0.42, 0.49) 0.51 (0.47, 0.55) High cognitive functionality 0.66 (0.61, 0.72) 0.75 (0.68, 0.83) 0.78 (0.71, 0.87) Low probability of depression 0.33 (0.30, 0.36) 0.34 (0.31, 0.38) 0.38 (0.34, 0.42) Active social engagement 0.79 (0.73, 0.86) 0.87 (0.80, 0.95) 0.86 (0.78, 0.94) † p > 0.05; ORs, odds ratios; 95% CIs, 95% Confidence intervals. Model 1 adjusted for: age, sex, level of education, work status, marital status, place of residence, economic status, caste; Model 2 adjusted for: model 1 plus body mass index (BMI), alcohol use, smoking status. Conclusions Insomnia was negatively linked with SA within the older Indian population. Future prospective studies are warranted to validate these relationships, investigate underlying mechanisms, and enhance the understanding and promotion of SA. Disclosure of Interest None Declared

Lu Tan-1 (LT-1) has finished the in-orbit test and will be delivered to the users in 2023. In this paper, we discussed the satellite characteristics including the satellite mission, the platform as well as the payload. The satellite constellation was designed following two main demands, i.e., digital elevation model (DEM) generation and deformation monitoring. Thus, we provided two kinds of productions. First was the DEM created using the images provided by helix bistatic formation. Second was the deformation products created using that of pursuit monostatic formation. The deformation products were finally classified into three different types given the processing technologies. They were deformation field provided by differential interferometric SAR (InSAR, DInSAR), deformation velocity field provided by stacking, and deformation time series provided by multi-temporal InSAR. DEM data were validated to be better than 5 m compared to ICESat. Deformation field, deformation velocity field, as well as deformation time series were validated to be better than 2.7 mm, 8.6 mm/yr and 3.7 mm, respectively.

The unsteady hypersonic flow under finite amplitude pulse entropy perturbation at different freestream temperatures was calculated by direct numerical simulation. The flow response characteristics under the perturbation of entropy waves in freestreaming are analyzed. The temperature effect of freestreaming is studied based on the sensitivity of the boundary layer caused by pulse entropy perturbation. The results show that the higher freestream temperature promotes the first growth of the above third-order modes after leaving the head region, and strongly inhibits the first attenuation. The influence of the freestream temperature on the evolution of the induced disturbance wave is more significant than that on the development of the main flow disturbance waves. Low freestream temperature can suppress the attenuation of the modes below the second order. As the disturbance wave evolves downstream, the frequency band of the finite frequency disturbance wave gradually narrows, and the frequency band narrows faster when the temperature of freestreaming is low than when the temperature of freestreaming is high.

The intelligent interpretation of land-use change has become a research frontier. Reasonably and effectively utilizing limited land resources and making scientific predictions to promote sustainable utilization of land resources is significant for establishing a resource-saving and environmentally friendly society. Remote sensing technology can efficiently complete multi-temporal and dynamic land-use change detection, especially using high-spatial resolution remote sensing images. However, the existing land-use change and prediction have not been combined. In addition, land-use change detection mainly relies on shallow feature design, resulting in low prediction accuracy and weak generalization performance. To solve the above problems, we proposed a CNN-based CA Markov model using multi-temporal GaoFen satellite remote sensing images for the change detection and prediction of land cover. Taking the city of Panzhihua in China as an example, the study constructed training sample data that includes a multi-temporal remote sensing training dataset from 2006, 2010, 2015, and 2021 using GaoFen satellite remote sensing images. Meanwhile, a multitemporal CNN land-use detection model was constructed to generate a land-use transfer matrix by training the dataset. Furthermore, the comprehensive driving factors were selected, including terrain factors (height and slope) and social factors (economic and population density). Then, the CA-Markov model was constructed to predict the land-use development trend in Panzhihua City after ten years. Compared with the traditional methods, experimental results demonstrate that the proposed model can improve the model's automatic interpretation ability and prediction accuracy with an increase of 24.6% in the FoM index and 4.37% in the Kappa coefficient.

With semiconductor technology gradually approaching its physical and thermal limits, graphics processing units (GPUs) are becoming an attractive solution for many scientific applications due to their high performance. This paper presents an application of GPU accelerators in an air quality model. We demonstrate an approach that runs a piecewise parabolic method (PPM) solver of horizontal advection (HADVPPM) for the air quality model CAMx on GPU clusters. Specifically, we first convert the HADVPPM to a new Compute Unified Device Architecture C (CUDA C) code to make it computable on the GPU (GPU-HADVPPM). Then, a series of optimization measures are taken, including reducing the CPU–GPU communication frequency, increasing the data size computation on the GPU, optimizing the GPU memory access, and using thread and block indices to improve the overall computing performance of the CAMx model coupled with GPU-HADVPPM (named the CAMx-CUDA model). Finally, a heterogeneous, hybrid programming paradigm is presented and utilized with GPU-HADVPPM on the GPU clusters with a message passing interface (MPI) and CUDA. The offline experimental results show that running GPU-HADVPPM on one NVIDIA Tesla K40m and an NVIDIA Tesla V100 GPU can achieve up to a 845.4× and 1113.6× acceleration. By implementing a series of optimization schemes, the CAMx-CUDA model results in a 29.0× and 128.4× improvement in computational efficiency by using a GPU accelerator card on a K40m and V100 cluster, respectively. In terms of the single-module computational efficiency of GPU-HADVPPM, it can achieve 1.3× and 18.8× speedup on an NVIDIA Tesla K40m GPU and NVIDIA Tesla V100 GPU, respectively. The multi-GPU acceleration algorithm enables a 4.5× speedup with eight CPU cores and eight GPU accelerators on a V100 cluster.

The ISPRS Technical Commission I Midterm Symposium on "Intelligent Sensing and Remote Sensing Application" was held in Changsha, China, during May 13–17, 2024, aiming to provide a platform to share the latest researches, advanced technologies and application experience, to discuss the future development and to seek international cooperation in various forms. The Symposium has received 229 full paper and abstract s, among them 45 double-blind peer-reviewed full papers were published in ISPRS Annals of the Photogrammetry, Remote Sensing and Spatial Information, and 165 papers accepted through abstract review were published in the International Archives of the Photogrammetry, Remote Sensing and Spatial Information Sciences. These papers are mostly dedicated to topics of the 8 TC I Working Groups, 3 Inter-commission Working Groups, including Satellite Missions and Constellations for Remote Sensing, Mobile Mapping Technology, Multispectral, Hyperspectral and Thermal Sensors, LiDAR, Laser Altimetry and Sensor Integration, Microwave and InSAR Technology for Earth Observation, Orientation, Calibration and Validation of Sensors, Data Quality and Benchmark of Sensors, Multi-sensor Modelling and Cross-modality Fusion, Robotics for Mapping and Machine Intelligence, Autonomous Sensing Systems and their Applications, Digital Construction: Reality Capture, Automated Inspection and Integration to BIM, Point Cloud Generation and Processing, Artificial Intelligence Technology Related to Sensor Systems, Multi-sensor Remote Sensing Applications.. These papers presented the latest trends of sensor systems. The full papers and abstracts were reviewed by the members of the Symposium Scientific Committee comprised of Working Group officers and invited experts. We would like to take this opportunity to express our great gratitude to the Scientific Committee, Local Organizing Committee, Sponsors, Exhibitors and all those who have contributed to this successful Symposium. We also want to express our thanks to the authors for their excellent papers and presentations. Tang Xinming, Antonio Maria Garcia Tommaselli, Zhang Tao, Xie JunfengISPRS Technical Commission I on Sensor SystemsMay 2024, Changsha, China

The unprecedented lockdown of human activities during the COVID-19 pandemic has significantly influenced social life in China. However, understanding the impact of this unique event on the emissions of different species is still insufficient, prohibiting the proper assessment of the environmental impacts of COVID-19 restrictions. Here we developed a multi-air-pollutant inversion system to simultaneously estimate the emissions of NOx, SO2, CO, PM2.5 and PM10 in China during COVID-19 restrictions with high temporal (daily) and horizontal (15 km) resolutions. Subsequently, contributions of emission changes versus meteorological variations during the COVID-19 lockdown were separated and quantified. The results demonstrated that the inversion system effectively reproduced the actual emission variations in multi-air pollutants in China during different periods of COVID-19 lockdown, which indicate that the lockdown is largely a nationwide road traffic control measure with NOx emissions decreasing substantially by ∼40 %. However, emissions of other air pollutants were found to only decrease by ∼10 % because power generation and heavy industrial processes were not halted during lockdown, and residential activities may actually have increased due to the stay-at-home orders. Consequently, although obvious reductions of PM2.5 concentrations occurred over the North China Plain (NCP) during the lockdown period, the emission change only accounted for 8.6 % of PM2.5 reductions and even led to substantial increases in O3. The meteorological variation instead dominated the changes in PM2.5 concentrations over the NCP, which contributed 90 % of the PM2.5 reductions over most parts of the NCP region. Meanwhile, our results suggest that the local stagnant meteorological conditions, together with inefficient reductions of PM2.5 emissions, were the main drivers of the unexpected PM2.5 pollution in Beijing during the lockdown period. These results highlighted that traffic control as a separate pollution control measure has limited effects on the coordinated control of O3 and PM2.5 concentrations under current complex air pollution conditions in China. More comprehensive and balanced regulations for multiple precursors from different sectors are required to address O3 and PM2.5 pollution in China.

Hydrological simulations are a main method of quantifying the contribution rate (CR) of climate change (CC) and human activities (HAs) to watershed streamflow changes. However, the uncertainty of hydrological simulations is rarely considered in current research. To fill this research gap, based on the Soil and Water Assessment Tool (SWAT) model, in this study, we propose a new framework to quantify the CR of CC and HAs based on the posterior histogram distribution of hydrological simulations. In our new quantitative framework, the uncertainty of hydrological simulations is first considered to quantify the impact of “equifinality for different parameters”, which is common in hydrological simulations. The Lancang River (LR) basin in China, which has been greatly affected by HAs in the past 2 decades, is then selected as the study area. The global gridded monthly sectoral water use data set (GMSWU), coupled with the dead capacity data of the large reservoirs within the LR basin and the Budyko hypothesis framework, is used to compare the calculation result of the novel framework. The results show that (1) the annual streamflow at Yunjinghong station in the Lancang River basin changed abruptly in 2005, which was mainly due to the construction of the Xiaowan hydropower station that started in October 2004. The annual streamflow and annual mean temperature time series from 1961 to 2015 in the LR basin showed significant decreasing and increasing trends at the α= 0.01 significance level, respectively. The annual precipitation showed an insignificant decreasing trend. (2) The results of quantitative analysis using the new framework showed that the reason for the decrease in the streamflow at Yunjinghong station was 42.6 % due to CC, and the remaining 57.4 % was due to HAs, such as the construction of hydropower stations within the study area. (3) The comparison with the other two methods showed that the CR of CC calculated by the Budyko framework and the GMSWU data was 37.2 % and 42.5 %, respectively, and the errors of the calculations of the new framework proposed in this study were within 5 %. Therefore, the newly proposed framework, which considers the uncertainty of hydrological simulations, can accurately quantify the CR of CC and HAs to streamflow changes. (4) The quantitative results calculated by using the simulation results with the largest Nash–Sutcliffe efficiency coefficient (NSE) indicated that CC was the dominant factor in streamflow reduction, which was in opposition to the calculation results of our new framework. In other words, our novel framework could effectively solve the calculation errors caused by the “equifinality for different parameters” of hydrological simulations. (5) The results of this case study also showed that the reduction in the streamflow in June and November was mainly caused by decreased precipitation and increased evapotranspiration, while the changes in the streamflow in other months were mainly due to HAs such as the regulation of the constructed reservoirs. In general, the novel quantitative framework that considers the uncertainty of hydrological simulations presented in this study has validated an efficient alternative for quantifying the CR of CC and HAs to streamflow changes.

Vegetation detection aims to find the area which should be attributed with the labels of vegetation on the captured images, such as forest, grass land etc., and nowadays it is a key research topic in the field of remote sensing information processing and application. Over the last few years, the deep learning method based on convolutional neural network (CNN) has become the mainstream method for vegetation detection. However, due to the peculiarities of the underlying encoding and decoding structures, it is common for some CNN methods to loss some boundary details of vegetation when employing high-resolution images with rich details and clear boundaries. In order to improve the boundary localization capability of vegetation, this paper proposes a hybrid solution, i.e., an MLP (MultiLayer Perceptron)-based high-resolution image adaptive superpixels vegetation detection method. Compared with the traditional watershed transform algorithm, this method adopts the two-step boundary marching criterion to generate superpixels with more adherent boundary and compact regularity which contains adaptive neighborhood information by design. Based on the generated superpixels with boundary detail information, this paper applies MLP for binary predictions, i.e., vegetation or non-vegetation. The experimental results show that our method has more precise vegetation boundary localization and higher accuracy compared with several state-of-the-art methods on the UAV image data set and ISPRS data set.

Using a new high-resolution air quality reanalysis dataset for China for five winters from December 2013 to February 2018, we examine the influence of large-scale circulation on daily PM2.5 variability through its direct effect on key regional meteorological variables over three major populated regions of China: Beijing–Tianjin–Hebei (BTH), the Yangtze River Delta (YRD) and the Pearl River Delta (PRD). In BTH, a shallow East Asian trough curbs northerly cold and dry air from the Siberian High, enhancing PM2.5 pollution levels. Weak southerly winds in eastern and southern China, associated with a weakened Siberian High, suppress horizontal dispersion, contributing to air pollution accumulation over YRD. In PRD, weak southerly winds and precipitation deficits over southern China are conducive to high PM2.5 pollution levels. To account for these dominant large-scale circulation–PM2.5 relationships, we propose three new circulation-based indices for predicting different levels of air pollution based on regional PM2.5 concentrations in each region: a 500 hPa geopotential height-based index for BTH, a sea level pressure-based index for YRD and an 850 hPa meridional wind-based index for PRD. These three indices can effectively distinguish clean days from heavily polluted days in these regions, assuming variation is solely due to meteorology. We also find that including the most important regional meteorological variable in each region improves the performance of the circulation-based indices in predicting daily PM2.5 concentrations on the regional scale. These results are beneficial to understanding and forecasting the occurrence of heavily polluted PM2.5 days in BTH, YRD and PRD from a large-scale perspective.

This paper proposed the method to generate triple epipolar images in tristereo imaging on the same orbit mode. It generated projection tie points based on double projection surface in object space, and designed conversion model from epipolar images to its corresponding original images on the basis of projection tie points and created the RPC of epipolar images. During stereo matching one stereo image pairs are used as the basic pair and proposed the rapid transformation model between the current matching points and the corresponding point on the third image, which accomplished the combination of epipolar stereo matching and object space geometric constraints. After left/right bidirectional matching and occlusion area checking, a third matching was implemented. The cost of occlusion area will use the smallest one among the three and these areas were revamped. SGM was used as the optimization strategy. Experiments in three typical areas using Pleiades and ZY-3 as data recourses show that the loss of precision is negligible in the proposed epipolar image generation method. The proposed matching method combines the best of both object geometric constraint method and isolate epipolar image pair method, and the computational efficiency significantly better than these two methods. Lastly, the precision of the proposed method is significantly better than these two methods in building area and weak texture area.

Introduction The Crisis Response Team (CRT) is an interprofessional collaboration between the Singapore Police Force (SPF) and the Mental Health Helpline (MHH) of the Institute of Mental Health (IMH). Supported by a multidisciplinary team comprising of the SPF, IMH psychiatrists, community psychiatric nurses and crisis counsellors, and community partners, this intervention aims to support suicidal individuals, depending on their risk severity, residing in the community. Objectives To present the CRT work process and to explore the characteristics and outcomes of suicide-related cases referred. Methods In this descriptive research study, a quantitative approach is adopted. An Excel file shared across the helpline counsellors is used to collate information of the referred cases. Data collected from October 2021 to August 2022 were evaluated using the IBM SPSS Statistics for Windows v28.0. Descriptive statistics were used to summarise the characteristics and outcomes of the cases. Results Figure 1 shows the CRT work process. To standardise the method of assessing both suicide ideation and behaviour, the Columbia-Suicide Severity Rating Scale (C-SSRS) is utilised. As compared to other suicide ideation and behaviour scales, the C-SSRS has demonstrated good convergent and divergent validity, high sensitivity and specificity for suicidal classifications, and moderate to strong internal consistency (Cronbach’s α: 0.73 - 0.95) (Posner et al. AJP 2011; 168(12) 1266-1277). A total of 3,386 suicide-related cases was referred. The age range of the suicide-related cases range from 8 – 97 years old (M = 36, SD = 17.33). Of these 3,386 cases, 627 cases were discharged back to their family members/employer/friend/partner and with follow-up check-in calls by the MHH counsellors, 416 cases were sent to the restructured hospitals for organic workup, 2,268 cases were brought back to IMH, 55 cases were discharged back to the SPF for further investigation, and 20 cases warranted CRT home visit activations. Figure 2 shows the total number of referred cases and outcome of these cases in each month. Image: Image 2: Conclusions The CRT intervention could mitigate suicide risk and pressure on the mental health system (i.e., reduce unnecessary emergency room visits and hospital admissions), create greater mental health awareness, and facilitate individuals’ connection to mental healthcare services (i.e., in hospitals and/or in the community) as evidenced by the increasing number of cases referred, and increased collaboration with the various stakeholders, ensuring timely intervention and necessary follow-ups thereafter. Disclosure of Interest None Declared

Many efforts have been devoted to quantifying the impact of intercontinental transport on global air quality by using global chemical transport models with horizontal resolutions of hundreds of kilometers in recent decades. In this study, a global online air quality source–receptor model (GNAQPMS-SM) is designed to effectively compute the contributions of various regions to ambient pollutant concentrations. The newly developed model is able to quantify source–receptor (S-R) relationships in one simulation without introducing errors by nonlinear chemistry. We calculate the surface and planetary boundary layer (PBL) S-R relationships in 19 regions over the whole globe for ozone (O3), black carbon (BC), and non-sea-salt sulfate (nss-sulfate) by conducting a high-resolution (0.5&deg &times 0.5&deg) simulation for the year 2018. The model exhibits a realistic capacity in reproducing the spatial distributions and seasonal variations of tropospheric O3, carbon monoxide, and aerosols at global and regional scales – Europe (EUR), North America (NAM), and East Asia (EA). The correlation coefficient (R) and normalized mean bias (NMB) for seasonal O3 at global background and urban–rural sites ranged from 0.49 to 0.87 and −2 % to 14.97 %, respectively. For aerosols, the R and NMB in EUR, NAM, and EA mostly exceed 0.6 and are within ±15 %. These statistical parameters based on this global simulation can match those of regional models in key regions. The simulated tropospheric nitrogen dioxide and aerosol optical depths are generally in agreement with satellite observations. The model overestimates ozone concentrations in the upper troposphere and stratosphere in the tropics, midlatitude, and polar regions of the Southern Hemisphere due to the use of a simplified stratospheric ozone scheme and/or biases in estimated stratosphere–troposphere exchange dynamics. We find that surface O3 can travel a long distance and contributes a non-negligible fraction to downwind regions. Non-local source transport explains approximately 35 %–60 % of surface O3 in EA, South Asia (SAS), EUR, and NAM. The O3 exported from EUR can also be transported across the Arctic Ocean to the North Pacific and contributes nearly 5 %–7.5 % to the North Pacific. BC is directly linked to local emissions, and each BC source region mainly contributes to itself and surrounding regions. For nss-sulfate, contributions of long-range transport account for 15 %–30 % within the PBL in EA, SAS, EUR, and NAM. Our estimated international transport of BC and nss-sulfate is lower than that from the Hemispheric Transport of Air Pollution (HTAP) assessment report in 2010, but most surface O3 results are within the range. This difference may be related to the different simulation years, emission inventories, vertical and horizontal resolutions, and S-R revealing methods. Additional emission sensitivity simulation shows a negative O3 response in receptor region EA in January from EA. The difference between two methods in estimated S-R relationships of nss-sulfate and O3 are mainly due to ignoring the nonlinearity of pollutants during chemical processes. The S-R relationship of aerosols within EA subcontinent is also assessed. The model that we developed creates a link between the scientific community and policymakers. Finally, the results are discussed in the context of future model development and analysis opportunities.

The uptake of Co(II) on graphene oxide (GO) by an adsorption process as a function of pH and ionic strength in the absence and presence of humic acid (HA) or fulvic acid (FA) was studied using batch technique. The results indicated that the uptake is strongly dependent on pH but independent of ionic strength. A stimulative effect of HA/FA on Co(II) uptake was found at pH < 7.0, whereas an inhibitory effect was observed at pH > 7.0. Kinetic studies suggest that Co(II) uptake on GO could be described more favorably by the pseudo-second-order kinetic model. The uptake isotherms can be described better by the Langmuir, Freundlich, and D-R models than by the linear model. The thermodynamic data calculated from the temperature-dependent uptake isotherms suggests that the uptake of Co(II) on GO is spontaneous and endothermic. Results of this work are of great importance for the environmental application of GO in the treatment of Co(II) from wastewater and indicated that GO is promising for the natural attenuation of Co(II) and related metal ions from aqueous solution.

Based on source-specific saccharide tracers, the characteristics of biomass burning (BB) and biogenic emissions of saccharides were investigated in three rural sites at Lincang, which is 65 % covered with forest in the southwest border of China. The total saccharides accounted for 8.4 ± 2.7 % of organic carbon (OC) and 1.6 ± 0.6 % of PM2.5. The measured anhydrosugars accounted for 48.5 % of total saccharides, among which levoglucosan was the most dominant species. The high level of levoglucosan was both attributed to the local BB activities and biomass combustion smoke transported from the neighboring regions of Southeast Asia (Myanmar) and the northern Indian subcontinent. The measured mono- or disaccharides and sugar alcohols accounted for 24.9 ± 8.3 % and 26.6 ± 9.9 % of the total saccharides, respectively, and both proved to be mostly emitted by direct biogenic volatilization from plant material or surface soils rather than byproducts of polysaccharide breakdown during BB processes. Five sources of saccharides were resolved by non-negative matrix factorization (NMF) analysis, including BB, soil microbiota, plant senescence, airborne pollen, and plant detritus with contributions of 34.0 %, 16.0 %, 21.0 %, 23.7 %, and 5.3 %, respectively. The results provide information on the magnitude of levoglucosan and contributions of BB, as well as the characteristic of biogenic saccharides, at the remote sites of southwest China, which can be further applied to regional source apportionment models and global climate models.

As one of the most common types of interference, pulse interference and its suppression methods have been widely studied, in which the blanking method consumes less hardware resources and it is more commonly used in the Global Navigation Satellite System (GNSS) receivers. Previous studies used carrier-to-noise ratio (CNR) as an indicator to evaluate the performance of the receiver after pulse suppression. However, CNR is not the most important parameter that should be measured. The main function of the GNSS receiver is to measure the distance between the satellite and the receiver. How the pulse interference with different periods and duty cycle affects the ranging performance of the navigation receiver after blanking has not been fully studied. This paper focuses on the influence of the blanking method on the code tracking performance. Through derivation and simulation, it can be found that the ranging accuracy of the delay locked loop may not be deteriorated sometimes when the blanking operation plays a role of narrow correlation and the frequency of the pulse interference is close to the pseudo code. However, the blanking algorithm will cause large code tracking deviation, which will seriously affect the ranging performance of the receiver.

The anthropogenic emission of sulfur dioxide (SO2) over China has significantly declined as a consequence of the clean air actions. In this study, we have developed a new emission inversion system based on a four-dimensional local ensemble transform Kalman filter (4D-LETKF) and the Weather Research and Forecasting model coupled with Chemistry (WRF-Chem) to dynamically update the SO2 emission grid by grid over China by assimilating the ground-based hourly SO2 observations. Sensitivity tests for the assimilation system have been conducted firstly to tune four system parameters: ensemble size, horizontal and temporal localization lengths, and perturbation size. Our results reveal that the same random perturbation factors used throughout the whole model grids with assimilating observations within about 180 km can efficiently optimize the SO2 emission, whereas the ensemble size has only little effect. The temporal localization by assimilating only the subsequent hourly observations can reveal the diurnal variation of the SO2 emission, which is better than updating the magnitude of SO2 emission every 12 h by assimilating all the observations within the 12 h window. The inverted SO2 emission over China in November 2016 has declined by an average of 49.4 % since 2010, which is well in agreement with the bottom-up estimation of 48.0 %. Larger reductions of SO2 emission are found over the a priori higher source regions such as the Yangtze River Delta (YRD). The simulated SO2 surface mass concentrations using two distinguished chemical reaction mechanisms are both much more comparable to the observations with the newly inverted SO2 emission than those with the a priori emission. These indicate that the newly developed emission inversion system can efficiently update the SO2 emissions based on the routine surface SO2 observations. The reduced SO2 emission induces the sulfate and PM2.5 surface concentrations to decrease by up to 10 µg m−3 over central China.

A 6-year-long high-resolution Chinese air quality reanalysis (CAQRA) dataset is presented in this study obtained from the assimilation of surface observations from the China National Environmental Monitoring Centre (CNEMC) using the ensemble Kalman filter (EnKF) and Nested Air Quality Prediction Modeling System (NAQPMS).This dataset contains surface fields of six conventional air pollutants in China (i.e. PM2.5, PM10, SO2, NO2, CO, and O3) for the period 2013–2018 at high spatial (15 km×15 km) and temporal (1 h) resolutions. This paper aims to document this dataset by providing detailed descriptions of the assimilation system and the first validation results for the above reanalysis dataset. The 5-fold cross-validation (CV) method is adopted to demonstrate the quality of the reanalysis. The CV results show that the CAQRA yields an excellent performance in reproducing the magnitude and variability of surface air pollutants in China from 2013 to 2018 (CV R2=0.52–0.81, CV root mean square error (RMSE) =0.54 mg/m3 for CO, and CV RMSE =16.4–39.3 µg/m3 for the other pollutants on an hourly scale). Through comparison to the Copernicus Atmosphere Monitoring Service reanalysis (CAMSRA) dataset produced by the European Centre for Medium-Range Weather Forecasts (ECWMF), we show that CAQRA attains a high accuracy in representing surface gaseous air pollutants in China due to the assimilation of surface observations. The fine horizontal resolution of CAQRA also makes it more suitable for air quality studies on a regional scale. The PM2.5 reanalysis dataset is further validated against the independent datasets from the US Department of State Air Quality Monitoring Program over China, which exhibits a good agreement with the independent observations (R2=0.74–0.86 and RMSE =16.8–33.6 µg/m3 in different cities). Furthermore, through the comparison to satellite-estimated PM2.5 concentrations, we show that the accuracy of the PM2.5 reanalysis is higher than that of most satellite estimates. The CAQRA is the first high-resolution air quality reanalysis dataset in China that simultaneously provides the surface concentrations of six conventional air pollutants, which is of great value for many studies, such as health impact assessment of air pollution, investigation of air quality changes in China, model evaluation and satellite calibration, optimization of monitoring sites, and provision of training data for statistical or artificial intelligence (AI)-based forecasting. All datasets are freely available at https://doi.org/10.11922/sciencedb.00053 (Tang et al., 2020a), and a prototype product containing the monthly and annual means of the CAQRA dataset has also been released at https://doi.org/10.11922/sciencedb.00092 (Tang et al., 2020b) to facilitate the evaluation of the CAQRA dataset by potential users.

The hypersonic transient flow pass a blunt cone under three types of pulse disturbances is calculated using DNS. The response characteristic of hypersonic boundary layer among different types of pulse disturbance is compared. The distribution and evolution characteristics of disturbance modes are investigated by mode analysis. Results indicate that the receptivity characteristics induced by freestream pulse wave have both similarities and differences with that induced by freestream continuous wave. The interactions of different types of pulse waves with boundary layer and bow shock present different characteristics. The boundary layer thermodynamic characteristics under pulse fast acoustic wave are sensitive to mainstream disturbance wave, and that under pulse slow acoustic wave are sensitive to residual reflection wave. The type of pulse disturbance wave has a great influence on the production and mode distribution of boundary layer disturbance wave. In general, the disturbance amplitude in the pulse fast acoustic wave situation is the largest, the case of entropy wave is the second, and the case of slow acoustic wave is the smallest. For regional influence, the type of pulse disturbance has a huge impact on the disturbance modes in both the head and the non-head. For the three cases of pulse wave, the main mode group attenuation phenomenon which narrows the disturbance frequency band exists in the boundary layer. This group attenuation is the fastest for freestream slow acoustic wave, followed by entropy wave, and then fast acoustic wave. Under the action of pulse slow acoustic waves, the disturbance wave evolution of each order mode in the boundary layer along the streamwise is relatively stable, followed by entropy wave, and the case of fast acoustic wave is the most active.

The full-waveform data is the core data of GaoFen-7 (GF-7) satellite laser altimeter, and evaluation of waveform data quality is an important step and premise for satellite laser altimetry and quality control. In this paper, the full waveform data quality assessment and analysis of GF-7 laser altimeter is implemented during the period of on-orbit experiment, and the real waveform data of many orbits is used to quantitatively describe the characteristic parameters of the transmitted waveform and the signal-to-noise ratio (SNR), and the result of two beam lasers is compared. The conclusion is validated that the GF-7 laser altimeter can obtain effective waveform data and the echo waveform availability of the experimental data is approximate 72.59%, moreover, the quality of beam 1 is slightly better than that of the beam 2. The laser temperature is an important indication of the quality of transmitted waveform according to the SNR changing. The good SNR value of the waveform and small footprint size will be helpful for the terrain information extraction and analysis, although the repetition frequency is low.

The Antarctic plays a vital role in the Earth system. However, our poor knowledge of the Antarctic limits predicting and projecting future climate changes and sea level rising due to rapid changing of the Antarctic. Airborne platforms can access most places of this hostile and remote continent and measure subice properties with high resolution and accuracy. China deployed the first fixed-wing airplane of “Snow Eagle 601” for Antarctic expeditions in 2015. Airborne scientific instruments, including radio-echo sounder, gravimeter, magnetometer, laser altimeter etc., were configured and integrated on the airplane. In the past four years, the airborne platform has been applied to survey the Princess Elizabeth Land, the largest data gap in Antarctica, Amery Ice Shelf and other critical areas in East Antarctica, and overall ∼150,000 km flight lines have been completed. Here, we introduced the “Snow Eagle 601” airborne platform and base stations, as well as field operations of airborne survey, including aviation supports, daily cycle of the scientific flight, data processing and quality control, and finally summarized progress of airborne survey in the past four years.

With China’s first stereo imaging satellite ZY-3’s successful launch and two satellites networking operation, space remote sensing becomes an important means of data acquisition for survey and mapping, and geographic information updating in China.The updating period of 4D products in China is shortened by one third, the geographic information updating capability was improved more than 2 times.After more than eight years of stable and continued earth observation, ZY-3 statellites data coverage has gradually achieved more than half of the earth land which enables the overseas service for global geospatial application. Focusing on the Chinese domestic mapping applications and services, the data of ZY-3 and other domestic land observation satellites can be real-time pushed and distributed across China through the satellite cloud service platform, and worldwide for facilitating the "Belt and Road" initiative, which is promoted through the GEOSS as well for global application.This paper presents the overseas geometric accuracy evaluation and validation of ZY-3 satellites images, which was carried out systematically for the first time abroad and complements with China’s mapping evaluation practices to provide a comprehensive technical guidelines for global mapping application. The direct location accuracy of ZY-3 satellites sensor corrected image products were further evaluated and verified cooperating with the University of Vienna, Austria. The location deviations in mountain area and in flat area were analyzed and compared to check the deviation pattern and validate their consistency with the results in China.Utilizing China’s ZY-3 satellites images ranging from 2012–2018, the DSM was generated automatically based on a semiglobal optimization method (Yue et al. 2016) using self-developed software SDP without ground control points but using SRTM data as elevation reference to improve the geometric accuracy. The result shows the elevation accuracy of DSM is 3.19 m (RMSE), satisfying the local requirement for 10m interval contour mapping.The planar accuracy of DOM generated without ground control points utilizing ZY-3 satellites images within 2012–2015 is 2.46 m (RMSE). With 128 orthorectified aerial photo slots provided by NGD of Laos as reference, the planar accuracy of the DOM generated utilizing ZY-3 satellites images from 2016–2018 is 1.65 m (RMSE), which can satisfy the local 1:25000 planar accuracy requirement and overlay with the local 1:2000 transportation data exactly. The overseas geometric accuracy evaluation and validation of ZY-3 satellites images provides a systematic and practical guidance for future global applications by complementing with china’s experience, which would be beneficial to overseas users in acknowledging the usage of ZY-3 satellites data and help to promote it’s global applications.

Abstract Using a sample of $$1.31\times 10^{9} ~J/\psi $$ 1.31×109J/ψ events collected with the BESIII detector, we perform a study of $$J/\psi \rightarrow \gamma K{\bar{K}}\eta '$$ J/ψ→γKK¯η′ . X(2370) is observed in the $$K{\bar{K}}\eta '$$ KK¯η′ invariant-mass distribution with a statistical significance of $$8.3\sigma $$ 8.3σ . Its resonance parameters are measured to be $$M=2341.6\pm 6.5 \, \text {(stat.)} \pm 5.7 \, \text {(syst.)}~ \hbox {MeV}/c^{2}$$ M=2341.6±6.5(stat.)±5.7(syst.)MeV/c2 and $$\Gamma = 117\pm 10 \, \text {(stat.)}\pm 8 \, \text {(syst.)}~\hbox {MeV}$$ Γ=117±10(stat.)±8(syst.)MeV . The product branching fractions for $$J/\psi \rightarrow \gamma X(2370),X(2370)\rightarrow K^{+}K^{-}\eta '$$ J/ψ→γX(2370),X(2370)→K+K-η′ and $$J/\psi \rightarrow \gamma X(2370),X(2370)\rightarrow K_{S}^{0}K_{S}^{0}\eta '$$ J/ψ→γX(2370),X(2370)→KS0KS0η′ are determined to be $$(1.79\pm 0.23\, \text {(stat.)}\pm 0.65\,\text {(syst.)})\times 10^{-5}$$ (1.79±0.23(stat.)±0.65(syst.))×10-5 and $$(1.18\pm 0.32\, \text {(stat.)}\pm 0.39\, \text {(syst.)})\times 10^{-5}$$ (1.18±0.32(stat.)±0.39(syst.))×10-5 , respectively. No evident signal for X(2120) is observed in the $$K{\bar{K}}\eta '$$ KK¯η′ invariant-mass distribution. The upper limits for the product branching fractions of $${\mathcal {B}}(J/\psi \rightarrow \gamma X(2120)\rightarrow \gamma K^{+} K^{-} \eta ')$$ B(J/ψ→γX(2120)→γK+K-η′) and $${\mathcal {B}}(J/\psi \rightarrow \gamma X(2120)\rightarrow \gamma K_{S}^{0} K_{S}^{0} \eta ')$$ B(J/ψ→γX(2120)→γKS0KS0η′) are determined to be $$1.49\times 10^{-5}$$ 1.49×10-5 and $$6.38\times 10^{-6}$$ 6.38×10-6 at the 90% confidence level, respectively.

The internal layers of ice sheets from ice-penetrating radar (IPR) investigation preserve critical information about the englacial conditions and ice-flow field. This paper presents a new detailed analysis of the spatial distribution characteristics of internal layers and subglacial topography of East Antarctic ice sheet (EAIS) from Zhongshan station to Dome A. Taking the internal layering continuity index (ILCI) and basal roughness as indicators, it provides an opportunity to evaluate the past internal environment and dynamics of ice sheet. The radar data of 1244 km along a traverse between Zhongshan Station and Dome A of EAIS was collected during the 29th Chinese National Antarctic Research Expedition (CHINARE 29, 2012/2013). Except for the upstream of Lambert Glacier, the patterns of the folds in the internal layers are basically similar to the bed topography. The relatively flat basal topography and the decrease of ILCI with the deepening of the depth provide evidence for identifying previous rapid ice flow areas that the satellite cannot obtain, especially in the upstream of Lambert Glacier. Well continuous internal layers of Dome A almost extend to the bed, with high ILCI and high roughness characteristics. There are three kinds of basal roughness patterns in the whole traverse. The characteristics of the internal layer and basal topography of the traverse between Zhongshan Station and Dome A provide new information for understanding the ancient ice-flow activity and the historical evolution of EAIS.

It’s easily to obtain the geometric information of terrain features in a timely manner using advanced surveying and mapping methods, but it is impossible to obtain their semantic information with low latency due to the rapid development of cities. The popularity of GPS-enabled devices and technologies provide us a large number of personal location information. Moreover, it is possible to extract the personal or group behavior pattern due to the regularity of human behavior. Those conditions make it possible to extract and identify human behavior patterns from their trajectory data. In this paper, we present an automatic semantic map generation method that extract semantic patterns and take advantage of them to tagging spatial objects in an unknown region based on known semantic patterns. We study the regularity of trajectory data and build the semantic pattern based on the regularity of human behavior. Most importantly, we use known semantic patterns to identify the semantics of the stay points in the unknown region, and use this method to realize the semantic recognition of the stay points. Results of the experiments show the effectiveness of our proposed method.

The lithospheric mantle structure of the Antarctic continent is of great significance of studying the polymerization and fragmentation mechanism of Gondwana and the plate movement law. Long-period magnetotelluric (LMT) is an important method to study the electrical structure of earth crust and mantle. However, been limited by the bad natural environment and logistics supply difficulties, there is no LMT record of Antarctica before. In 2018, China's 34th Antarctic scientific expedition carried out the LMT survey at the eastern edge of the Antarctic continent with a frequency range of 0.00015 Hz to 0.1 Hz. After the processing and analysis, we get three points as fellow: (1) The lithospheric mantle of Antarctica has a three-dimensional resistivity structure; (2) There are low resistivity regions in the Antarctic mantle, which may be related to thermal activity. (3) It is possible to carry out LMT measurements in eastern Antarctic and more can be done in the future.

The present study investigated the effects of ultrasonic seed treatment and Cu application on grain yield, photosynthesis, grain quality, and Cu contents of aromatic rice. The ultrasonic treated and nontreated seeds of two aromatic rice cultivars, i.e., Nongxiang 18 and Meixiangzhan 2, were sown in Cu-contaminated soil with 1.5 and 3.0 g(Cu) m-2 whereas the soil without Cu application was taken as control (CK). Ultrasonic seed treatment and Cu application increased grain yield by 2.7-33.5% in Nongxiang 18 and by 12.9-20.2% in Meixiangzhan 2 owing to substantial improvements in morphophysiological and yield-related traits. Both ultrasonic seed treatment and Cu application also improved the 2-acetyl-1-pyrroline contents as a result of increased proline contents and proline dehydrogenase activity. The Cu contents in plant parts were higher in Cu-containing soil than that of CK. Overall, ultrasonic seed treatment and optimum Cu application improved aromatic rice grain yield, dry biomass, aroma, and grain quality of aromatic rice.

Soil heterotrophic respiration (RH) is one of the largest and most uncertain components of the terrestrial carbon cycle, directly reflecting carbon loss from soils to the atmosphere. However, high variations and uncertainties of RH existing in global carbon cycling models require RH estimates from different angles, e.g., a data-driven angle. To fill this knowledge gap, this study applied a Random Forest (RF) algorithm (a machine learning approach) to (1) develop a globally gridded RH dataset and (2) investigate its spatial and temporal patterns from 1980 to 2016 at the global scale by linking field observations from the Global Soil Respiration Database and global environmental drivers (temperature, precipitation, soil water content, etc.). Finally, a globally gridded RH dataset was developed covering from 1980 to 2016 with a spatial resolution of half a degree and a temporal resolution of 1 year. Globally, the average annual RH was 57.2±0.6 Pg C a−1 from 1980 to 2016, with a significantly increasing trend of 0.036±0.007 Pg C a−2. However, the temporal trend of the carbon loss from RH varied in climate zones, and RH showed a significant and increasing trend in boreal and temperate areas. In contrast, such a trend was absent in tropical regions. Temperature-driven RH dominated 39 % of global land and was primarily distributed at high-latitude areas. The areas dominated by precipitation and soil water content were mainly semiarid and tropical areas, accounting for 36 % and 25 % of global land area, respectively, suggesting variations in the dominance of environmental controls on the spatial patterns of RH. The developed globally gridded RH dataset will further aid in the understanding of the mechanisms of global soil carbon dynamics, serving as a benchmark to constrain terrestrial biogeochemical models. The dataset is publicly available at https://doi.org/10.6084/m9.figshare.8882567 (Tang et al., 2019a).

Despite the significant progress in improving chemical transport models (CTMs), applications of these modeling endeavors are still subject to large and complex model uncertainty. The Model Inter-Comparison Study for Asia III (MICS-Asia III) has provided the opportunity to assess the capability and uncertainty of current CTMs in East Asian applications. In this study, we have evaluated the multi-model simulations of nitrogen dioxide (NO2), carbon monoxide (CO) and ammonia (NH3) over China under the framework of MICS-Asia III. A total of 13 modeling results, provided by several independent groups from different countries and regions, were used in this study. Most of these models used the same modeling domain with a horizontal resolution of 45 km and were driven by common emission inventories and meteorological inputs. New observations over the North China Plain (NCP) and Pearl River Delta (PRD) regions were also available in MICS-Asia III, allowing the model evaluations over highly industrialized regions. The evaluation results show that most models captured the monthly and spatial patterns of NO2 concentrations in the NCP region well, though NO2 levels were slightly underestimated. Relatively poor performance in NO2 simulations was found in the PRD region, with larger root-mean-square error and lower spatial correlation coefficients, which may be related to the coarse resolution or inappropriate spatial allocations of the emission inventories in the PRD region. All models significantly underpredicted CO concentrations in both the NCP and PRD regions, with annual mean concentrations that were 65.4 % and 61.4 % underestimated by the ensemble mean. Such large underestimations suggest that CO emissions might be underestimated in the current emission inventory. In contrast to the good skills for simulating the monthly variations in NO2 and CO concentrations, all models failed to reproduce the observed monthly variations in NH3 concentrations in the NCP region. Most models mismatched the observed peak in July and showed negative correlation coefficients with the observations, which may be closely related to the uncertainty in the monthly variations in NH3 emissions and the NH3 gas–aerosol partitioning. Finally, model intercomparisons have been conducted to quantify the impacts of model uncertainty on the simulations of these gases, which are shown to increase with the reactivity of species. Models contained more uncertainty in the NH3 simulations. This suggests that for some highly active and/or short-lived primary pollutants, like NH3, model uncertainty can also take a great part in the forecast uncertainty in addition to the emission uncertainty. Based on these results, some recommendations are made for future studies.

Belowground autotrophic respiration (RA) is one of the largest but most highly uncertain carbon flux components in terrestrial ecosystems. However, RA has not been explored globally before and still acts as a “black box” in global carbon cycling currently. Such progress and uncertainty motivate the development of a global RA dataset and understanding its spatial and temporal patterns, causes, and responses to future climate change. We applied the random forest (RF) algorithm to upscale an updated dataset from the Global Soil Respiration Database (v4) – covering all major ecosystem types and climate zones with 449 field observations, using globally gridded temperature, precipitation, soil and other environmental variables. We used a 10-fold cross validation to evaluate the performance of RF in predicting the spatial and temporal pattern of RA. Finally, a globally gridded RA dataset from 1980 to 2012 was produced with a spatial resolution of 0.5∘ × 0.5∘ (longitude × latitude) and a temporal resolution of 1 year (expressed in g C m−2 yr−1; grams of carbon per square meter per year). Globally, mean RA was 43.8±0.4 Pg C yr−1, with a temporally increasing trend of 0.025±0.006 Pg C yr−2 from 1980 to 2012. Such an incremental trend was widespread, representing 58 % of global land. For each 1 ∘C increase in annual mean temperature, global RA increased by 0.85±0.13 Pg C yr−2, and it was 0.17±0.03 Pg C yr−2 for a 10 mm increase in annual mean precipitation, indicating positive feedback of RA to future climate change. Precipitation was the main dominant climatic driver controlling RA, accounting for 56 % of global land, and was the most widely spread globally, particularly in dry or semi-arid areas, followed by shortwave radiation (25 %) and temperature (19 %). Different temporal patterns for varying climate zones and biomes indicated uneven responses of RA to future climate change, challenging the perspective that the parameters of global carbon stimulation are independent of climate zones and biomes. The developed RA dataset, the missing carbon flux component that is not constrained and validated in terrestrial ecosystem models and Earth system models, will provide insights into understanding mechanisms underlying the spatial and temporal variability in belowground vegetation carbon dynamics. The developed RA dataset also has great potential to serve as a benchmark for future data–model comparisons. The developed RA dataset in a common NetCDF format is freely available at https://doi.org/10.6084/m9.figshare.7636193 (Tang et al., 2019).

Currently, Coronavirus Disease 2019 (COVID-19)—a respiratory contagion spreading through expiratory droplets—has evolved into a global pandemic, severely impacting the public health. Importantly, the emerging of immune evasion SARS-CoV-2 variants and the limited effect of current antivirals against SARS-CoV-2 in clinical trials suggested that alternative strategies in addition to the conventional vaccines and antivirals are required to successfully control the COVID-19 pandemic. Here, we propose to use liquid-repellent coatings to prevent the spread of the disease in the absence of effective vaccines, antimicrobial agents, or therapeutics, wherein the deposition and penetration of pathogen droplets are prohibited. We use SARS-CoV-2 as a model pathogen and find that SARS-CoV-2 remnants are reduced by seven orders of magnitude on coated surfaces, yielding a repelling efficacy far outperforming the inactivation rate of disinfectants. The SARS-CoV-2 remnant scales exponentially with the liquid/solid adhesion, uncovering the mechanism and effective means for minimizing pathogen attachment. The antipathogen coating that both repels and inactivates pathogens is demonstrated by incorporating the super-liquid-repellent coating with antipathogen additives. Together with its versatility over a wide range of substrates and pathogens, the novel antipathogen coating is of considerable value for infection control in everyday life as well as during pandemics.

Mitogen-activated protein kinases (MAPKs) are significant components of MAPK cascades, which play versatile roles in different transduction pathways to mediate stress adaptation. However, little information is known about post-transcriptional regulation of MAPK genes in plant under drought stress. MicroRNAs (miRNAs), a class of newly identified, short non-coding RNAs, regulate the expression of target genes in plant growth, development, and stress responses. In order to investigate the mechanism of miRNA regulating MAPK genes in potato, we identified a novel potato miRNA with the sequence CGGCCTTAATAAGATGGTGAAG and named it as stu-miR856 depending on miRNA deep sequencing and bioinformatic analysis. Target prediction indicates that it can bind to the coding sequence region of two potato MAPK-like genes, and cleavage positions of them were also effectively validated by RNA ligase-mediated 5' rapid amplification of cDNA ends assay. In addition, expressional analysis shows that stu-miR856 and its targets exhibited an opposite expression pattern: stu-miR856 expression significantly decreased while its target genes greatly increased in the different stages of drought treatment. The results indicate that a decreased expression of stu-miR856 might drive overexpression of two StMAPK genes family members, which may contribute to regulation of the drought adaptation of potato plants.

Ice-penetrating radar is an effective method for studying the subglacial bedrock and ice information within the Antarctic ice sheet. Because of the low conductivity of ice and the relatively uniform composition of ice sheets in the polar region, ice-penetrating radar can penetrate deeper part of the ice sheet and collect the following data. However, it is still necessary to suppress the noise from radar data to obtain more accurate and effective data. In this paper, the entirely non-recursive Variational Mode Decomposition (VMD) is applied to the data noise reduction of ice-penetrating radar data. VMD is a decomposition method of adaptive and quasi-orthogonal signals, which decomposes airborne radar data into multiple frequency-limited quasi-orthogonal Intrinsic Mode Functions (IMFs). The IMFs containing noise are then removed according to the information distribution in the IMFs component and the remaining IMFs are reconstructed. We implements the method to process the real ice-penetrating radar data, which effectively eliminates the interference noise in the data, improves the signal-to-noise ratio and characterizes the internal layer structure of ice. It is verified that the method can be applied to the noise reduction processing of polar ice-penetrating radar data successful, which provides a better basis for data interpretation. Finally, we present the internal structure within the ice sheet based on VMD denoised radar profile.

Using 16 energy points of e+e− annihilation data collected in the vicinity of the J/ψ resonance with the BESIII detector and with a total integrated luminosity of around 100pb−1, we study the relative phase between the strong and electromagnetic amplitudes of J/ψ decays. The relative phase between J/ψ electromagnetic decay and the continuum process (e+e− annihilation without the J/ψ resonance) is confirmed to be zero by studying the cross section lineshape of μ+μ− production. The relative phase between J/ψ strong and electromagnetic decays is then measured to be (84.9±3.6)∘ or (−84.7±3.1)∘ for the 2(π+π−)π0 final state by investigating the interference pattern between the J/ψ decay and the continuum process. This is the first measurement of the relative phase between J/ψ strong and electromagnetic decays into a multihadron final state using the lineshape of the production cross section. We also study the production lineshape of the multihadron final state ηπ+π− with η→π+π−π0, which provides additional information about the phase between the J/ψ electromagnetic decay amplitude and the continuum process. Additionally, the branching fraction of J/ψ→2(π+π−)π0 is measured to be (4.73±0.44)% or (4.85±0.45)%, and the branching fraction of J/ψ→ηπ+π− is measured to be (3.78±0.68)×10−4. Both of them are consistent with the world average values. The quoted uncertainties include both statistical and systematic uncertainties, which are mainly caused by the low statistics. Keywords: Phase, Strong amplitude, Electromagnetic amplitude, J/ψ decay, BESIII

Precise and rapid air quality simulations and forecasting are limited by the computational performance of the air quality model used, and the gas-phase chemistry module is the most time-consuming function in the air quality model. In this study, we designed a new framework for the widely used the Carbon Bond Mechanism Z (CBM-Z) gas-phase chemical kinetics kernel to adapt the single-instruction, multiple-data (SIMD) technology in next-generation processors to improve its calculation performance. The optimization implements the fine-grain level parallelization of CBM-Z by improving its vectorization ability. Through constructing loops and integrating the main branches, e.g., diverse chemistry sub-schemes, multiple spatial points in the model can be operated simultaneously on vector processing units (VPUs). Two generation CPUs – Intel Xeon E5-2680 V4 CPU and Intel Xeon Gold 6132 – and Intel Xeon Phi 7250 Knights Landing (KNL) are used as the benchmark processors. The validation of the CBM-Z module outputs indicates that the relative bias reaches a maximum of 0.025 % after 10 h integration with -fp-model fast =1 compile flag. The results of the module test show that the Multiple-Points CBM-Z (MP CBM-Z) resulted in 5.16× and 8.97× speedup on a single core of Intel Xeon E5-2680 V4 and Intel Xeon Gold 6132 CPUs, respectively, and KNL had a speedup of 3.69× compared with the performance of CBM-Z on the Intel Xeon E5-2680 V4 platform. For the single-node tests, the speedup on the two generation CPUs can reach 104.63× and 198.50× using message passing interface (MPI) and 101.02× and 194.60× using OpenMP, and the speedup on the KNL node can reach 175.23× using MPI and 167.45× using OpenMP. The speedup of the optimized CBM-Z is approximately 40 % higher on a one-socket KNL platform than on a two-socket Broadwell platform and about 13 %–16 % lower than on a two-socket Skylake platform. We also tested a three-dimensional chemistry transport model (CTM) named Nested Air Quality Prediction Model System (NAQPMS) equipped with the MP CBM-Z. The tests illustrate an obvious improvement on the performance for the CTM after adopting the MP CBM-Z. The results show that the MP CBM-Z leads to a speedup of 3.32 and 1.96 for the gas-phase chemistry module and the CTM on the Intel Xeon E5-2680 platform. Moreover, on the new Intel Xeon Gold 6132 platform, the MP CBM-Z gains 4.90× and 2.22× speedups for the gas-phase chemistry module and the whole CTM. For the KNL, the MP CBM-Z enables a 3.52× speedup for the gas-phase chemistry module, but the whole model lost 24.10 % performance compared to the CPU platform due to the poor performance of other modules. In addition, since this optimization seeks to improve the utilization of the VPU, the model is more suitable for the new generation processors adopting the more advanced SIMD technology. The results of our tests already show that the benefit of updating CPU improved by about 47 % by using the MP CBM-Z since the optimized code has better adaptability for the new hardware. This work improves the performance of the CBM-Z chemical kinetics kernel as well as the calculation efficiency of the air quality model, which can directly improve the practical value of the air quality model in scientific simulations and routine forecasting.

We report a study of the e+e−→D+D−π+π− process using e+e− collision data samples with an integrated luminosity of 2.5fb−1 at center-of-mass energies from 4.36 to 4.60GeV, collected with the BESIII detector at the BEPCII storage ring. The D1(2420)+ is observed in the D+π+π− mass spectrum. The mass and width of the D1(2420)+ are measured to be (2427.2±1.0stat.±1.2syst.)MeV/c2 and (23.2±2.3stat.±2.3syst.)MeV, respectively. In addition, the Born cross sections of the e+e−→D1(2420)+D−+c.c.→D+D−π+π− and e+e−→ψ(3770)π+π−→D+D−π+π− processes are measured as a function of the center-of-mass energy.

Abstract Abyssal manganese nodules have been explored widely for their economic potential and paleoenvironmental significance. Debate about whether biogenic or physical‐chemical processes are responsible for their formation remains because of difficulties in quantifying ancient microbiological contributions. To address this question, we investigated microbial fossils in manganese nodules from the western Pacific Ocean by integrating scanning electron microscope, transmission electron microscope, and synchrotron transmission X‐ray microscope observations. Our results suggest that the nodules host abundant fossil biogenic magnetite and manganese‐oxidizing bacteria. These organisms engage in redox reactions or live in environments with redox gradients. By combining magnetic properties and observations of fossil biogenic magnetite morphology, we estimate magnetofossil abundances and further assess fossil biogenic manganese oxide in nodules. Our results imply that manganese nodule formation appears to be dominated by biomineralization with an additional terrestrial contribution. Extensive biomineralization in ultralow‐productivity oceanic environments suggests that manganese nodule formation is an important aspect of biogeochemical cycling in abyssal seafloor environments.

The four decay modes D0→ϕπ0, D0→ϕη, D+→ϕπ+, and D+→ϕK+ are studied by using a data sample taken at the centre-of-mass energy s=3.773 GeV with the BESIII detector, corresponding to an integrated luminosity of 2.93 fb−1. The branching fractions of the first three decay modes are measured to be B(D0→ϕπ0)=(1.168±0.028±0.028)×10−3, B(D0→ϕη)=(1.81±0.46±0.06)×10−4, and B(D+→ϕπ+)=(5.70±0.05±0.13)×10−3, respectively, where the first uncertainties are statistical and the second are systematic. In addition, the upper limit of the branching fraction for D+→ϕK+ is given to be 2.1×10−5 at the 90% confidence level. The ratio of B(D0→ϕπ0) to B(D+→ϕπ+) is calculated to be (20.49±0.50±0.45)%, which is consistent with the theoretical prediction based on isospin symmetry between these two decay modes. Keywords: BESIII, D meson, Hadronic decays, Branching fractions

Using a data sample of e+e− collision data corresponding to an integrated luminosity of 2.93 fb−1 collected with the BESIII detector at a center-of-mass energy of s=3.773GeV, we search for the singly Cabibbo-suppressed decays D0→π0π0π0, π0π0η, π0ηη and ηηη using the double tag method. The absolute branching fractions are measured to be B(D0→π0π0π0)=(2.0±0.4±0.3)×10−4, B(D0→π0π0η)=(3.8±1.1±0.7)×10−4 and B(D0→π0ηη)=(7.3±1.6±1.5)×10−4 with the statistical significances of 4.8σ, 3.8σ and 5.5σ, respectively, where the first uncertainties are statistical and the second ones systematic. No significant signal of D0→ηηη is found, and the upper limit on its decay branching fraction is set to be B(D0→ηηη)

A severe dust storm event originated from the Gobi Desert in Central and East Asia during 2–7 May 2017. Based on Moderate Resolution Imaging Spectroradiometer (MODIS) satellite products, hourly environmental monitoring measurements from Chinese cities and East Asian meteorological observation stations, and numerical simulations, we analysed the spatial and temporal characteristics of this dust event as well as its associated impact on the Asia-Pacific region. The maximum observed hourly PM10 (particulate matter with an aerodynamic diameter ≤ 10 µm) concentration was above 1000 µg m−3 in Beijing, Tianjin, Shijiazhuang, Baoding, and Langfang and above 2000 µg m−3 in Erdos, Hohhot, Baotou, and Alxa in northern China. This dust event affected over 8.35 million km2, or 87 % of the Chinese mainland, and significantly deteriorated air quality in 316 cities of the 367 cities examined across China. The maximum surface wind speed during the dust storm was 23–24 m s−1 in the Mongolian Gobi Desert and 20–22 m s−1 in central Inner Mongolia, indicating the potential source regions of this dust event. Lidar-derived vertical dust profiles in Beijing, Seoul, and Tokyo indicated dust aerosols were uplifted to an altitude of 1.5–3.5 km, whereas simulations by the Weather Research and Forecasting with Chemistry (WRF-Chem) model indicated 20.4 and 5.3 Tg of aeolian dust being deposited respectively across continental Asia and the North Pacific Ocean. According to forward trajectory analysis by the FLEXible PARTicle dispersion (FLEXPART) model, the East Asian dust plume moved across the North Pacific within a week. Dust concentrations decreased from the East Asian continent across the Pacific Ocean from a magnitude of 103 to 10−5 µg m−3, while dust deposition intensity ranged from 104 to 10−1 mg m−2. This dust event was unusual due to its impact on continental China, the Korean Peninsula, Japan, and the North Pacific Ocean. Asian dust storms such as those observed in early May 2017 may lead to wider climate forcing on a global scale.

Ice fabric influences the rheology of ice, and hence the age–depth profile at ice core drilling sites. To investigate the age–depth profile to be expected of the ongoing deep ice coring at Kunlun station, Dome A, we use the depth-varying anisotropic fabric suggested by the recent polarimetric measurements around Dome A along with prescribed fabrics ranging from isotropic through girdle to single maximum in a three-dimensional, thermo-mechanically coupled full-Stokes model of a 70 × 70 km2 domain around Kunlun station. This model allows for the simulation of the near basal ice temperature and age, and ice flow around the location of the Chinese deep ice coring site. Ice fabrics and geothermal heat flux strongly affect the vertical advection and basal temperature which consequently control the age profile. Constraining modeled age–depth profiles with dated radar isochrones to 2∕3 ice depth, the surface vertical velocity, and also the spatial variability of a radar isochrones dated to 153.3 ka BP, limits the age of the deep ice at Kunlun to between 649 and 831 ka, a much smaller range than previously inferred. The simple interpretation of the polarimetric radar fabric data that we use produces best fits with a geothermal heat flux of 55 mW m−2. A heat flux of 50 mW m−2 is too low to fit the deeper radar layers, and 60 mW m−2 leads to unrealistic surface velocities. The modeled basal temperature at Kunlun reaches the pressure melting point with a basal melting rate of 2.2–2.7 mm a−1. Using the spatial distribution of basal temperatures and the best fit fabric suggests that within 400 m of Kunlun station, 1-million-year-old ice may be found 200 m above the bed, and that there are large regions where even older ice is well above the bedrock within 5–6 km of the Kunlun station.

To realize real-time, detailed, and standardized watershed monitoring and management, a dynamic monitoring system is proposed, at all levels (space, air, and ground), by comprehensively utilizing advanced satellite and low-altitude unmanned aerial vehicle (UAV) technologies The system can be used to monitor and manage all kinds of sensitive water targets. This study takes water administration enforcement as an example for proving it feasibility by selecting typical study areas. This study shows that the proposed system is a promising information acquisition means, contributing to the development of watershed management.

Mapping and monitoring wetlands of Dongting lake using optical sensor data has been limited by cloud cover, and open access Sentinal-1 C-band data could provide cloud-free SAR images with both have high spatial and temporal resolution, which offer new opportunities for monitoring wetlands. In this study, we combined optical data and SAR data to map wetland of Dongting Lake reserves in 2016. Firstly, we generated two monthly composited Landsat land surface reflectance, NDVI, NDWI, TC-Wetness time series and Sentinel-1 (backscattering coefficient for VH and VV) time series. Secondly, we derived surface water body with two monthly frequencies based on the threshold method using the Sentinel-1 time series. Then the permanent water and seasonal water were separated by the submergence ratio. Other land cover types were identified based on SVM classifier using Landsat time series. Results showed that (1) the overall accuracies and kappa coefficients were above 86.6 % and 0.8. (3) Natural wetlands including permanent water body (14.8 %), seasonal water body (34.6 %), and permanent marshes (10.9 %) were the main land cover types, accounting for 60.3 % of the three wetland reserves. Human-made wetlands, such as rice fields, accounted 34.3 % of the total area. Generally, this study proposed a new flowchart for wetlands mapping in Dongting lake by combining multi-source remote sensing data, and the use of the two-monthly composited optical time series effectively made up the missing data due to the clouds and increased the possibility of precise wetlands classification.