Search

Background The treatment of completely displaced midshaft clavicle fractures is still controversial, especially Robinson 2B fractures. Titanium elastic nail (TEN) fixation is a good option for simple fractures, but there are no reports on its use in complex fractures. The aim of this study was to present a surgical method using the Nice knot-assisted TEN fixation to treat Robinson 2B midshaft clavicular fractures.Methods A retrospective analysis of 29 patients who underwent fixation with TEN and had a 1-year postoperative follow-up between 2016 and 2020 was performed. The fractures were classified as Robinson type 2B1 in 17 cases and type 2B2 in 12 cases. Length of the incision, postoperative shoulder function, Disability of Arm Shoulder and Hand (DASH) score, complications, and second surgical incision length were recorded.Results The length of the incision was 2–6 cm (mean, 3.7 cm). All incisions healed by first intention, and no infection or nerve injury occurred. The Constant score was 92–100 (mean, 96) and the DASH score was 0-6.2 (mean, 2.64). ESIN bending and hypertrophic nonunion occurred in one case (3.4%) and implant irritation occurred in four (13.8%) after operation. Internal fixators were removed at 12–26 months (mean, 14.6 months) after operation, and the length of the second incision was 1-2.5 cm (mean, 1.3 cm).Conclusions Intramedullary clavicle fixation with TEN is an ideal surgical technique. Nice knot-assisted fixation effectively stabilizes multifragmentary fractures, thereby achieving fracture healing. Surgeons should consider this technique in cases of Robinson 2B midshaft clavicular fractures.Trial registration: Retrospectively registered. This study was approved by the Ethics Committee of Wuxi Ninth People's Hospital (LW20220021).

This study examined the prognostic role of CENPW in clear cell renal cell carcinoma (ccRCC) using publicly available data from The Cancer Genome Atlas (TCGA). In order to clarify the relationship between clinicopathological features and CENPW expression information obtained from the TCGA database, logistic regression analysis was applied. Moreover, the expression of CENPW was closely associated with multiple immune cell infiltrations, as determined by immune cell infiltration analysis. Kaplan-Meier survival analysis demonstrated that the lower the expression of CENPW, the better the prognosis (p

Background: Acute myeloid leukemia(AML) is a malignant clonal disease. As the most common type of leukaemia, it is characterised by poor treatment outcomes and a poor prognosis in both the paediatric and adult populations. Improving anti-tumour responses through immunomodulators is a promising strategy or a new avenue for AML treatment. Methods: Using publicly available data from The Cancer Genome Atlas (TCGA) and Genotype-Tissue Expression (GTEx), we examined the association between SAM And SH3 Domain Containing 3(SASH3) and AML. Wilcoxon signed-rank test and logistic regression were used to analyze the relationship between clinical pathologic features and SASH3. Cox regression and Kaplan-Meier methods were used to determine the clinical characteristics associated with overall survival in patients with AML. Then the relationship between immune infiltration and SASH3 was also analyzed. The research finding was validated by data from the Gene Expression Omnibus (GEO) database. Results: Compared to normal patients, SASH3 expression in AML patients was significantly higher (p = 3.05e-34) and strongly associated with survival. In addition, SASH3 expression was significantly correlated with survival outcome (p = 5.3E-03) and cytogenetic risk (p = 3E-04) in AML. SASH3 expression was correlated with the expression of the genes HCK, SYK, FYN, ITGB2, PIK3CD, FGR, PIK3R5, VAV1, LCP2, and GRB2. Our study suggests that SASH3 expression is strongly associated with AML development and survival outcomes as well as multiple cancer-related genes and pathways, such as the HCK(Hematopoietic cell kinase) and regulation of small GTPase-mediated signal transduction. Conclusion: Our study revealed that SASH3 expression is closely associated with AML development and survival outcome, as well as multiple cancer-related genes and pathways, thus highlighting SASH3 as a potential therapeutic marker of AML.

Patella fractures treated with traditional open approach and tension band fixation are associated with a significant rate of soft tissues complications, including hardware irritation, postoperative adhesions and non-cosmetic scar. An alternative is to utilize cannulated screws and high-strength sutures by the minimally invasive technique.This retrospective study comprised 48 patients who had been treated for unilateral closed transverse patellar fracture, type 34C1 according to the AO Foundation and Orthopaedic Trauma Association (AO/OTA) classification, between June 2018 to June 2020. All patients were treated either by closed reduction and internal fixation using cannulated screws combined with high-strength sutures and Nice knots (the CRIF-NK group, n=24), or traditional open reduction and internal fixation using cannulated screws and tension band wiring (the ORIF-TBW group, n=24). The operative time and intraoperative blood loss for each patient were recorded. All the patients were underwent a regularly clinical and radiological follow-up. The clinical evaluation was performed using the Böstman scale and the Visual Analogue Scale (VAS) for pain.Average follow up was 21.9 months (range, 16-29 months). The mean intraoperative blood loss of the CRIF-NK group (35.21±6.16 mL) was significantly less than that of the ORIF-TBW group (75.42±7.92 mL; P0.001). The mean VAS scores at 4 and 8 weeks and the mean Böstman scale score at 8 weeks after surgery were significantly better in the CRIF-NK group (3.52±0.42, 1.47±0.40 and 28.13±0.94, respectively) than the ORIF-TBW group (5.16±0.68, 3.14±0.72 and 26.33±1.00, respectively; all P0.001). No significant differences were observed between the two groups in terms of operative time, Böstman scale score at 1-year follow-up, or fracture healing time. The union rate was 100% (24/24) in both groups. One patient (1/24) in the CRIF-NK group, and all patients (24/24) in the ORIF-TBW group required internal fixation removal.The percutaneous minimally invasive technique using cannulated screws combined with high-strength sutures and Nice knots exhibited some superiority to traditional open reduction with cannulated screws and tension band wiring for treatment of transverse patellar fractures in terms of efficacy and safety by reducing soft-tissue stimulating complications and promoting functional recovery.

Polydactyly is a common congenital malformation characterized by the presence of supernumerary fingers or toes. In this case study, we sought to identify the causative pathogenic factor in a family from a northern region of China affected by non-syndromic postaxial polydactyly (PAP).After recruiting a three-generation family with PAP, whole-exome sequencing was performed to identify the causative variant. In silico analysis and Sanger sequencing were used to validate the variant.We identified a novel heterozygous frameshift variant (NM_000168.6:c.4540delG, p.Asp1514Thrfs*5) in the transcriptional activator (TA1) domain of the GLI3 gene.The novel frameshift variant identified in this study further confirms the relationship between non-syndromic PAP and GLI3 and extends the previously established mutational and phenotypic spectra of GLI3.

This study aimed to evaluate the compatibility of L. acidophilus KLDS 1.0738 (LA-1.0738) with different prebiotic carbohydrates to develop a synbiotic soft soy cheese. It was observed that the addition of 4% (m/v) prebiotics mixture (galacto-oligosaccharide: inulin = 1:3) to soy cheese significantly improved the growth of LA-1.0738, making it no less than 8.2 log colony-forming unit (CFU)/g during the 28-day storage period, but had limited influence on the viability of S. thermophilus KLDS T1C2 (STT1C2). Meanwhile, because of the presence of prebiotics, soy cheese fermented by LA-1.0738 in co-culture with STT1C2 exhibited higher values of acidity, proteolysis and lipolysis index as well as better texture properties and sensory acceptance. These results suggested that the selected combination of prebiotics could be used as functional ingredients to manufacture soy cheese to maintain the survival of desired LA-1.0738, which contributed to improve the texture and sensory features of soy cheese.

Background and Aims. Men who have sex with men (MSM) are at high risk of HIV infection. The nonhomologous end joining (NHEJ) pathway is the main way of double-stranded DNA break (DSB) repair in the higher eukaryotes and can repair the DSB timely at any time in cell cycle. It is also indicated that the NHEJ pathway is associated with HIV-1 infection since the DSB in host genome DNA occurs in the process of HIV-1 integration. The aim of the present investigation was to evaluate associations of single-nucleotide polymorphisms (SNPs) in NHEJ pathway genes with susceptibility to HIV-1 infection and AIDS progression among MSM residing in northern China. Methods. A total of 481 HIV-1 seropositive men and 493 HIV-1 seronegative men were included in this case-control study. Genotyping of 22 SNPs in NHEJ pathway genes was performed using the SNPscan™ Kit. Results. Positive associations were observed between XRCC6 rs132770 and XRCC4 rs1056503 genotypes and the susceptibility to HIV-1 infection. In gene-gene interaction analysis, significant SNP-SNP interactions of XRCC6 and XRCC4 genetic variations were found to play a potential role in the risk of HIV-1 infection. In stratified analysis, XRCC5 rs16855458 was significantly associated with CD4+ T cell counts in AIDS patients, whereas LIG4 rs1805388 was linked to the clinical phases of AIDS patients. Conclusions. NHEJ gene polymorphisms can be considered to be risk factors of HIV-1 infection and AIDS progression in the northern Chinese MSM population.

To evaluate the feasibility and clinical effect of Krackow suturing combined with the suture bridge technique for the treatment of acute inferior pole patella fracture.In this study, 18 patients with acute inferior pole patella fracture who received treatment using Krackow suturing combined with the suture bridge technique between January 2019 and March 2020 were retrospectively reviewed. There were 10 men and 8 women, with an average age of 50.1 years (range 24-69 years). X-ray examinations were performed to assess fracture healing and the Insall-Salvati index. The clinical effect was measured by the range of motion of the knee joint and the Böstman scale.Patients were followed up for 13-26 months, with an average follow-up period of 19.6 months. X-ray indicated that fracture union had occurred in all patients by 10.1 weeks after surgery on average (range 8-14 weeks). The mean Insall-Salvati index immediately after surgery and at the final follow-up was 0.98 ± 0.07 and 0.90 ± 0.22, respectively (P 0.05). At the last follow-up, the mean flexion and extension ranges for the knee joint were 135.8° ± 8.8° and - 2.8° ± 3.9°, respectively, and the mean Böstman scale was 28.9 ± 1.1 points. Functional recovery was excellent in 17 patients and good in one patient, resulting in an overall good/excellent recovery rate of 100%.Our results indicated that Krackow suturing combined with the suture bridge technique can achieve stable fracture fixation, provides good clinical outcomes in the treatment of acute inferior pole patella fracture, and is worthy of clinical application.

BACKGROUND Previous studies reported that DNA damage repair (DDR) genes may play an important role in HIV-1 infection. The MRE11 gene, a member of the MRN complex, plays an essential part in the homologous recombination pathway, which is one of the classical DDR pathways. Previous reports have demonstrated that MRE11 has an effect on HIV-1 replication. However, the role of SNPs in the MRE11 gene and their impact on HIV-1 infection and AIDS progression remain unknown. METHODS In this study, 434 MSM HIV-1-infected patients in northern China and 431 age-matched healthy controls were enrolled. Five SNPs (rs2155209, rs10831234, rs13447720, rs601341 and rs11020803) at the MRE11 gene were genotyped. Another series of cases (409 MSM HIV-1-infected patients) and controls (403 age-matched healthy males) were recruited as the validation set. RESULTS In our study, rs10831234 showed differences in allele frequencies between cases and controls (P = 0.005). Additionally, there was an association between rs10831234 and HIV-1 infection susceptibility in dominant and additive models (P = 0.005 and P = 0.006, respectively). All significant associations were replicated in the validation set, and the associations were still significant after Bonferroni correction for multiple testing when the two data sets were combined. Furthermore, in haplotype association analyses between the case and control groups, the frequencies of the haplotypes Crs11020803Crs10831234 and Trs11020803Trs10831234 showed significant differences (P = 0.0181 and P = 0.0068, respectively). CONCLUSIONS We demonstrated that the MRE11 rs10831234-T allele may confer increased risk of HIV-1 infection.

Background The application of free skin flaps to repair severe peri-knee soft tissue defects is a common clinical approach. This article aims to investigate clinical efficacy and precautions of using a free anterolateral thigh flap with the descending genicular vessels as a recipient pedicle for repairing Gustilo IIIB and IIIC soft tissue defects around the knee. Methods We retrospectively analyzed the data of the patients with severe peri-knee Gustilo IIIB or IIIC soft tissue defects operated on from January 2015 to December 2019. All patients underwent repair of the severe soft tissue defect using anterolateral thigh flap transplantation with the descending genicular vessels as the recipient pedicle. Results All patients completed effective follow-up for an average of 14.1 [6-30] months. For two patients with larger flaps, necrosis occurred in the distal tip of the flaps, 6 cm and 4 cm in size. The necrotic flaps were removed, and the wound healed after skin grafting. In the other 12 patients, the skin flaps fully survived. Conclusions Using a free anterolateral thigh flap with descending genicular vessels as the recipient pedicle to repair Gustilo IIIB and IIIC soft tissue defects around the knee is a convenient and preferred technique that can achieve satisfactory efficacy.

Background: Single gene disorders are common diseases that cause birth defect. Carrier screening is an effective method to reduce the affected children with single gene disorders. However, incidence rates and carrier positive rates vary among ethnic groups. Results: In the present study, four hundred alleles associated with 11 recessive disease were detected in the Daur ethnicity of China. Among the 246 individuals, 25 individuals were identified as heterozygous carriers of at least one for 11 recessive disorder, carrier rate was 10.16%. A total of 19 females were carrier positive among 143 individuals with a 13.29% positive rate, however, only 6 out 103 males were carrier positive with a 5.83% positive rate. The most common in the Daur was HLD (2.85%) and congenital hearing loss (2.85%), followed by CAH (2.44%), PKU (1.22%), SMA (0.41%), MMA (0.41%), and X-linked ichthyosis (0.41%). Conclusions: These results estimated the distribution of carrier frequencies in the Daur, and showed that several of these diseases may be considered for inclusion in carrier screening in the Daur population. Further large-scale study should be performed to identified the results.

Background Polycystic kidney disease (PKD) is an inherited disease that is life‐threatening. Multiple cysts are present in the bilateral kidneys of PKD patients. The progressively enlarged cysts cause structural damage and loss of kidney function. Methods This study examined and analyzed 12 families with polycystic kidney disease. Whole exome sequencing (WES) or whole genome sequencing (WGS) of the probands was performed to detect the pathogenic genes. The candidate gene segments for lineal consanguinity in the family were amplified by the nest PCR followed by Sanger sequencing. The variants were assessed by pathogenic and conservational property prediction analysis and interpreted according to the American College of Medical Genetics and Genomics. Results Nine of the 12 pedigrees were identified the disease causing variants. Among them, four novel variants in PKD1, c.6930delG:p.C2311Vfs*3, c.1216T>C:p.C406R, c.8548T>C:p.S2850P, and c.3865G>A:p.V1289M (NM_001009944.2) were detected. After assessment, the four novel variants were considered to be pathogenic variants and cause autosomal dominant polycystic kidney disease in family. The detected variants were interpreted. Conclusion The four novel variants in PKD1, c.6930delG:p.C2311Vfs*3, c.1216T>C:p.C406R, c.8548T>C:p.S2850P, and c.3865G>A:p.V1289M (NM_001009944.2) are pathogenic variants and cause autosomal dominant polycystic kidney disease in family., This study examined and analyzed 12 families with polycystic kidney disease using whole exome sequencing or whole genome sequencing and several prediction tools. After assessment and interpretion, the four novel variants were considered to be pathogenic variants and cause autosomal dominant polycystic kidney disease in family. The present study enriched the knowledge of the pathogenicity for autosomal dominant polycystic kidney disease and would improve the understanding of this autosomal dominant disorder.

Objectives: The relationship between Noggin ( NOG) and methylenetetrahydrofolate reductase and nonsyndromic cleft lip and palate (NSCLP) has been reported participate in craniofacial development but need further evidence. To indicate the susceptibility between the 2 genes and NSCLP, rs227731 and rs1801131 polymorphisms were included in the present research. This research may provide some genetic clues for disease detection and surveillance. Design: Seventeen studies including 4023 cases and 5691 controls were provided for meta-analysis, and odds ratio (OR) with 95% CI were obtained to estimate NSCLP risk. Results: Our analysis suggested potential association of rs227731C on increasing the risk of NSCLP in the Caucasian group and total group but not Asian group under all models: allele (OR = 1.45, 95% CI = 1.21-1.75, P < .0001), homozygote (OR = 2.03, 95% CI = 1.42-2.90, P < .0001), heterozygote (OR = 1.44, 95% CI = 1.19-1.73, P = .0001), dominant (OR = 1.61, 95% CI = 1.27-2.04, P < .0001), and recessive models (OR = 1.63, 95% CI = 1.25-2.12, P = .0003). Besides, increased risk is related to rs1801131 in Asian group under 3 models: allele (OR = 1.24, 95% CI = 1.06-1.44, P = .006), heterozygote (OR = 1.24, 95% CI = 1.02-1.52, P = .03), and dominant models (OR = 1.29, 95% CI = 1.06-1.56, P = .009). Conclusions: Our analysis indicates polymorphisms rs227731 and rs1801131 are associated with NSCLP, with predominance of different ethnic group and deepen understanding of NSCLP.

Background MSM has a high risk of HIV infection. Previous studies showed that the cell cycle regulation played an important role in HIV-1 infection, especially in G2/M checkpoint. The ATR, Chk1, Cdc25C and CDK1 are key genes in G2/M checkpoint. However, the association between the SNPs of these genes and susceptibility to HIV-1 infection and AIDS progression remains unknown. Results 42 tSNPs of G2/M checkpoint genes were genotyped to analyze the association between these tSNPs and susceptibility to HIV-1 infection and AIDS progression among MSM (529 HIV − 1 seropositive men and 529 HIV-1 seronegative men) in northern China. The results showed that rs34660854-A and rs75368165-A in ATR gene and rs3756766-A in Cdc25C gene could increase the risk of HIV-1 infection (P = 0.049, P = 0.020 and P = 0.010, respectively), and ATR rs75069062 and Chk1 rs10893405 were significantly associated with AIDS progression (P = 0.026 and P = 0.029, respectively). Besides, rs34660854 and rs75368165 in ATR gene, rs12576279 and rs540436 in Chk1 gene, rs3756766 in Cdc25C gene and rs139245206 in CDK1 gene were significantly associated with HIV-1 infection under different models (P

Gene amplification chiefly manifests as homogeneously stained regions (HSRs) or double minutes (DMs) in cytogenetically and extrachromosomal DNA (ecDNA) in molecular genetics. Evidence suggests that gene amplification is becoming a hotspot for cancer research, which may be a new treatment strategy for cancer. DMs usually carry oncogenes or chemoresistant genes that are associated with cancer progression, occurrence and prognosis. Defining the molecular structure of DMs will facilitate understanding of the molecular mechanism of tumorigenesis. In this study, we re‐identified the origin and integral sequence of DMs in human colorectal adenocarcinoma cell line NCI‐H716 by genetic mapping and sequencing strategy, employing high‐resolution array‐based comparative genomic hybridization, high‐throughput sequencing, multiplex‐fluorescence in situ hybridization and chromosome walking techniques. We identified two distinct populations of DMs in NCI‐H716, confirming their heterogeneity in cancer cells, and managed to construct their molecular structure, which were not investigated before. Research evidence of amplicons distribution in two different populations of DMs suggested that a multi‐step evolutionary model could fit the module of DM genesis better in NCI‐H716 cell line. In conclusion, our data implicated that DMs play a very important role in cancer progression and further investigation is necessary to uncover the role of the DMs.

Colorectal cancer (CRC) is the third most developing cancer worldwide and Lynch syndrome (LS) accounts for 3–4% of CRC. Genetic alteration in any of DNA mismatch repair (MMR) gene is the major cause of LS that disrupt the normal upstream and downstream MMR events. Germline mutation of MLH1 in heterozygous state have an increased risk for CRC. Defective MMR pathway mostly results in microsatellite instability (MSI) that occurs in high percentage of CRC associated tumors. Here, we reported a patient with LS like metastatic CRC (mCRC) associated with other related cancers. Whole exome sequencing (WES) of the proband was performed to identify potential causative gene. Genetic screening validated by Sanger sequencing identified a heterozygous missense mutation in exon 12 of MLH1 (c.1151T>A, p.V384D). The clinical significance of identified variant was elucidated on the basis of clinicopathological data, computational predictions and various in vitro functional analysis. In silico predictions classified the variant to be deleterious and evolutionary conserved. In vitro functional studies revealed a significant decrease in protein expression because of stability defect leading to loss of MMR activity. Mutant residue found in MutL transducer domain of MLH1 that localized in the nucleus but translocation was not found to be significantly disturbed. In conclusion, our study give insight into reliability of combinatorial prediction approach of in silico and in vitro expression analysis. Hence, we highlighted the pathogenic correlation of MLH1 variant with LS associated CRC as well as help in earlier diagnosis and surveillance for improved management and genetic counselling.

Background: Prenatal intake of folic acid is important for prevention of NSCL/P (nonsyndromic cleft lip with or without cleft palate). Associated genes in folate pathway are major enzymes of folic acid metabolism that is crucial for preventing birth defects. The present meta-analysis aims to investigate the association between four SNPs in folate pathway genes and the risk of NSCL/P. Methods: Comprehensive bioinformatics analysis was used to predict the functional pathogenicity of genetic variation. The PubMed, Embase database and Google Scholar were searched by two researchers. Stata 11.0 software was used to analyze the results. Subgroup analysis was carried out to assess the influence of genetic background. Sensitivity analysis, regression analysis and publication analysis were also conducted to enhance the strength of our results. Results: It is estimated that the probability of two missense mutation rs1801133 in MTHFR and rs1801394 in MTRR are more likely to be damaging by bioinformatics analysis. A significant association between rs1801133 and risk of NSCL/P in two genetic models: TT genotype vs CC genotype (OR = 1.333 95%CI = 1.062–1.674, P = 0.013), and recessive model (OR = 1.325 95%CI = 1.075–1.634, P = 0.008). A significant protective association between rs1801394 GG genotype and NSCL/P in Asian (GG vs AA, OR = 0.520 95%CI = 0.321–0.841, P = 0.008) was observed. Meta-regression, sensitivity analysis, and publication bias analysis confirmed that the results of the present study were statistically significant. Conclusions: The present study identified that rs1801133 in MTHFR is associated with the risk of NSCL/P, and rs1801394 GG genotype in MTRR play a protective role in Asian. Further, larger studies should be performed to confirm these findings.

The aim of this study was to identify the potential key candidate genes of multiple sclerosis (MS) and uncover mechanisms in MS. We combined data from the microarray expression profile of three MS stages and performed bioinformatics analysis. Differentially expressed genes (DEGs) were identified among the distinct stages of MS and healthy controls, and a total of 349 shared DEGs were identified. Gene ontology (GO) and pathway enrichment analyses showed that the DEGs were significantly enriched in the biological processes (BPs) of purine-related metabolic processes and signaling, especially the common DEGs, which were enriched in some immunological processes. Most of the DEGs were enriched in signaling pathways associated with the immune system, some immune diseases and infectious disease pathways. Through a protein–protein interaction (PPI) network analysis and a gene expression regulatory network constructed with MS-related miRNAs, we confirmed FOS, TP53, VEGFA, JUN, HIF1A, RB1, PTGS2, CXCL8, OAS2, NFKBIA and OAS1 as candidate genes of MS. Furthermore , we explored the potential SNPs associated with MS by database mining. In conclusion, this study provides the identified genes, SNPs, biological processes, and cellular pathways associated with MS. The uncovered candidate genes may be potential biomarkers involved in the diagnosis and therapy of MS.

Progressive familial intrahepatic cholestasis type 3 (PFIC3) is a hepatic disorder occurring predominantly in childhood and is difficult to diagnose. PFIC3, being a rare autosomal recessive disease, is caused by genetic mutations in both alleles of ABCB4, resulting in the disruption of the bile secretory pathway. The identification of pathogenic effects resulting from different mutations in ABCB4 is the key to revealing the internal cause of disease. These mutations cause truncation, instability, misfolding, and impaired trafficking of the MDR3 protein. Here, we reported a girl, with a history of intrahepatic cholestasis and progressive liver cirrhosis, with an elevated gamma-glutamyltransferase level. Genetic screening via whole exome sequencing found a novel homozygous missense mutation ABCB4:c.1195G>C:p.V399L, and the patient was diagnosed with PFIC3. Various computational tools predicted the variant to be deleterious and evolutionary conserved. For functional characterization studies, plasmids, encoding ABCB4 wild-type and selected established mutant constructs, were expressed in human embryonic kidney (HEK-293T) and hepatocellular carcinoma (HepG2) cells. In vitro expression analysis observed a reduced expression of mutant protein compared to wild-type protein. We found that ABCB4 wild type was localized at the apical canalicular membrane, while mutant p.V399L showed intracellular retention. Intracellular mistrafficking proteins usually undergo proteasomal or lysosomal degradation. We found that after treatment with proteasomal inhibitor MG132 and lysosomal inhibitor bafilomycin A1, MDR3 expression of V399L was significantly increased. A decrease in MDR3 expression of mutant V399L protein may be a result of proteasomal or lysosomal degradation. Pharmacological modulator cyclosporin A and intracellular low temperature (30°C) treatment significantly rescued both the folding defect and the active maturation of the mutant protein. Our study identified a novel pathogenic mutation which expanded the mutational spectrum of the ABCB4 gene and may contribute to understanding the molecular basis of PFIC3. Therefore, genetic screening plays a conclusive role in the diagnosis of rare heterogenic disorders like PFIC3.

Lynch syndrome (LS) is the most common hereditary colorectal cancer (CRCs) inherited in an autosomal-dominant manner. Here, we reported a multigeneration Chinese family clinically diagnosed with LS according to the Amsterdam II criteria. To identify the underlying causative gene for LS in this family, whole-exome sequencing (WES) was performed. A germline missense variant (c.2054C>T:p.S685F) in exon 18 of MLH1 was successfully identified by WES. Sanger sequencing verified the results of WES and also confirmed the cosegregation of the MLH1 missense variant in all affected members of the family including two unaffected family members. Bioinformatic tools predicted the identified MLH1 variant as deleterious. Immunohistochemistry (IHC) staining showed loss of MLH1 and PMS2 protein expression. In vitro expression analysis also revealed that the identified MLH1 missense variant (c.2054C>T:p.S685F) results in reduced expression of both MLH1 and PMS2 proteins. Based on the American College of Medical Genetics and Genomics (ACMG) guidelines, the missense mutation c.2054C>T in MLH1 was classified as a “pathogenic” variant. Two unaffected family members were later recommended for colonoscopy and other important cancer diagnostic inspections every 1-2 years as both were at higher risk of LS. In conclusion, our findings widen the genotypic spectrum of MLH1 mutations responsible for LS. This study increases the phenotypic spectrum of LS which will certainly help the clinicians in diagnosing LS in multigeneration families. This study also puts emphasis on the importance of genetic counselling for the benefit of asymptomatic carriers of MMR gene variants who are at higher risk of LS.

Progressive familial intrahepatic cholestasis type 3 (PFIC3) is a hepatic disorder occurring predominantly in childhood and is difficult to diagnose. PFIC3, being a rare autosomal recessive disease, is caused by genetic mutations in both alleles ofABCB4, resulting in the disruption of the bile secretory pathway. The identification of pathogenic effects resulting from different mutations in ABCB4 is the key to revealing the internal cause of disease. These mutations cause truncation, instability, misfolding, and impaired trafficking of the MDR3 protein. Here, we reported a girl, with a history of intrahepatic cholestasis and progressive liver cirrhosis, with an elevated gamma-glutamyltransferase level. Genetic screeningviawhole exome sequencing found a novel homozygous missense mutationABCB4:c.1195G>C:p.V399L, and the patient was diagnosed with PFIC3. Various computational tools predicted the variant to be deleterious and evolutionary conserved. For functional characterization studies, plasmids, encodingABCB4wild-type and selected established mutant constructs, were expressed in human embryonic kidney (HEK-293T) and hepatocellular carcinoma (HepG2) cells.In vitroexpression analysis observed a reduced expression of mutant protein compared to wild-type protein. We found thatABCB4wild type was localized at the apical canalicular membrane, while mutant p.V399L showed intracellular retention. Intracellular mistrafficking proteins usually undergo proteasomal or lysosomal degradation. We found that after treatment with proteasomal inhibitor MG132 and lysosomal inhibitor bafilomycin A1, MDR3 expression of V399L was significantly increased. A decrease in MDR3 expression of mutant V399L protein may be a result of proteasomal or lysosomal degradation. Pharmacological modulator cyclosporin A and intracellular low temperature (30°C) treatment significantly rescued both the folding defect and the active maturation of the mutant protein. Our study identified a novel pathogenic mutation which expanded the mutational spectrum of theABCB4gene and may contribute to understanding the molecular basis of PFIC3. Therefore, genetic screening plays a conclusive role in the diagnosis of rare heterogenic disorders like PFIC3.

Background Synpolydactyly type 1 (SPD1), also known as syndactyly type II, is an autosomal dominant limb deformity generally results in webbing of 3rd and 4th fingers, duplication of 4th or 5th toes. It is most commonly caused by mutation in HOXD13 gene. In this study, a five-generation Chinese family affected with SPD1 disease were collected. We tried to identify the pathogenic variations associated with SPD1 involved in the family. Methods We used the whole genome sequencing (WGS) to identify the pathogenic variant in this family which was later confirmed by PCR-Sanger sequencing. The genetic variation were evaluated with the frequencies in the 1000 Genome Project and Exome Aggregation Consortium (ExAC) dataset. The significance of variants were assessed using different mutation predictor softwares like Mutation Taster, PROVEAN and SIFT. The classification of variants was assessed according to American College of Medical Genetics and Genomics (ACMG) guidelines. Results Our results showed the mutation of 24-base pair duplication (c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC) in exon one of HOXD13 in heterozygous form which was predicted to result in eight extra alanine (A) residues in N-terminal domain of HOXD13 protein. The mutation was detected in all affected members of the family. Conclusion Based on our mutation analysis of variant c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC in HOXD13 and its cosegregation in all affected family members, we found this variant as likely pathogenic to this SPD1 family. Our study highlights variable expressivity of HOXD13 mutation. Our results also widen the spectrum of HOXD13 mutation responsible for SPD1.

Background Heilongjiang Province located in northeast China is a multi-ethnic region with people who have lived in cold conditions for several generations. Fatty acids are important to people with cold resistance. CPT1A encodes a protein that imports long-chain fatty acids into the mitochondria for fatty-acid oxidation. FADS is an essential enzyme for the synthesis of long-chain polyunsaturated fatty acids. Results In the present study, we investigated the distributions of three cold resistance-related SNPs (rs80356779 G > A in CPT1A, rs7115739 T > G in FADS3 and rs174570 C > T in FADS2) from six populations that included 1093 individuals who have lived in Heilongjiang Province for at least three generations. The frequencies of rs174570 and rs7115739 were different in our six north minorities compared to the Chinese Dai in Xishuangbanna (CDX) in southern China. All the SNPs in Hezhen were significantly different from other five studied populations. In addition, the genetic distribution of rs174570 in Daur was significantly different from Manchu and Korea, and the frequency of rs7115739 in Ewenki was significantly different from the other populations. The results also showed that the frequencies of the three SNPs in the six minorities were different from those of Greenlandic Inuit and Siberian population. Conclusions Our results showed the distributions of the three cold resistance-related SNPs from six populations that included 1093 individuals in northern China. Distributions of the allele frequencies for the cold resistance-related SNPs in northern China were statistically different from those in southern China. These data help to establish the DNA genome database for the six populations and fully preserve existing minority genetic information. Electronic supplementary material The online version of this article (10.1186/s12864-018-4524-1) contains supplementary material, which is available to authorized users.

The prognostic role of COX-2 expression in ovarian cancer patients has been studied for years, while results remain controversial. Thus we performed a meta-analysis to evaluate the prognostic impact of COX-2 expression on survival of ovarian cancer patients. The databases PubMed, Embase and CNKI were searched. Summary hazard ratio (HR) and 95% confidence intervals (CIs) were calculated to analyze the correlations between COX-2 expression and overall survival (OS), and disease-free survival (DFS). A total of 1,867 patients from 18 studies were enrolled in the final analysis. The results showed that patients with higher COX-2 expression had a poor OS (HR: 1.48; 95% CI: 1.19-1.85) and DFS (HR: 1.81, 95% CI: 1.28-2.55). Subgroup analysis showed that there had significant associations between COX-2 expression and survival rate in most of the subgroups. Furthermore, there were significant associations between COX-2 expression and several clinical parameters such as FIGO stage, histological type and age. These results showed the patients with higher COX-2 expression had a significantly poorer survival rate, COX-2 expression had the potential to be a prognostic marker of ovarian cancer.

The BRCA2 gene plays an important role in cancer carcinogenesis, and polymorphisms in this gene have been associated with cancer risk. The BRCA2 rs144848 polymorphism has been associated with several cancers, but results have been inconsistent. In the present study, a meta-analysis was performed to assess the association between the rs144848 polymorphism and cancer risk. Literature was searched from the databases of PubMed, Embase and Google Scholar before April 2016. The fixed or random effects model was used to calculate pooled odd ratios on the basis of heterogeneity. Meta-regression, sensitivity analysis, subgroup analysis and publication bias assessment were also performed using STATA 11.0 software according to Preferred Reporting Items for Systematic Reviews and Meta-Analyses 2009. A total of 40 relevant studies from 30 publications including 34,911 cases and 48,329 controls were included in the final meta-analysis. Among them, 22 studies focused on breast cancer, seven on ovarian cancer, five on non-Hodgkin lymphoma, and the remaining six studies examined various other cancers. The meta-analysis results showed that there were significant associations between the rs144848 polymorphism and cancer risk in all genetic models. Stratified by cancer type, the rs144848 polymorphism was associated with non-Hodgkin lymphoma. Stratified by study design, the allele model was associated with breast cancer risk in population-based studies. The meta-analysis suggests that the BRCA2 rs144848 polymorphism may play a role in cancer risk. Further well-designed studies are warranted to confirm these results.

Background Prenatal intake of folic acid is important for prevention of nonsyndromic cleft lip with or without cleft palate (NSCL/P). Associated genes in folate pathway are major enzymes of folic acid metabolism that is crucial for preventing birth defects. The present study aims to investigate the association between four single nucleotide polymorphisms (SNPs) in folate pathway genes and the risk of NSCL/P. Methods Comprehensive bioinformatics analysis was used to predict the functional pathogenicity of genetic variation. The PubMed, Embase database and Google Scholar were intensively searched by two researchers to ascertain all relevant studies. Stata 11.0 software was used to analyze the results. Subgroup analysis was carried out to assess the influence of genetic background. Sensitivity analysis, regression analysis and publication analysis were also conducted to enhance the strength of our results. Results It is estimated that the probability of two missense mutation rs1801133 in MTHFR and rs1801394 in MTRR are more likely to be damaging by bioinformatics analysis. A total of 34 publications were included in the present study analysis. Our results showed a significant association between rs1801133 and risk of NSCL/P in two genetic models: TT allele vs CC allele (OR=1.333 95%CI=1.062-1.674, P =0.013), and recessive model (OR=1.325 95%CI=1.075-1.634, P =0.008). A significant association between rs1801394 and the risk of NSCL/P in Asian (GG allele vs AA allele, OR=0.520 95%CI=0.321-0.841, P =0.008) was also observed. Meta-regression, sensitivity analysis, and publication bias analysis confirmed that the results of the present study were statistically significant. Conclusions The present study highlights two SNPs rs1801133 in MTHFR and rs1801394 in MTRR, associated with the increasing risk of NSCL/P. Further, larger studies should be performed to confirm these findings.

Background Prenatal intake of folic acid is important for prevention of nonsyndromic cleft lip with or without cleft palate (NSCL/P), genes participant in folate pathway are crucial for preventing birth defects. The present study aims to investigate the associations between four single nucleotide polymorphisms (SNPs) in folate pathway genes and the risk of NSCL/P. Methods Prediction by bioinformatics was conducted to assess the function of genetic variation. The PubMed, Embase database and Google Scholar were searched by two researchers to identify all relevant studies. Stata 11.0 software was used to calculate the results. Subgroup analysis was conducted to assess the influence of the genetic background. Sensitivity analysis, regression analysis and publication analysis were conducted to improve the strength of the results. Results Two genetic variations rs1801394 in MTRR gene and rs1801133 in MTHFR were predicted damaging. A total of 34 publications were included in the present analysis. The results showed that there were a significant association between rs1801133 and NSCL/P risk in two genetic models TT allele vs CC allele (OR=1.333 95%CI=1.062-1.674, P=0.013) and recessive model (OR=1.325 95%CI=1.075-1.634, P=0.008) and there were a significant association between rs1801394 and NSCL/P risk in Asian (GG allele vs AA allele, OR=0.520 95%CI=0.321-0.841, P=0.008). Meta-regression, sensitivity analysis, and publication bias analysis confirmed that the results of the present study were statistically robust. Conclusions This present study suggests that rs1801133 of the MTHFR gene and rs1801394 of the MTRR gene are risk factors for NSCL/P. Additional, larger studies should be performed to confirm these findings.

Polycystic kidney disease (PKD) is a life‑threatening inherited disease with a morbidity of 1:500‑1,000 worldwide. Numerous progressively enlarging cysts are observed in the bilateral kidneys of patients with PKD, inducing structural damage and loss of kidney function. The present study analyzed one family with PKD. Whole exome sequencing of the proband was performed to detect the pathogenic gene present in the family. Candidate gene segments for lineal consanguinity in the family were amplified by nest polymerase chain reaction, followed by Sanger sequencing. One novel duplication variant (NM_001009944.2:c.9359dupA:p.Y3120_E3121delinsX) and one missense mutation (c.G9022A:p.V3008M) were detected in PKD1. Additionally, the pathogenic substitutions in PKD1 published from the dataset were analyzed. Following analysis and confirmation, the duplication variant NM_001009944.2:c.9359dupA:p.Y3120_E3121delinsX in PKD1, within the polycystin‑1, lipoxygenase, α‑toxin domain, was considered to be the pathogenic factor in the examined family with autosomal dominant PKD. Additionally, based on the analysis of 4,805 pathogenic substitutions in PKD1 within various regions, the presence of the missense mutation in the N‑terminal domain of polycystin‑1 may present high pathogenicity in ADPKD.

Additional file 1: Table S1. Mutations in limb development genes found in WGS

Psoriasis is a chronic immune-mediated disease with a complex etiology involving various genetic and immunological factors as well as environmental factors. Psoriasis is thought to be mediated by T-cells polarized to a Th17 fate. PTPN2 encodes the T-cell protein tyrosine phosphatase, which acts as a negative regulator of the JAK/STAT signaling pathways downstream of cytokines and plays a prominent role in T-cell activation, signaling and/or effector function. To evaluate the association between PTPN2 gene polymorphisms and psoriasis in the Northeastern Chinese population. A case-control study was conducted, and 398 patients with psoriasis and 397 healthy controls were genotyped for thirteen genetic polymorphisms in PTPN2. Allele analysis revealed that rs2847297, rs657555 and rs482160 polymorphisms were significantly associated with psoriasis (p = 0.0018, p = 0.0017 and p = 0.0086, respectively). Genotype analysis also revealed that these polymorphisms were significantly associated with psoriasis under different models (codominant, dominant and recessive models) (p 0.05). In this study, three haplotypes (H1, H7 and H11) were also found to be associated with psoriasis (p = 0.0015, p = 0.0094, and p = 0.0124, respectively). These results indicate that PTPN2 genetic polymorphisms are associated with psoriasis in the Northeastern Chinese population.