Search

Objective: Theracurmin is a submicron dispersed formulation of curcumin, which was developed to increase the bioavailability of curcumin. This study aimed to compare the pharmacokinetics of curcumin administered as two Theracurmin powder products and unformulated curcumin powder., Materials and Methods: This randomized, three-treatment, six-sequence, and three-period crossover study enrolled 24 healthy subjects. Blood sampling was done until 12 hours after the administration of Theracurmin and curcumin powder to assess pharmacokinetics using a non-compartmental method. The plasma concentration of curcumin was determined using high-performance liquid chromatography coupled with tandem mass spectrometry., Results: The median time to reach the maximum concentration was 1.5 - 3 hours for Theracurmin and 8 hours for curcumin powder. The two Theracurmin products showed systemic exposure profiles that were comparable to each other. The exposure ratio of Theracurmin to curcumin powder was 18.4 - 20.5 for the maximum plasma concentration and 35.9 - 42.6 for the area under the concentration-time curve from dosing to the last measurable time., Conclusion: In conclusion, this study showed similar systemic exposure between the two Theracurmin products. The absorption of curcumin after the administration of Theracurmin was significantly enhanced compared with curcumin powder.

In eukaryotic cells, mitochondria are closely tethered to the endoplasmic reticulum (ER) at sites called mitochondria-associated ER membranes (MAMs). Ca 2+ ion and phospholipid transfer occurs at MAMs to support diverse cellular functions. Unlike those in yeast, the protein complexes involved in phospholipid transfer at MAMs in humans have not been identified. Here, we determine the crystal structure of the tetratricopeptide repeat domain of PTPIP51 (PTPIP51_TPR), a mitochondrial protein that interacts with the ER-anchored VAPB protein at MAMs. The structure of PTPIP51_TPR shows an archetypal TPR fold, and an electron density map corresponding to an unidentified lipid-like molecule probably derived from the protein expression host is found in the structure. We reveal functions of PTPIP51 in phospholipid binding/transfer, particularly of phosphatidic acid, in vitro. Depletion of PTPIP51 in cells reduces the mitochondrial cardiolipin level. Additionally, we confirm that the PTPIP51-VAPB interaction is mediated by the FFAT-like motif of PTPIP51 and the MSP domain of VAPB. Our findings suggest that PTPIP51 is a phospholipid transfer protein with a MAM-tethering function., (© 2021 The Authors.)

Curcumin, a hydrophobic polyphenol isolated from the Curcuma longa L . plant, has many pharmacological properties, including antioxidant, anti-inflammatory, and chemo-preventive activities. Curcumin has been shown to have potential in preventing nonalcoholic fatty liver disease (NAFLD). However, the low bioavailability of curcumin has proven to be a major limiting factor in its clinical adoption. Theracurmin, a highly bioavailable curcumin that utilizes micronized technology showed improved biological absorbability in vivo . The aim of this study was to investigate the role of theracurmin in modulating hepatic lipid metabolism in vivo . A fatty liver mouse model was produced by feeding mice a high fat diet (HFD; 60% fat) for 12 weeks. We found that treatment for 12 weeks with theracurmin significantly lowered plasma triacylglycerol (TG) levels and reduced HFD-induced liver fat accumulation. Theracurmin treatment lowered hepatic TG and total cholesterol (T-CHO) levels in HFD-fed mice compared to controls. In addition, theracurmin administration significantly reduced lipid peroxidation and cellular damage caused by reactive oxygen species in HFD-fed mice. Overall, these results suggest that theracurmin has the ability to control lipid metabolism and can potentially serve as an effective therapeutic remedy for the prevention of fatty liver., Competing Interests: CONFLICT OF INTEREST The Authors who have taken part in this study declared that they do not have anything to disclose regarding funding or conflict of interest with respect to this manuscript. Hee Hye Yun is former employee of HANDOK, Inc., (Copyright © 2019 The Korean Society Of Toxicology.)

FadR is a fatty acyl-CoA dependent transcription factor that regulates genes encoding proteins involved in fatty-acid degradation and synthesis pathways. In this study, the crystal structures of Bacillus halodurans FadR, which belong to the TetR family, have been determined in three different forms: ligand-bound, ligand-free and DNA-bound at resolutions of 1.75, 2.05 and 2.80 Å, respectively. Structural and functional data showed that B. halodurans FadR was bound to its operator site without fatty acyl-CoAs. Structural comparisons among the three different forms of B. halodurans FadR revealed that the movement of DNA binding domains toward the operator DNA was blocked upon binding of ligand molecules. These findings suggest that the TetR family FadR negatively regulates the genes involved in fatty acid metabolism by binding cooperatively to the operator DNA as a dimer of dimers., (© The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.)

Kaposi's sarcoma-associated herpesvirus (KSHV) is a highly infectious human herpesvirus that causes Kaposi's sarcoma. KSHV encodes functional thymidylate synthase, which is a target for anticancer drugs such as raltitrexed or 5-fluorouracil. Thymidylate synthase catalyzes the conversion of 2'-deoxyuridine-5'-monophosphate (dUMP) to thymidine-5'-monophosphate (dTMP) using 5,10-methylenetetrahydrofolate (mTHF) as a co-substrate. The crystal structures of thymidylate synthase from KSHV (apo), complexes with dUMP (binary), and complexes with both dUMP and raltitrexed (ternary) were determined at 1.7 Å, 2.0 Å, and 2.4 Å, respectively. While the ternary complex structures of human thymidylate synthase and E. coli thymidylate synthase had a closed conformation, the ternary complex structure of KSHV thymidylate synthase was observed in an open conformation, similar to that of rat thymidylate synthase. The complex structures of KSHV thymidylate synthase did not have a covalent bond between the sulfhydryl group of Cys219 and C6 atom of dUMP, unlike the human thymidylate synthase. The catalytic Cys residue demonstrated a dual conformation in the apo structure, and its sulfhydryl group was oriented toward the C6 atom of dUMP with no covalent bond upon ligand binding in the complex structures. These structural data provide the potential use of antifolates such as raltitrexed as a viral induced anticancer drug and structural basis to design drugs for targeting the thymidylate synthase of KSHV., Competing Interests: The authors have declared that no competing interests exist.

The arginine repressor (ArgR) is an arginine-dependent transcription factor that regulates the expression of genes encoding proteins involved in the arginine biosynthesis and catabolic pathways. ArgR is a functional homolog of the arginine-dependent repressor/activator AhrC from Bacillus subtilis, and belongs to the ArgR/AhrC family of transcriptional regulators. In this research, we determined the structure of the ArgR (Bh2777) from Bacillus halodurans at 2.41 Å resolution by X-ray crystallography. The ArgR from B. halodurans appeared to be a trimer in a size exclusion column and in the crystal structure. However, it formed a hexamer in the presence of L-arginine in multi-angle light scattering (MALS) studies, indicating the oligomerization state was dependent on the presence of L-arginine. The trimeric structure showed that the C-terminal domains form the core, which was made by inter-subunit interactions mainly through hydrophobic contacts, while the N-terminal domains containing a winged helix-turn-helix DNA binding motif were arranged around the periphery. The arrangement of trimeric structure in the B. halodurans ArgR was different from those of other ArgR homologs previously reported. We finally showed that the B. halodurans ArgR has an arginine-dependent DNA binding property by an electrophoretic mobility shift assay.

Charcot-Marie-Tooth disease (CMT) is a heterogeneous group of peripheral neuropathies with diverse genetic causes. In this study, we identified p.I43N mutation in PMP2 from a family exhibiting autosomal dominant demyelinating CMT neuropathy by whole exome sequencing and characterized the clinical features. The age at onset was the first to second decades and muscle atrophy started in the distal portion of the leg. Predominant fatty replacement in the anterior and lateral compartment was similar to that in CMT1A caused by PMP22 duplication. Sural nerve biopsy showed onion bulbs and degenerating fibers with various myelin abnormalities. The relevance of PMP2 mutation as a genetic cause of dominant CMT1 was assessed using transgenic mouse models. Transgenic mice expressing wild type or mutant (p.I43N) PMP2 exhibited abnormal motor function. Electrophysiological data revealed that both mice had reduced motor nerve conduction velocities (MNCV). Electron microscopy revealed that demyelinating fibers and internodal lengths were shortened in both transgenic mice. These data imply that overexpression of wild type as well as mutant PMP2 also causes the CMT1 phenotype, which has been documented in the PMP22. This report might expand the genetic and clinical features of CMT and a further mechanism study will enhance our understanding of PMP2-associated peripheral neuropathy.

Background and Objective: While the association for apolipoprotein ɛ4 allele (APOE4) with Alzheimer's disease (AD) has been consistently confirmed, the association with vascular cognitive impairment (VCI) is unclear. We therefore explored the relationship of APOE with both AD and cerebrovascular disease (CeVD) by examining the prevalence of APOE4 in AD, AD with CeVD and vascular dementia (VaD), as well as in cognitive impairment no dementia (CIND) with and without CeVD., Methods: We performed a case-control study with subjects recruited from memory clinics and the community. All subjects underwent standardized brain neuroimaging, clinical and neuropsychological assessments, following which they were classified using research criteria., Results: A total of 411 subjects; 92 controls with no cognitive impairment (NCI), 77 CIND without CeVD, 87 CIND with CeVD, 55 AD without CeVD, 68 AD with CeVD, and 32 VaD patients were recruited. Compared to NCI (16.3%), the prevalence of APOE4 carriers was significantly higher only in CIND (37.7%) and AD in the absence of CeVD (45.5%), but not in the three subgroups of VCI, namely CIND with CeVD (20.7%), AD with CeVD (27.9%) and VaD (25.0%). Logistic regression analyses also showed that APOE4 carriers were more likely to have CIND without CeVD (Odds Ratio [OR]: 3.34; 95% Confidence Interval [CI]: 1.59-7.03) and AD without CeVD (OR: 7.21; 95% CI: 2.74-18.98), but no such association was observed in the VCI subgroups., Conclusion: APOE4 is significantly associated with dementia and CIND due to AD pathology, but not with VCI.

Background: Mutations in heat shock 27 kDa protein 1 (HSP27 or HSPB1) cause distal hereditary motor neuropathy (dHMN) or Charcot-Marie-Tooth disease type 2 F (CMT2F) according to unknown factors. Mutant HSP27 proteins affect axonal transport by reducing acetylated tubulin., Results: We generated a transgenic mouse model overexpressing HSP27-S135F mutant protein driven by Cytomegalovirus (CMV) immediate early promoter. The mouse phenotype was similar to dHMN patients in that they exhibit motor neuropathy. To determine the phenotypic aberration of transgenic mice, behavior test, magnetic resonance imaging (MRI), electrophysiological study, and pathology were performed. Rotarod test showed that founder mice exhibited lowered motor performance. MRI also revealed marked fatty infiltration in the anterior and posterior compartments at calf level. Electrophysiologically, compound muscle action potential (CMAP) but not motor nerve conduction velocity (MNCV) was reduced in the transgenic mice. Toluidine staining with semi-thin section of sciatic nerve showed the ratio of large myelinated axon fiber was reduced, which might cause reduced locomotion in the transgenic mice. Electron microscopy also revealed abundant aberrant myelination. Immunohistochemically, neuronal dysfunctions included elevated level of phosphorylated neurofilament and reduced level of acetylated tubulin in the sural nerve of transgenic mice. There was no additional phenotype besides motor neuronal defects., Conclusions: Overexpression of HSP27-S135F protein causes peripheral neuropathy. The mouse model can be applied to future development of therapeutic strategies for dHMN or CMT2F.

The arginine repressor (ArgR) is a transcriptional regulator which regulates genes encoding proteins involved in arginine biosynthesis and the arginine catabolic pathway. ArgR from the alkaliphilic bacterium Bacillus halodurans was cloned and overexpressed in Escherichia coli. ArgR (Bh2777) from B. halodurans is composed of 149 amino-acid residues with a molecular mass of 16 836 Da. ArgR was crystallized at 296 K using 1,2-propanediol as a precipitant. Crystals of N-terminally His-tagged ArgR were obtained by the sitting-drop vapour-diffusion method. Dehydrated crystals showed a dramatic improvement in diffraction quality and diffracted to 2.35 Å resolution. The crystals belonged to the cubic space group I23, with unit-cell parameters a = b = c = 104.68 Å. The asymmetric unit contained one monomer of ArgR, which generates a trimer by the threefold axis of the space group, giving a crystal volume per mass (VM) of 2.98 Å(3) Da(-1) and a solvent content of 56.8%.

The iron-dependent regulator (IdeR) is a metal ion-activated transcriptional repressor that regulates the expression of genes encoding proteins involved in iron uptake to maintain metal-ion homeostasis. IdeR is a functional homologue of the diphtheria toxin repressor (DtxR), and both belong to the DtxR/MntR family of metalloregulators. The structure of Fe(2+)-bound IdeR (TA0872) from Themoplasma acidophilum was determined at 2.1 Å resolution by X-ray crystallography using single-wavelength anomalous diffraction. The presence of Fe(2+), which is the true biological activator of IdeR, in the metal-binding site was ascertained by the use of anomalous difference electron-density maps using diffraction data collected at the Fe absorption edge. Each DtxR/IdeR subunit contains two metal ion-binding sites separated by 9 Å, labelled the primary and ancillary sites, whereas the crystal structures of IdeR from T. acidophilum show a binuclear iron cluster separated by 3.2 Å, which is novel to T. acidophilum IdeR. The metal-binding site analogous to the primary site in DtxR was unoccupied, and the ancillary site was occupied by binuclear clustered ions. This difference suggests that T. acidophilum IdeR and its closely related homologues are regulated by a mechanism distinct from that of either DtxR or MntR. T. acidophilum IdeR was also shown to have a metal-dependent DNA-binding property by electrophoretic mobility shift assay.

YhgD is a member of the TetR-family transcription factors, which regulate genes encoding proteins involved in multidrug resistance, virulence, osmotic stress and pathogenicity. YhgD from the alkaliphilic bacterium Bacillus halodurans was cloned and overexpressed in Escherichia coli. YhgD (Bh2145) from B. halodurans is composed of 193 amino-acid residues with a molecular mass of 21 853 Da. YhgD was crystallized at 296 K using ethylene glycol as a precipitant by the sitting-drop vapour-diffusion method. The crystal diffracted to 1.9 Å resolution and belonged to the apparent triclinic space group P1, with unit-cell parameters a = 37.22, b = 47.85, c = 54.15 Å, α = 92.75, β = 107.9, γ = 90.27°. The asymmetric unit is likely to contain two molecules of monomeric YhgD, giving a crystal volume per mass (VM) of 2.05 Å(3) Da(-1) and a solvent content of 40.2%.

Parabens are alkyl esters of p-hydroxybenzoic acid (BA), including methyl paraben (MP), ethyl paraben, propyl paraben (PP), and butyl paraben (BP). In the present study, possible role of metabolism by fecalase in BP-induced cytotoxicity was investigated in HepG2 cell cultures. As an intestinal bacterial metabolic system, a human fecalase prepared from human fecal specimen was employed. Among the parabens tested, cytotoxicity of BP was most severe. BA, the de-esterified metabolite, did not induce cytotoxicity when compared to other parabens. When BP was incubated with fecalase, it rapidly disappeared, in association with reduced cytotoxicity in HepG2 cells. In addition, BP incubated with fecalase significantly caused an increase in Bcl-2 expression together with a decrease in Bax expression and cleaved caspase-3. Moreover, anti-apoptotic effect by the incubation of BP with fecalase was also confirmed by the TUNEL assay. Furthermore, BP induced a sustained activation of the phosphorylation of JNK only when it was treated alone. Meanwhile, BP-induced cell death was reversed by the pre-incubation of BP with either fecalase or SP600125. Taken together, the findings suggested that metabolism of BP by human fecalase might have protective effects against BP-induced toxicity in HepG2 cells., (Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.)

FadR is an acyl-CoA-dependent transcription factor which regulates genes encoding proteins involved in fatty-acid degradation and synthesis in order to maintain lipid homeostasis. FadR from the alkaliphilic bacterium Bacillus halodurans was cloned and overexpressed in Escherichia coli. The FadR (Bh3102) protein from B. halodurans is composed of 195 amino-acid residues with a molecular mass of 22 378 Da. Crystals were obtained by the sitting-drop vapour-diffusion method and diffracted to 2.05 Å resolution. FadR was crystallized at 296 K using polyethylene glycol 3350 as a precipitant. The crystal belonged to the apparent trigonal space group P3(2)21, with unit-cell parameters a = b = 56.34, c = 199.73 Å. The Matthews coefficient and solvent content were estimated to be 2.0 Å(3) Da(-1) and 39.8%, respectively, assuming that the asymmetric unit contained two molecules of FadR, which was subsequently confirmed by molecular-replacement calculations.

Orally administered herbal glycosides are metabolized to their hydrophobic compounds by intestinal microflora in the intestine of animals and human, not liver enzymes, and absorbed from the intestine to the blood. Of these metabolites, some, such as quercetin and kaempherol, are mutagenic. The fecal bacterial enzyme fraction (fecalase) of human or animals has been used for measuring the mutagenicity of dietary glycosides. However, the fecalase activity between individuals is significantly different and its preparation is laborious and odious. Therefore, we developed a fecal microbial enzyme mix (FM) usable in the Ames test to remediate the fluctuated reaction system activating natural glycosides to mutagens. We selected, cultured, and mixed 4 bacteria highly producing glycosidase activities based on a cell-free extract of feces (fecalase) from 100 healthy Korean volunteers. When the mutagenicities of rutin and methanol extract of the flos of Sophora japonica L. (SFME), of which the major constituent is rutin, towards Salmonella typhimurium strains TA 98, 100, 102, 1,535, and 1,537 were tested using FM and/or S9 mix, these agents were potently mutagenic. These mutagenicities using FM were not significantly different compared with those using Korean fecalase. SFME and rutin were potently mutagenic in the test when these were treated with fecalase or FM in the presence of S9 mix, followed by those treated with S9 mix alone and those with fecalase or FM. Freeze-dried FM was more stable in storage than fecalase. Based on these findings, FM could be usable instead of human fecalase in the Ames test.

Intestinal microflora (IM) is able to produce toxic and carcinogenic metabolites and induce more potent cytotoxicity against cells than non-metabolites. This study was performed to investigate the cytotoxic responses of geniposide (GS) and its metabolite and to determine the role of metabolism by IM in GS-induced cytotoxicity. Genipin (GP), a GS metabolite, increased cytotoxic effects in cells, but GS did not. Following GS incubation with IM for metabolic activation, increased cytotoxicity was detected compared to GS. Western blot analysis revealed that the activated GS inhibited Bcl-2 expression with a subsequent increase in Bax expression. Likewise, GS activation by IM stimulated caspase-3 and the production of reactive oxygen species (ROS). In addition, activated GS-induced apoptosis was confirmed by apoptosis and ROS assays; N-acetyl-l-cysteine (NAC) suppressed ROS production and apoptotic cell death. Activated GS induced sustained JNK phosphorylation. Moreover, activated GS-induced cell death was reversed by SP600125. Taken together, these findings suggest that human IM is able to metabolize GS into GP, and the related biological activities induce apoptosis through ROS/JNK signaling., (Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.)

Possible role of metabolism by the intestinal bacteria in geniposide-induced cytotoxicity was investigated in human hepatoma HepG2 cells. Initially, toxic effects of geniposide and its metabolite genipin were compared. Genipin, a deglycosylated form of geniposide, was cytotoxic at the concentrations that geniposide was not. As metabolic activation systems for geniposide, human intestinal bacterial cultures, fecal preparation (fecalase) and intestinal microbial enzyme mix were employed in the present study. When geniposide was incubated with human intestinal bacteria, either Bifidobacterium longum HY8001 or Bacteroides fragilis, for 24 h, the cultured media caused cytotoxicity in HepG2 cells. Fecalase and intestinal enzyme mix were also effective to metabolically activate geniposide to its cytotoxic metabolite. The present results indicated that genipin, a metabolite of geniposide, might be more toxic than geniposide, and that intestinal bacteria might have a role in biotransformation of geniposide to its toxic metabolite. In addition, among three activation systems tested, intestinal microbial enzyme mix would be convenient to use in detecting toxicants requiring metabolic activation by intestinal bacteria.

The diphtheria toxin repressor (DtxR) is a metal-ion-dependent transcriptional regulator which regulates genes encoding proteins involved in metal-ion uptake to maintain metal-ion homeostasis. DtxR from Thermoplasma acidophilum was cloned and overexpressed in Escherichia coli. Crystals of N-terminally His-tagged DtxR were obtained by hanging-drop vapour diffusion and diffracted to 1.8 Å resolution. DtxR was crystallized at 296 K using polyethylene glycol 4000 as a precipitant. The crystals belonged to the orthorhombic space group P2(1)2(1)2, with unit-cell parameters a = 61.14, b = 84.61, c = 46.91 Å, α = β = γ = 90°. The asymmetric unit contained approximately one monomer of DtxR, giving a crystal volume per mass (V(M)) of 2.22 Å(3) Da(-1) and a solvent content of 44.6%.

Baicalin, a glycoside present in Scutellaria baicalensis Georgi, is metabolized to its aglycone, baicalein, in intestine. In the present study, possible role of metabolism of baicalin by intestinal bacteria to baicalein in baicalin-induced toxicity was investigated in HepG2 cell cultures. As an intestinal bacterial metabolic system for baicalin, human fecal preparation containing intestinal microflora (fecalase) was employed. Initially, when cytotoxic effects of baicalin and baicalein were compared, baicalin was more cytotoxic than baicalein in HepG2 cells. When baicalin was incubated with fecalase, it was metabolized to baicalein. In addition, baicalin-incubated with fecalase reduced cytotoxicity of HepG2 cells in a concentration-dependent manner. Moreover, baicalin-incubated with fecalase significantly caused an increase in Bcl-2 expression together with a decrease in Bax expression and cleaved Caspase-3. Furthermore, anti-apoptotic effect by the incubation of baicalin with fecalase was also confirmed by the terminal deoxynucleotidyltransferase-mediated dUTP-biotin nick-end labeling assay. Taken all together, the findings suggested that metabolism of baicalin by human fecalase to baicalein might have protective effects against baicalin-induced toxicity in HepG2 cells.

A possible role for metabolism by the human intestinal microflora in arbutin-induced cytotoxicity was investigated using human hepatoma HepG2 cells. When the cytotoxic effects of arbutin and hydroquinone (HQ), a deglycosylated metabolite of arbutin, were compared, HQ was more toxic than arbutin. Incubation of arbutin with a human fecal preparation could produce HQ. Following incubation of arbutin with a human fecal preparation for metabolic activation, the reaction mixture was filter-sterilized to test its toxic effects on HepG2 cells. The mixture induced cytotoxicity in HepG2 cells in a concentration-dependent manner. In addition, the mixture considerably inhibited expression of Bcl-2 together with an increase in Bax expression. Likewise, activation stimulated cleavage of caspase-3 and production of reactive oxygen species in HepG2 cell cultures. Furthermore, induction of apoptosis by the intestinal microflora reaction mixture was confirmed by the terminal deoxynucleotidyltransferase-mediated dUTP-biotin nick-end labeling assay. Taken together, these findings suggest that the human intestinal microflora is capable of metabolizing arbutin to HQ, which can induce apoptosis in mammalian cells., (Copyright © 2011 Elsevier Inc. All rights reserved.)

A randomised, double blind, repeated measures study was conducted to investigate the initial effects of an accessory mobilisation technique applied to the ankle joint in 13 patients with a unilateral sub-acute ankle supination injury. Ankle dorsiflexion range of motion, pressure pain threshold, visual analogue scale rating of pain during functional activity and ankle functional scores were assessed before and after application of treatment, manual contact control and no contact control conditions. There were significant improvements in ankle dorsiflexion range of motion (p = 0.000) and pressure pain threshold (p = 0.000) during the treatment condition. However no significant effects were observed for the other measures. These findings demonstrate that mobilisation of the ankle joint can produce an initial hypoalgesic effect and an improvement in ankle dorsiflexion range of motion., (Crown Copyright © 2011. Published by Elsevier Ltd. All rights reserved.)

Soybean, which contains soyasaponins and isoflavones as representative constituents, exhibits anti-inflammatory and antioxidant effects. To understand the anti-inflammatory effects of soyasaponins, we isolated soyasaponin I, a major constituent of soybean, and investigated the inhibitory effects on inflammatory markers in LPS-stimulated mouse peritoneal macrophages and 3,4,5-trinitrobenzenosulfonic acid (TNBS)-induced colitic mice. Soyasaponin I, which exhibited lipid peroxidation-inhibitory effects in vitro, inhibited the production of proinflammatory cytokines (TNF-α and IL-1β), inflammatory mediators (NO and PGE2), and inflammatory enzymes (COX-2 and iNOS) in LPS-stimulated peritoneal macrophages. Soyasaponin I also suppressed the phosphorylation of IκB-α and the nuclear translocation of NF-κB. However, these soyasaponins barely inhibited mitogen-activated protein kinases. Oral administration of soyasaponin I (10 and 20 mg/kg) to TNBS-treated colitic mice significantly reduced inflammatory markers, colon length, myeloperoxidase, lipid peroxide (malondialdehyde and 4-hydroxy-2-nonenal), proinflammatory cytokines and NF-κB activation in the colon, as well as increased glutathione content, superoxide dismutase, and catalase activity. Based on these findings, soyasaponin I may attenuate colitis by inhibiting the NF-κB pathway.

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

The AIP1 fraction, a small water-soluble fraction purified from Artemisia iwayomogi, was shown to increase antibody production and suppress transplanted tumor cell growth in mice. In order to understand its immuno-modulating activity, we have examined the effect of the AIP1 on mouse thymocytes in vitro. Treatment of mouse thymocytes in culture with the fraction resulted in the suppression of the cell death and the extension of the cell survival. A mouse gene array provided a profile of gene expression change showing the pattern of up- and down-regulated genes by the AIP1 treatment, suggesting that the Fas/FasL-dependent apoptosis pathway might be modulated by the fraction.

Apoptotic death of mouse thymocytes in vitro, as induced by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), involves the up-regulation of Fas gene expression, while a carbohydrate fraction, AIP1, from Artemisia iwayomogi suppresses the death of thymocytes in culture along with the down-regulation of Fas gene expression. We have now investigated whether the AIP1 fraction modulates TCDD-induced thymocyte death. When treated with TCDD and AIP1 fraction together, the thymocytes do not show apoptosis induced by the TCDD treatment. The AIP1 supplementation to the TCDD treatment also down-regulates the TCDD-induced Fas gene up-regulation. These findings indicate that the AIP1 fraction suppresses TCDD-induced thymocyte apoptosis through the modulation of Fas gene expression.