Search

To report three-decade changes of clinical characteristics, progress of treatments, and risk factors associated with mortality and enucleation in patients with retinoblastoma in China.Retrospective cohort study.This multicenter study included 2552 patients diagnosed with retinoblastoma in 38 medical centers in 31 provinces in China from 1989 to 2017, with follow-up data. Kendall's tau-b value was used to describe correlation coefficients between the three eras (between 1989 and 2008, between 2009 and 2013, and between 2014 and 2017) and clinical or demographic features. Hazard ratios and odds ratios were applied to measure risk factors.A total of 324 (13%) patients died and 1414 (42%) eyes were removed. The 1-year, 3-year, and 5-year overall survival rates were 95%, 86%, and 83%, respectively. Patients were diagnosed at a better stage by International Classification for Retinoblastoma over time (Kendall's tau-b value = -0.084, P.001). Pathological risk factors were also observed less in recent eras. New conservative therapies were adopted and used in more patients. The eye removal rate gradually decreased (Kendall's tau-b value = -0.167, P.001). The overall survival rates were 81%, 83%, and 91% in the three eras. By multivariate Cox regression, bilateral tumors and extraocular extension were identified as risk factors for death. Among intraocular disease, Group E indicated higher risk of mortality. By multivariate logistics regression, unilateral tumors, earlier era of diagnosis, and extraocular extension were risk factors for eye salvage failure. Among intraocular retinoblastoma, Groups D and E had higher risk of eye salvage failure.Patients were diagnosed at an earlier stage in recent eras. Conservative therapies, including intra-arterial chemotherapy, were increasingly being used. The above changes may contribute to the decreasing enucleation rate. Although no significant impact was identified on the mortality by the three eras, a decreasing trend was shown.

Purpose This study attempted to estimate the impact of eye-preserving therapies for the long-term prognosis of patients with advanced retinoblastoma with regard to overall survival and ocular salvage. Design Retrospective cohort study covering all 31 provinces (38 retinoblastoma treating centers) of mainland China. Participants One thousand six hundred seventy-eight patients diagnosed with group D or E retinoblastoma from January 2006 through May 2016. Methods Chart review was performed. The patients were divided into primary enucleation and eye-preserving groups, and they were followed up for survival status. The impact of initial treatment on survival was evaluated by Cox analyses. Main Outcome Measures Overall survival and final eye preservation. Results After a median follow-up of 43.9 months, 196 patients (12%) died, and the 5-year overall survival was 86%. In total, the eyeball preservation rate was 48%. In this cohort, 1172 patients (70%) had unilateral retinoblastoma, whereas 506 patients (30%) had bilateral disease. For patients with unilateral disease, 570 eyes (49%) underwent primary enucleation, and 602 patients (51%) received eye-preserving therapies initially. During the follow-up (median, 45.6 months), 59 patients (10%) from the primary enucleation group and 56 patients (9.3%) from the eye-preserving group died. Multivariate Cox analyses indicated no significant difference in overall survival between the 2 groups (hazard ratio [HR], 1.25; 95% confidence interval [CI], 0.85–1.84; P = 0.250). For patients with bilateral disease, 95 eyes (19%) underwent primary enucleation, and 411 patients (81%) received eye-preserving therapies initially. During the follow-up (median, 40.1 months), 12 patients (13%) from the primary enucleation group and 69 patients (17%) from the eye-preserving group died. For bilateral retinoblastoma with the worse eye classified as group E, patients undergoing primary enucleation exhibited better overall survival (HR, 2.35; 95% CI, 1.10–5.01; P = 0.027); however, this survival advantage was not evident until passing 22.6 months after initial diagnosis. Conclusions Eye-preserving therapies have been used widely for advanced retinoblastoma in China. Patients with bilateral disease whose worse eye was classified as group E and who initially underwent eye-preserving therapies exhibited a worse overall survival. The choice of primary treatment for advanced retinoblastoma should be weighed carefully.

Cone-rod dystrophy (CRD) is a genetically inherited retinal disease that can be associated with male infertility, while the specific genetic mechanisms are not well known. Here, we report CEP78 as a causative gene of a particular syndrome including CRD and male infertility with multiple morphological abnormalities of sperm flagella (MMAF) both in human and mouse. Cep78 knockout mice exhibited impaired function and morphology of photoreceptors, typified by reduced ERG amplitudes, disrupted translocation of cone arrestin, attenuated and disorganized photoreceptor outer segments (OS) disks and widen OS bases, as well as interrupted connecting cilia elongation and abnormal structures. Cep78 deletion also caused male infertility and MMAF, with disordered ‘9+2’ structure and triplet microtubules in sperm flagella. Intraflagellar transport (IFT) proteins IFT20 and TTC21A are identified as interacting proteins of CEP78. Furthermore, CEP78 regulated the interaction, stability, and centriolar localization of its interacting protein. Insufficiency of CEP78 or its interacting protein causes abnormal centriole elongation and cilia shortening. Absence of CEP78 protein in human caused similar phenotypes in vision and MMAF as Cep78−/− mice. Collectively, our study supports the important roles of CEP78 defects in centriole and ciliary dysfunctions and molecular pathogenesis of such multi-system syndrome.

BACKGROUND Familial exudative vitreoretinopathy (FEVR) is a group of inherited eye diseases characterized by premature arrest of retinal vessel development. The purpose of our study was to characterize the genetic causes and clinical features in eight Chinese families with FEVR using next-generation sequencing (NGS) technology. MATERIALS AND METHODS Eight families with FEVR were included in genetic and clinical analyses. We screened the proband and the parents in eight pedigrees with FEVR using targeted NGS approach and in silico analysis to determine the causative mutation for their family's phenotype. RESULTS Four cases (4/8, 50.0%) were confirmed to harbor mutations in known genes, including 3 novel mutations and one previously reported mutation. Among the detected mutations, TSPAN12 accounted for 75% (3/4). We identified a novel stop codon of TSPAN12, a heterozygous missense mutation NM_012338.4:c.633T>A, NP_036470.1:p.Tyr211Ter involved in highly conserved residues in the proband. Retrospective analysis of its clinical manifestation showed that the mutant carrier presented mild clinical features. CONCLUSIONS We found the novel stop codon mutation p.Tyr211Ter in the TSPAN12, which creates a milder phenotype. Discovery of this novel mutation expands the mutation spectrum of TSPAN12, and would be valuable for future genetic disease diagnosis.

To report novel BEST1 variants in six Chinese families with bestrophinopathies of two different inheritance modes and analyze the intrafamilial phenotypic diversity.A total of 25 participants including 13 patients and 12 healthy family members from 6 Chinese families with bestrophinopathies were available for genetic and clinical analysis. All of the patients were subjected to comprehensive ophthalmic evaluations and exome sequencing was performed on the probands to detect the causative variants. The pathogenicity of gene variants was predicted using silico analysis and evaluated according to ACMG guidelines. All (likely) pathogenic variants were determined by Sanger sequencing and co-segregation analyses were performed on available family members. The relevant original literature previously reported was retrieved to explore the relationship between BEST1-related gene variants and clinical features.In the 6 families, 3 families (10 patients) were assigned as autosomal dominant bestrophinopathies (VMD) and 3 families (3 patients) were assigned as Autosomal recessive Bestrophinopathies (ARB). A total of 9 variants on the BEST1 gene were identified, containing 7 missense variants, 1 nonsense variant, and 1 frameshift variant, respectively, of which 3 variants c.88A G (p.Lys30Glu), c.764G A (p.Arg255Gln) and c.233dupT (p.Ser79Phefs*153) were novel variants. Three families with ARB were detected with heterozygous variants on the BEST1 gene.2 families (8 patients) with BVMD showed markedly irregular dominant inheritance, and the severity of macular lesions varies greatly among individuals of the same family. Among them, the probands showed typical vitelliform lesions in the macula, while the other six patients had no visible signs of the disease by fundus photography (ophthalmoscopy) and minor lesions could be detected on OCT in two patients, the continuity of the ellipsoidal band was interrupted with the chimeric band. The phenotypes of the patients in the three ARB families ranged from typical/atypical vitelliform lesions to extensive extramacular deposits (peripheral spots).This study provided evidence that the phenotype of BVMD manifested irregular dominant inheritance, with patients carrying a pathogenic heterozygous variant of BEST1 to develop obvious intrafamilial phenotypic diversity, and the patients who harbor two pathogenic alleles showed recessive inheritance bestrophinopathies with distinct phenotypic diversity. Our study also emphasized the importance of comprehensive genetic analysis in patients with bestrophinopathies, and in such challenging families with distinct intrafamilial phenotypic diversity, it shall provide novel insights into phenotypic assessments of bestrophinopathies, and contribute to better diagnosis, prognosis, and treatment for these patients.

AIM: To characterize the genetic causes and clinical features in a four-generation Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome (BPES). METHODS: Thirteen patients with BPES and eight healthy family members were included in this study. All participants received routine ophthalmic examinations. The target next-generation sequencing (NGS) was performed to determine the causative mutation for this family. The silico analysis was also applied to predict the pathogenesis of identified mutations. RESULTS: All patients had severe ptosis, normal intelligence, female patients have normal fertility. Genetic assessments revealed a heterozygous insertion variation in FOXL2 gene, c.672_701insGCGGCTGCCGC CGCAGCTGCTG CAGGCGCT (p.Ala234_Gly235linsAAAAAAAAGA), carried by 13 patient but absent in all unaffected members. In silico analysis supported the pathogenic nature of this highly conserved variant. This mutation resulted in the insertion of 10 amino acids into the encoded polyala nine chain, which increased the number of original polyalanine chains from 14 to 24, resulting in an extended protein. CONCLUSION: A novel FOXL2 mutation c.672_701ins GCGGCTGCCGCCGCAGCTGCTGC AGGCGCT (p.Ala234_Gly235linsAAAAAAAAGA) was identified in a large Chinese family with BPES. This study amplified the genotypic spectrum of FOXL2-BPES and better illustrates its genotype-phenotype correlations, which provided a basis for elucidating the pathogenesis of BPES and genetic counseling.

Background: Achromatopsia (ACHM) is an inherited retinal disease affecting the cone cell function. To date, six pathogenic genes of ACHM have been identified. However, the diagnostic and therapeuti...

BackgroundCone-rod dystrophy (CRD) is a genetically inherited retinal disease characterized by photoreceptor degeneration. In some rare cases, CRD and hearing loss can be associated with male fertility, while the underlying mechanism is not well known.MethodsUsing CRISPR/Cas9 system, we generated Cep78-/- mice. And electroretinogram (ERG), immunofluorescence staining and transmission electron microscopy (TEM) were used to analyze visual function and photoreceptor ciliary structure changes in Cep78-/- mouse. HE/PAS staining, scanning-electron microscopy (SEM) were conducted to Cep78-/- mice and human CRD patient with CEP78 protein loss to illustrate male infertility and multiple morphological abnormalities of the sperm flagella (MMAF) caused by CEP78 deficiency. TEM and immunofluorescence staining were performed to characterize morphological and molecular changes of sperm flagella microtubule arrangement, centriole development and spermatid head shaping in Cep78-/- mice. Mass-spectrometry analyses were conducted to identify protein abnormalities after Cep78 deletion and Cep78 interacting proteins in spermiogenesis. Co-immunoprecipitation was used to show the Cep78-Ift20-Ttc21a trimer. The role of Cep78-Ift20-Ttc21a trimer in cilliogenesis and centriole elongation was assessed by cilia induction assay.ResultsCep78 knockout mice exhibited impaired function and morphology of photoreceptors, typified by reduced electroretinogram amplitudes, disrupted translocation of cone arrestin, attenuated and disorganized photoreceptor outer segments (OS) disks and widen OS bases, as well as interrupted cilia elongations and structures. Cep78 deletion also caused male infertility and MMAF, with disordered “9 + 2” structure and triplet microtubules in sperm flagella. CEP78 forms a trimer with intraflagellar transport (IFT) proteins IFT20 and TTC21A essential for sperm flagella formation, is essential for their interaction and stability, and recruits IFT20 to centrosome. Insufficiency of any component in the trimer causes centriole elongation and cilia shortening. Additionally, absence of CEP78 protein in human leaded to similar phenotypes in vision and MMAF as Cep78-/- mice.ConclusionsWe found CEP78 as the causative gene of CRD with MMAF in human and mouse. Cep78 forms a trimer with Ift20 and Ttc21a, and regulate the interaction, stability and localization of the trimer proteins, which regulate cilliogenesis, centriole length, and sperm flagella formation.FundingThis work was supported by the National Key R&D Program (2021YFC2700200 to X.G); National Natural Science Foundation of China (82020108006, 81730025 to C.Z, 81971439, 81771641 to X.G, 82070974 to X.C, 82060183 to X.S); Shanghai Outstanding Academic Leaders (2017BR013 to C.Z); and Six Talent Peaks Project in Jiangsu Province (YY-019 to X.G). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Background Keratoconus (KC) is a complex, non-inflammatory corneal degenerative disease. Although numerous studies have analyzed the correlation of SNP rs1324183, which located in MPDZ-NF1B gene, and KC in different populations, only few findings were repeated. In this study, to evaluate the association between rs1324183 and KC in a new independent Chinese population, we performed a replication study of the significantly associated rs1324183. Methods In total of 114 unrelated KC patients and 88 unrelated controls were recruited from Ningxia, China. We detected the genotypes and alleles of rs1324183 using PCR technology and Sanger sequencing and also analyzed the association between this locus and KC, its clinical parameters by statistical methods. Results The frequency of genotype AA (11, 9.6%) and genotypes containing allele A (47, 41.2%) of rs1324183 in KC were both higher than those of the control group. And genotype AA of rs1324183 conferred a higher risk of KC (OR > 1). Moreover, corneal parameter Belin/Ambrósio enhanced ectasia display final D value (BAD-D) had significant correlation (p = 0.002) with AA genotype of rs1324183 in KC. Conclusions Our replication study indicates that the results of rs1324183 associated with KC in our population is robust and further better illustrates the significance of BAD-D as a diagnostic indicator for KC. rs1324183 should be considered as the first genetic mark of KC risk in its future diagnosis.

This study attempted to estimate the impact of eye-preserving therapies for the long-term prognosis of patients with advanced retinoblastoma with regard to overall survival and ocular salvage.Retrospective cohort study covering all 31 provinces (38 retinoblastoma treating centers) of mainland China.One thousand six hundred seventy-eight patients diagnosed with group D or E retinoblastoma from January 2006 through May 2016.Chart review was performed. The patients were divided into primary enucleation and eye-preserving groups, and they were followed up for survival status. The impact of initial treatment on survival was evaluated by Cox analyses.Overall survival and final eye preservation.After a median follow-up of 43.9 months, 196 patients (12%) died, and the 5-year overall survival was 86%. In total, the eyeball preservation rate was 48%. In this cohort, 1172 patients (70%) had unilateral retinoblastoma, whereas 506 patients (30%) had bilateral disease. For patients with unilateral disease, 570 eyes (49%) underwent primary enucleation, and 602 patients (51%) received eye-preserving therapies initially. During the follow-up (median, 45.6 months), 59 patients (10%) from the primary enucleation group and 56 patients (9.3%) from the eye-preserving group died. Multivariate Cox analyses indicated no significant difference in overall survival between the 2 groups (hazard ratio [HR], 1.25; 95% confidence interval [CI], 0.85-1.84; P = 0.250). For patients with bilateral disease, 95 eyes (19%) underwent primary enucleation, and 411 patients (81%) received eye-preserving therapies initially. During the follow-up (median, 40.1 months), 12 patients (13%) from the primary enucleation group and 69 patients (17%) from the eye-preserving group died. For bilateral retinoblastoma with the worse eye classified as group E, patients undergoing primary enucleation exhibited better overall survival (HR, 2.35; 95% CI, 1.10-5.01; P = 0.027); however, this survival advantage was not evident until passing 22.6 months after initial diagnosis.Eye-preserving therapies have been used widely for advanced retinoblastoma in China. Patients with bilateral disease whose worse eye was classified as group E and who initially underwent eye-preserving therapies exhibited a worse overall survival. The choice of primary treatment for advanced retinoblastoma should be weighed carefully.

Aim To identify mutations with whole exome sequencing (WES) in a Chinese X-linked retinitis pigmentosa (XLRP) family. Methods Patients received the comprehensive ophthalmic evaluation. Genomic DNA was extracted from peripheral blood and subjected to SureSelect Human All Exon 6+ UTR exon capture kit. The exons were sequenced as 100 base paired reads on Illumina HiSeq2500 system. Only mutations that resulted in a change in amino acid sequence were selected. A pattern of inheritance of the RP family was aligned to identified causal mutation. Results We analysed the data of WES information from XLRP family. The analysis revealed a hemizygous large genomic deletion of RPGR c.29_113del was responsible for this XLRP. The gross deletion lead to a frame-shift mutation and generate stop codon at 7 animo acid behind Asp (D10Afs*7), which would serious truncate RPGR protein. The novel frame-shift mutation was found to segregate with retinitis pigmentosa (RP) phenotype in this family. Bilateral myopia was present on the male patients, but carrier female showed unilateral myopia without RP. Conclusion Our study identifies a novel frame-shift mutation of RPGR in a Chinese family, which would expand the spectrum of RPGR mutations. The geno-phenotypic analysis reveals a correlation between RP and myopia. Although exact mechanism of RP related myopia is still unknown, but the novel frame-shift mutation will give our hit on studying the molecular pathogenesis of RP and myopia.

To provide the general information on corneal transplantation (CT) in China, China Cornea Society designed a questionnaire on CT from 2014 to 2018 and entrusted it to 31 committee members for implementation of the survey nationwide. This article presents the results of the survey and compares the indicators used in the survey and those in the annual statistical report released by the Eye Bank Association of America (EBAA). The number of corneal transplantations completed by the 64 hospitals from 2014 to 2018 was respectively 5377, 6394, 7595, 8270 and 8980, totally 36,616 (22,959 male and 13,657 female). The five largest hospitals by the number of corneal transplantations completed 15,994 surgeries in total, accounting for 43.68% of all the surgeries performed in the 64 hospitals. The most common indication for corneal transplantations was corneal leukoma (7683, 20.98%), followed by bacterial keratitis (4209, 11.49%), corneal dystrophies (4189, 11.44%), keratoconus (3578, 9.77%) and corneal perforation (2839, 7.75%). The main surgical techniques were penetrating keratoplasty (PK) (19,896, 54.34%), anterior lamellar keratoplasty (ALK) (13,869, 37.88%). The proportion of PK decreased from 57.97% in 2014 to 52.88% in 2018 while the proportion of ALK increased from 36.04% in 2014 to 37.92% in 2018. The geographical distribution of keratoplasties performed in China is unbalanced. PK and ALK were the main techniques of CT and corneal leukoma, bacterial keratitis and corneal dystrophies were the main indications for CT in China.

To estimate the prevalence of vision impairment and blindness in 2014 among older adults in rural China with comparisons with the 2006 Nine-Province Survey.Population-based, cross-sectional study.Geographical cluster sampling was used in randomly selecting residents from a rural county or semi-rural district within 9 provinces: Beijing, Jiangsu, Guangdong, Heilongjiang, Jiangxi, Hebei, Ningxia, Chongqing, and Yunnan. Persons 50 years of age or older were enumerated through household visits and invited to examination sites for visual acuity testing and examination. Vision impairment and blindness in 2014 was compared with data from the 2006 survey.Among 51 310 examined persons, the prevalence of presenting vision impairment (20/63 to ≥20/400) in the better-seeing eye ranged from 6.05% to 15.3% across the 9 study sites, with presenting blindness (20/400) ranging from 0.66% to 5.35%. With best-corrected visual acuity, the prevalence of vision impairment ranged from 1.96% to 8.74%, and blindness from 0.47% to 5.01%. Vision impairment was associated with older age, female sex, and little or no education. The overall prevalence of presenting vision impairment and blindness decreased during the 2006-2014 interval by 6.31% and 29.0%, respectively; and by 16.1% and 38.0%, respectively, after standardization of 2006 prevalence rates to the 2014 population.Substantial progress has been made in the reduction of vision impairment in rural China. Nevertheless, vision impairment remains an important public health problem with substantial geographic disparities and with older age, female sex, and illiteracy as risk factors.

Purpose: The aim of this study was to investigate the genetic basis and pathogenic mechanism of variable maculopathies, ranging from mild photoreceptor degeneration to central areolar choroidal dystrophy, in a five-generation family. Methods: Clinical characterizations, whole-exome sequencing, and genome-wide linkage analysis were carried out on the family. Zebrafish models were used to investigate the pathogenesis of GUCA1A mutations. Results: A novel mutation, GUCA1A p.R120L, was identified in the family and predicted to alter the tertiary structure of guanylyl cyclase-activating protein 1, a photoreceptor-expressed protein encoded by the GUCA1A gene. The mutation was shown in zebrafish to cause significant disruptions in photoreceptors and retinal pigment epithelium, together with atrophies of retinal vessels and choriocapillaris. Those phenotypes could not be fully rescued by exogenous wild-type GUCA1A, suggesting a likely gain-of-function mechanism for p.R120L. GUCA1A p.D100E, another mutation previously implicated in cone dystrophy, also impaired the retinal pigment epithelium and photoreceptors in zebrafish, but probably via a dominant negative effect. Conclusion: We conclude that GUCA1A mutations could cause significant variability in maculopathies, including central areolar choroidal dystrophy, which represents a severe pattern of maculopathy. The diverse pathogenic modes of GUCA1A mutations may explain the phenotypic diversities. Genet Med advance online publication 26 January 2017

Ningxia Hui Autonomous Region is the main gathering region of Hui nationality in China. Because of unique geographical environment and national characteristics, the incidence of hereditary eye disease is higher in Ningxia Region. From 2010 to 2017, our research team collected 230 pedigrees and 268 sporadic patients with monogenic hereditary eye disease, including 210 pedigrees and 250 sporadic patients with hereditary retinal diseases. Among these pedigrees, 89 (42%) families reported a family history of consanguinity. We carried genetic research on 113 pedigrees and 154 sporadic patients with hereditary retinal diseases. The disease-causing mutations were identified in 66 pedigrees and 69 sporadic patients. Total 63 related disease-causing genes were involved. Four new disease-causing genes were discovered through whole exome sequencing combined with a series of cell experiments and animal experiments, including GUCA1A gene that causes central areolar choroidal dystrophy, CCT2 gene that causes Leber congenital amaurosis, CEP78 gene that causes Usher syndrome, and PRPF4 gene that causes autosomal dominant retinitis pigmentosa. Through whole exome sequencing, we confirmed the clinical diagnosis of combined Marfan syndrome with X-linked hypophosphatemia in a pedigree with complex phenotypes. The homozygous mutation of BEST1 gene was found in a consanguineous family with complicated phenotype, and the diagnosis of autosomal recessive bestrophinopathy (ARB) was made.

Purpose Mutations in the intraflagellar transport protein 52 homolog (IFT52) gene are reported to interrupt ciliary function and cause short-rib thoracic dysplasia (SRTD), a specific form of skeletal ciliopathy. However, the roles of these mutations in retinal ciliopathy are inexplicit. We herein aim to study the impact of IFT52 mutations in retinopathies. Methods A patient with syndromic ciliopathy, presenting mild SRTD (skeletal ciliopathy) and Liber congenital amaurosis (LCA; retinal ciliopathy), and nine unaffected family members were recruited. Comprehensive systemic evaluations, including ophthalmic tests, were received by the patient. Whole genome sequencing (WGS) was applied for genetic annotation. An in vitro cell system was employed to study the pathogenicity of the variant. Results WGS identified a homozygous missense variation in IFT52, c.556A>G (p.T186A), carried by the patient but absent in both unaffected siblings. In silico analysis supported the pathogenic nature of this highly conserved variant. Structural analysis suggested that this substitution could generate a novel hydrogen bond between the mutated residue 186 and proline at residue 192, thus potentially interrupting the tertiary structure and the stability of the IFT52 protein. In vitro cellular study indicated that this mutation might disturb the stability of encoded IFT52 protein and dramatically disrupt cilia elongation in hTERT-RPE1 cells in a loss-of-function manner. Conclusions This report expands ocular phenotypes of IFT52 mutation-caused ciliopathy to include retinal ciliopathy and demonstrates its deleterious nature in interrupting primary ciliary function. Our study hence highlights the need for screening for IFT52 mutations in LCA patients and ophthalmic reviews of patients carrying IFT52 mutations.

Background Retinitis pigmentosa (RP) is the most common form of inherited retinal dystrophy presenting remarkable genetic heterogeneity. Genetic annotations would help with better clinical assessments and benefit gene therapy, and therefore should be recommended for RP patients. This report reveals the disease causing mutations in two RP pedigrees with confusing inheritance patterns using whole exome sequencing (WES). Methods Twenty-five participants including eight patients from two families were recruited and received comprehensive ophthalmic evaluations. WES was applied for mutation identification. Bioinformatics annotations, intrafamilial co-segregation tests, and in silico analyses were subsequently conducted for mutation verification. Results All patients were clinically diagnosed with RP. The first family included two siblings born to parents with consanguineous marriage; however, no potential pathogenic variant was found shared by both patients. Further analysis revealed that the female patient carried a recurrent homozygous C8ORF37 p.W185*, while the male patient had hemizygous OFD1 p.T120A. The second family was found to segregate mutations in two genes, TULP1 and RP1. Two patients born to consanguineous marriage carried homozygous TULP1 p.R419W, while a recurrent heterozygous RP1 p.L762Yfs*17 was found in another four patients presenting an autosomal dominant inheritance pattern. Crystal structural analysis further indicated that the substitution from arginine to tryptophan at the highly conserved residue 419 of TULP1 could lead to the elimination of two hydrogen bonds between residue 419 and residues V488 and S534. All four genes, including C8ORF37, OFD1, TULP1 and RP1, have been previously implicated in RP etiology. Conclusions Our study demonstrates the coexistence of diverse inheritance modes and mutations affecting distinct disease causing genes in two RP families with consanguineous marriage. Our data provide novel insights into assessments of complicated pedigrees, reinforce the genetic complexity of RP, and highlight the need for extensive molecular evaluations in such challenging families with diverse inheritance modes and mutations. Electronic supplementary material The online version of this article (10.1186/s12967-018-1522-7) contains supplementary material, which is available to authorized users.

PURPOSE: To estimate surgical coverage of cataract-related vision impairment and blindness and visual acuity outcomes in operated eyes in rural China in 2014 with comparisons with the 2006 Nine-Province Survey. DESIGN: Population-based, cross-sectional study. METHODS: Geographical cluster sampling was used in randomly selecting residents from a rural county or semi-rural district within 9 provinces: Beijing, Jiangsu, Guangdong, Heilongjiang, Jiangxi, Hebei, Ningxia, Chongqing, and Yunnan. Persons 50 years of age or older were enumerated through household visits and invited to examination sites for visual acuity testing and ocular examination. Surgical coverage and visual acuity outcomes in 2014 were compared with data from the 2006 survey. RESULTS: Among 51 310 examined persons, surgical coverage among those presenting with cataract-related severe visual impairment or blindness (

Retinitis pigmentosa (RP), a disease characterized by progressive loss of photoreceptors, exhibits significant genetic heterogeneity. Several genes associated with U4/U6-U5 triple small nuclear ribonucleoprotein (tri-snRNP) complex of the spliceosome have been implicated in autosomal dominant RP (adRP). HPrp4, encoded by PRPF4, regulates the stability of U4/U6 di-snRNP, which is essential for continuous splicing. Here, we identified two heterozygous variants in PRPF4, including c.-114_-97del in a simplex RP patient and c.C944T (p.Pro315Leu), which co-segregates with disease phenotype in a family with adRP. Both variants were absent in 400 unrelated controls. The c.-114_-97del, predicted to affect two transcription factor binding sites, was shown to down-regulate the promoter activity of PRPF4 by a luciferase assay, and was associated with a significant reduction of PRPF4 expression in the blood cells of the patient. In fibroblasts from an affected individual with the p.Pro315Leu variant, the expression levels of several tri-snRNP components, including PRPF4 itself, were up-regulated, with altered expression pattern of SC35, a spliceosome marker. The same alterations were also observed in cells over expressing hPrp4(Pro315Leu), suggesting that they arose as a compensatory response to a compromised splicing mechanism caused by hPrp4 dysfunction. Further, over expression of hPrp4(Pro315Leu), but not hPrp4(WT), triggered systemic deformities in wild-type zebrafish embryos with the retina primarily affected, and dramatically augmented death rates in morphant embryos, in which orthologous zebrafish prpf4 gene was silenced. We conclude that mutations of PRPF4 cause RP via haploinsufficiency and dominant-negative effects, and establish PRPF4 as a new U4/U6-U5 snRNP component associated with adRP.

The association among genetic variants in VEGFR1 and a predisposition to age-related macular degeneration (AMD) in a northern cohort from China was evaluated.A retrospective case-control correlation study was conducted on 432 cases and 906 gender-and ethnicity-matched controls. Whole DNA was isolated from peripheral blood samples after the individuals underwent detailed eye examinations. Eight single nucleotide polymorphisms (SNPs) in VEGFR1 genes were genotyped for all individuals using a MALDI-TOF technique. The distribution of genotypes was analyzed for Hardy-Weinberg equilibrium and the relationships among the genotype and allele frequencies with AMD were evaluated by age-adjusted logistic regression analysis. The measurement of linkage disequilibrium (LD) was carried out by Haploview 4.2. Bonferroni testing was employed to correct for multiple comparisons.Among the SNPs genotyped, p values of six SNPs were less than 0.05 between AMD cases and unaffected controls. However, after Bonferroni correction, the genotype and allele distributions of only two SNPs, rs9554322 and rs9582036 differed significantly between the controls and AMD patients. Further, the rs9554322 CC genotype conferred strong susceptibility to AMD (OR = 6.057, 95% CI: 3.099-11.839). Rs9943922 was also found to be significantly associated with AMD in the distributions for the genotype and allele recessive model (p = 0.004). The specific haplotype CA of rs9582036 and rs9554320 was associated with AMD (p = 0.035), but the correlation did not remain after correction.The SNPs rs9554322, rs9582036 and rs9943922 were correlated with AMD. Gene variants in VEGFR1 were linked to a pronounced emerging risk for AMD in a population in northern China.

Aim To describe the clinical characteristics with genetic lesions in a Chinese family with Crouzon syndrome. Methods All five patients from this family were included and received comprehensive ophthalmic and systemic examinations. Direct sequencing of the FGFR2 gene was employed for mutation identification. Crystal structure analysis was applied to analyze the structural changes associated with the substitution. Results All patients presented typical Crouzon features, including short stature, craniosynostosis, mandibular prognathism, shallow orbits with proptosis, and exotropia. Intrafamilial phenotypic diversities were observed. Atrophic optic nerves were exclusively detected in the proband and her son. Cranial magnetic resonance imaging (MRI) implied a cystic lesion in her sellar and third ventricular regions. A missense mutation, FGFR2 p.Cys342Trp, was found as disease causative. This substitution would generate conformational changes in the extracellular Ig-III domain of the FGFR-2 protein, thus altering its physical and biological properties. Conclusion We describe the clinical presentations and genotypic lesions in a Chinese family with Crouzon syndrome. The intrafamilial phenotypic varieties in this family suggest that other genetic modifiers may also play a role in the pathogenesis of Crouzon syndrome.

Background Usher syndrome is a genetically heterogeneous disorder featured by combined visual impairment and hearing loss. Despite a dozen of genes involved in Usher syndrome having been identified, the genetic basis remains unknown in 20–30% of patients. In this study, we aimed to identify the novel disease-causing gene of a distinct subtype of Usher syndrome. Methods Ophthalmic examinations and hearing tests were performed on patients with Usher syndrome in two consanguineous families. Target capture sequencing was initially performed to screen causative mutations in known retinal disease-causing loci. Whole exome sequencing (WES) and whole genome sequencing (WGS) were applied for identifying novel disease-causing genes. RT-PCR and Sanger sequencing were performed to evaluate the splicing-altering effect of identified CEP78 variants. Results Patients from the two independent families show a mild Usher syndrome phenotype featured by juvenile or adult-onset cone–rod dystrophy and sensorineural hearing loss. WES and WGS identified two homozygous rare variants that affect mRNA splicing of a ciliary gene CEP78 . RT-PCR confirmed that the two variants indeed lead to abnormal splicing, resulting in premature stop of protein translation due to frameshift. Conclusions Our results provide evidence that CEP78 is a novel disease-causing gene for Usher syndrome, demonstrating an additional link between ciliopathy and Usher protein network in photoreceptor cells and inner ear hair cells.

We aim to characterize the clinical features and genetic causes for two affected siblings from a Chinese family with cone dystrophy (CD). Two patients and four unaffected family members were recruited and received complete ophthalmic examinations. Genomic DNA was isolated from the peripheral blood samples from all patients. Targeted next-generation sequencing (NGS) approach followed by intrafamilal cosegregation and in silico analyses were employed to determine the genetic defects. Ophthalmic evaluations finalized the clinical diagnosis of CD for the two patients in this family, both of whom presented macular atrophy with no remarkable changes in the peripheral retina. Comprehensive genetic screening approach revealed biallelic missense mutations in the Leber congenital amaurosis 5 (LCA5) gene, p.[Ala212Pro];[Tyr441Cys], as disease causative for this family. Both mutations were novel. The first substitution was predicted to eliminate a hydrogen bond and alter the tertiary structure of lebercilin, protein encoded by LCA5. We for the first time report novel biallelic LCA5 mutations in causing CD. Our study extends the phenotypic and genotypic spectrums for LCA5-associated retinopathies and better illustrates its genotype-phenotype correlations, which would help with better genetic diagnosis, prognosis and personalized treatment for CD patients.

Background: The objective of this study was to determine the frequency and characteristics of mutations in the RP1 gene and to characterize mutations with the clinical features in the Chinese family with autosomal dominant retinitis pigmentosa (ADRP). Methods: Forty-three affected, unrelated Chinese individuals with ADRP were recruited between 2002 and 2006. Polymerase chain reaction and direct DNA sequencing were used to screen in the entire coding region and splice sites of the RP1 gene. Cosegregation analysis and population frequency studies were performed for patients with identified mutations. The clinical features were determined by complete ophthalmologic examinations. Results: The mutation detectable rate of the RP1 gene in Chinese patients with ADRP was 1/43. A missense mutation, N985Y , was identified in exon 4 of the RP1 gene in 8 affected individuals from a Chinese family with ADRP. The ophthalmic findings with an N985Y mutation were similar to those of typical retinitis pigmentosa with delayed onset after age 40 years and slow progression. In addition, a total of 9 distinct variants were detected in our study population, most of which were RP1 gene polymorphisms; the pathological significance of P903L , a novel missense mutation, was unconfirmed. Interpretation: Mutations in the RP1 gene are relatively rare in Chinese patients with ADRP. In our cases, N985Y mutation segregated with the phenotype from 1 Chinese family with mild and late-onset ADRP, a finding that has not been documented in other races.

Background To determine the genetic lesions and to modify the clinical diagnosis for a Chinese family with significant intrafamilial phenotypic diversities and unusual presentations. Methods Three affected patients and the asymptomatic father were included and received comprehensive systemic examinations. Whole exome sequencing (WES) was performed for mutation detection. Structural modeling test was applied to analyze the potential structural changes caused by the missense substitution. Results The proband showed a wide spectrum of systemic anomalies, including bilateral ectopia lentis, atrial septal defect, ventricular septal defect, widening of tibial metaphysis with medial bowing, and dolichostenomelia in digits, while her mother and elder brother only demonstrated similar skeletal changes. A recurrent mutation, PHEX p.R291*, was found in all patients, while a de novo mutation, FBN1 p.C792F, was only detected in the proband. The FBN1 substitution was also predicted to cause significant conformational change in fibrillin-1 protein, thus changing its physical and biological properties. Conclusions Taken together, we finalized the diagnosis for this family as X-linked hypophosphatemia (XLH), and diagnosed this girl as Marfan syndrome combined with XLH, and congenital heart disease. Our study also emphasizes the importance of WES in assisting the clinical diagnosis for complicated cases when the original diagnoses are challenged. Electronic supplementary material The online version of this article (doi:10.1186/s12967-015-0534-9) contains supplementary material, which is available to authorized users.

EYS mutations demonstrate great genotypic and phenotypic varieties, and are one of the major causes for patients with autosomal recessive retinitis pigmentosa (ARRP). Here, we aim to determine the genetic lesions with phenotypic correlations in two Chinese families with ARRP. Medical histories and ophthalmic documentations were obtained from all participants from the two pedigrees. Targeted next-generation sequencing (NGS) on 189 genes was performed to screen for RP causative mutations in the two families. Two biallelic mutations in EYS, p.[R164*];[C2139Y] and p.[W2640*];[F2954S], were identified in the two families, respectively. EYS p.R164* and p.F2954S are novel alleles associated with RP, while p.C2139Y and p.W2640* are known mutations. Crystal structure modeling on the protein eyes shut homolog encoded by the EYS gene revealed abnormal hydrogen bonds generated by p.C2139Y and p.F2954S, which would likely affect the solubility and cause significant structural changes of the two mutated proteins. In conclusion, our study expands the genotypic spectrums for EYS mutations, and may provide novel insights into the relevant pathogenesis for RP. We also demonstrate targeted NGS approach as a valuable tool for genetic diagnosis.

Additional file 1: Supplementary Tables.

To detect the disease-causing genes of 10 retinitis pigmentosa pedigrees by using exon combined target region capture sequencing chip.Pedigree investigation study. From October 2010 to December 2013, 10 RP pedigrees were recruited for this study in Ningxia Eye Hospital. All the patients and family members received complete ophthalmic examinations. DNA was abstracted from patients, family members and controls. Using exon combined target region capture sequencing chip to screen the candidate disease-causing mutations. Polymerase chain reaction (PCR) and direct sequencing were used to confirm the disease-causing mutations.Seventy patients and 23 normal family members were recruited from 10 pedigrees. Among 10 RP pedigrees, 1 was autosomal dominant pedigrees and 9 were autosomal recessive pedigrees. 7 mutations related to 5 genes of 5 pedigrees were detected. A frameshift mutation on BBS7 gene was detected in No.2 pedigree, the patients of this pedigree combined with central obesity, polydactyly and mental handicap. No.2 pedigree was diagnosed as Bardet-Biedl syndrome finally. A missense mutation was detected in No.7 and No.10 pedigrees respectively. Because the patients suffered deafness meanwhile, the final diagnosis was Usher syndrome. A missense mutation on C3 gene related to age-related macular degeneration was also detected in No. 7 pedigrees. A nonsense mutation and a missense mutation on CRB1 gene were detected in No. 1 pedigree and a splicesite mutation on PROM1 gene was detected in No. 5 pedigree.Retinitis pigmentosa is a kind of genetic eye disease with diversity clinical phenotypes. Rapid and effective genetic diagnosis technology combined with clinical characteristics analysis is helpful to improve the level of clinical diagnosis of RP.

USH2A mutations have been implicated in the disease etiology of several inherited diseases, including Usher syndrome type 2 (USH2), nonsyndromic retinitis pigmentosa (RP), and nonsyndromic deafness. The complex genetic and phenotypic spectrums relevant to USH2A defects make it difficult to manage patients with such mutations. In the present study, we aim to determine the genetic etiology and to characterize the correlated clinical phenotypes for three Chinese pedigrees with nonsyndromic RP, one with RP sine pigmento (RPSP), and one with USH2. Family histories and clinical details for all included patients were reviewed. Ophthalmic examinations included best corrected visual acuities, visual field measurements, funduscopy, and electroretinography. Targeted next-generation sequencing (NGS) was applied using two sequence capture arrays to reveal the disease causative mutations for each family. Genotype-phenotype correlations were also annotated. Seven USH2A mutations, including four missense substitutions (p.P2762A, p.G3320C, p.R3719H, and p.G4763R), two splice site variants (c.8223+1G>A and c.8559-2T>C), and a nonsense mutation (p.Y3745*), were identified as disease causative in the five investigated families, of which three reported to have consanguineous marriage. Among all seven mutations, six were novel, and one was recurrent. Two homozygous missense mutations (p.P2762A and p.G3320C) were found in one individual family suggesting a potential double hit effect. Significant phenotypic divergences were revealed among the five families. Three families of the five families were affected with early, moderated, or late onset RP, one with RPSP, and the other one with USH2. Our study expands the genotypic and phenotypic variability relevant to USH2A mutations, which would help with a clear insight into the complex genetic and phenotypic spectrums relevant to USH2A defects, and is complementary for a better management of patients with such mutations. We have also demonstrated that a targeted NGS approach is a valuable tool for the genetic diagnosis of USH2 and RP.

The associations between genetic variants located in CFH, CFB, ARMS2 and HTRA1 and the risk of age-related macular degeneration (AMD) in a northern Chinese population were investigated.A case-control association study of 150 AMD patients and 145 ethnicity- and gender-matched controls were recruited. Genomic DNA was prepared from peripheral blood after the participants underwent comprehensive eye examinations. All individuals were genotyped for eight single nucleotide polymorphisms (SNPs) in four specific genes. Genotypic distribution was tested for Hardy-Weinberg equilibrium. Statistical analysis was performed for genotype, allele and haplotype frequencies along with their p values and corresponding odds ratios (OR), 95% confidence intervals (95% CI) and measures of linkage disequilibrium (LD). Bonferroni corrections for multiple comparisons were performed.Among the SNPs genotyped, p values of seven SNPs were less than 0.05 in the genotypic distributions and allele frequencies between AMD and control subjects. However, after Bonferroni correction, the genotype and allele distributions of two SNPs in CFH (rs10737680, rs1410996), one SNP (rs10490924) in ARMS2 and one SNP (rs11200638) in HTRA1 differed significantly between the controls and AMD patients. Two SNPs were significantly associated with AMD in the allele distributions. They were rs800292 (p(allele) = 0.006, OR [CI] = 1.643[1.155-2.336]) in CFH and rs641153 (p(allele) = 0.002, OR [CI] = 0.273[0.120-0.620]) in CFB. Five haplotypes in CFH significantly predisposed patients to AMD after 50,000 permutations (p = 0.0099, p = 0.0099, p = 0.0013, p = 0.0414 and p = 0.0327).Gene variants in CFH, ARMS2 and HTRA1 are related to an increased risk of AMD in a northern Chinese population.