Search

Abstract Human norovirus (HuNoV) is an enteric infectious pathogen belonging to the Caliciviridae family that causes occasional epidemics. Circulating alcohol-tolerant viral particles that are readily transmitted via food-borne routes significantly contribute to the global burden of HuNoV-induced gastroenteritis. Moreover, contact with enzymes secreted by other microorganisms in the environment can impact the infectivity of viruses. Hence, understanding the circulation dynamics of Caliciviridae is critical to mitigating epidemics. Accordingly, in this study, we screened whether environmentally abundant secretase components, particularly proteases, affect Caliciviridae infectivity. Results showed that combining Bacillaceae serine proteases with epsilon-poly-l-lysine (EPL) produced by Streptomyces—a natural antimicrobial—elicited anti-Caliciviridae properties, including against the epidemic HuNoV GII.4_Sydney_2012 strain. In vitro and in vivo biochemical and virological analyses revealed that EPL has two unique synergistic viral inactivation functions. First, it maintains an optimal pH to promote viral surface conformational changes to the protease-sensitive structure. Subsequently, it inhibits viral RNA genome release via partial protease digestion at the P2 and S domains in the VP1 capsid. This study provides new insights regarding the high-dimensional environmental interactions between bacteria and Caliciviridae, while promoting the development of protease-based anti-viral disinfectants.

Human norovirus (HuNoV) is an enteric infectious pathogen belonging to the Caliciviridae family that causes occasional epidemics. Circulating alcohol-tolerant viral particles that are readily transmitted via food-borne routes significantly contribute to the global burden of HuNoV-induced gastroenteritis. Moreover, contact with enzymes secreted by other microorganisms in the environment can impact the infectivity of viruses. Hence, understanding the circulation dynamics of Caliciviridae is critical to mitigating epidemics. Accordingly, in this study, we screened whether environmentally abundant secretase components, particularly proteases, affect Caliciviridae infectivity. Results showed that combining Bacillaceae serine proteases with epsilon-poly-l-lysine (EPL) produced by Streptomyces—a natural antimicrobial—elicited anti-Caliciviridae properties, including against the epidemic HuNoV GII.4_Sydney_2012 strain. In vitro and in vivo biochemical and virological analyses revealed that EPL has two unique synergistic viral inactivation functions. First, it maintains an optimal pH to promote viral surface conformational changes to the protease-sensitive structure. Subsequently, it inhibits viral RNA genome release via partial protease digestion at the P2 and S domains in the VP1 capsid. This study provides new insights regarding the high-dimensional environmental interactions between bacteria and Caliciviridae, while promoting the development of protease-based anti-viral disinfectants. [ABSTRACT FROM AUTHOR]

Pseudomonas aeruginosa and Klebsiella pneumoniae are notorious for their resistance to antibiotics and propensity for biofilm formation, posing significant threats to human health. Epsilon-poly-L-lysine (ε-PL) emerges as a naturally occurring antimicrobial poly(amino acid), which positions it as a prospective agent for addressing challenges linked to multidrug resistance. ε-PL symbolizes a promising avenue in the pursuit of efficacious therapeutic strategies and warrants earnest consideration within the realm of clinical treatment. Thus, our objective was to determine the antibiotic susceptibility profiles of 38 selected P. aeruginosa and ESBL-producing K. pneumoniae clinical isolates and determine the ability of ε-PL to inhibit biofilm formation. After PCR analysis, detection of genes related to β-lactamases was observed among the selected isolates of P. aeruginosa [blaSPM (35.7%), blaKPC (35.7%), blaSHV (14.3%), blaCTX-M (14.3%), blaOXA (14.3%), blaTEM (7.1%), blaPER (7.1%), blaVIM (7.1%), and blaVIM-2 (7.1%)] and K. pneumoniae [blaCTX-M (91.7%), blaTEM (83.3%), blaKPC (16.7%), blaNDM (12.5%), and blaOXA (4.2%)]. The results of testing the activity of ε-PL against the clinical isolates showed relatively high minimum inhibitory concentrations (MICs) for the P. aeruginosa (range: 8–64 µg/mL) and K. pneumoniae isolates (range: 16–32 µg/mL). These results suggest the need for prior optimization of ε-PL concerning its viability as an alternative to antibiotics for treating infections caused by P. aeruginosa and K. pneumoniae of clinical origin. It is noteworthy that, in the context of a low antibiotic discovery rate, ε-PL could play a significant role in this quest, considering its low toxicity and the unlikely development of resistance. Upon exposure to ε-PL, P. aeruginosa and K. pneumoniae isolates exhibited a reduction in biofilm production, with ε-PL concentration showing an inverse relationship, particularly in isolates initially characterized as strong or moderate producers, indicating its potential as a natural antimicrobial agent with further research needed to elucidate optimal concentrations and application methods across different bacterial species. Further research is needed to optimize its use and explore its potential in various applications. [ABSTRACT FROM AUTHOR]

Antimicrobial resistance has become a major problem over the years and threatens to remain in the future, at least until a solution is found. Silver nanoparticles (Ag-NPs) and antimicrobial polymers (APs) are known for their antimicrobial properties and can be considered an alternative approach to fighting resistant microorganisms. Hence, the main goal of this research is to shed some light on the antimicrobial properties of Ag-NPs and APs (chitosan (CH), poly-L-lysine (PLL), ε-poly-L-lysine (ε-PLL), and dopamine (DA)) when used alone and complexed to explore the potential enhancement of the antimicrobial effect of the combination Ag-NPs + Aps. The resultant nanocomplexes were chemically and morphologically characterized by UV-visible spectra, zeta potential, transmission electron microscopy, and Fourier-transform infrared spectroscopy. Moreover, the Ag-NPs, APs, and Ag-NPs + APs nanocomplexes were tested against Gram-positive Staphylococcus aureus (S. aureus) and the Gram-negative Escherichia coli (E. coli) bacteria, as well as the fungi Candida albicans (C. albicans). Overall, the antimicrobial results showed potentiation of the activity of the nanocomplexes with a focus on C. albicans. For the biofilm eradication ability, Ag-NPs and Ag-NPs + DA were able to significantly remove S. aureus preformed biofilm, and Ag-NPs + CH were able to significantly destroy C. albicans biofilm, with both performing better than Ag-NPs alone. Overall, we have proven the successful conjugation of Ag-NPs and APs, with some of these formulations showing potential to be further investigated for the treatment of microbial infections. [ABSTRACT FROM AUTHOR]

Bacterial infections are the major inhibitory factors for natural wound healing. 3D bioprinted nanocellulose-based composite scaffold with a desirable porous and shape specificity is highly effective for antibacterial applications. However, the slow self-healing and lack of antibacterial activities of cellulose cause bacterial infection. In this work, Epsilon-poly-L-lysine (EPL) bioconjugated cellulose nanofibrils (TCNFs) were subjected to bioprinting with a customizable 3D scaffold with biocompatible and antibacterial activities. Results show that the 3D composite scaffold possesses a mesoporous structure (2–50 nm) and high specific surface area (232.25 m2/g) that ensure a high adsorption capacity of red blood cells in wound healing. The in vitro cytocompatibility of the scaffold is confirmed by the growth and proliferation of NIH 3T3 fibroblast cells in a 3D cell culture study. In addition, the 3D composite scaffold shows antimicrobial activity against wound-infecting pathogens, namely Gram-positive (Staphylococcus aureus) and Gram-negative (Escherichia coli and Pseudomonas aeruginosa) bacteria. In summary, this work integrates the uniqueness of 3D bioprinting and the inherent characteristics of TCNF/EPL-based composite into a flexible 3D scaffold to achieve antibacterial performance and cytocompatibility for biomedical applications. [ABSTRACT FROM AUTHOR]

Introduction: e-poly-L-lysine (e-PL) is a high value, widely used natural antimicrobial peptide additive for foods and cosmetic products that is mainly produced by Streptomyces albulus. In previous work, we developed the high-yield industrial strain S. albulus WG-608 through successive rounds of engineering. Methods: Here, we use integrated physiological, transcriptomic, and proteomics association analysis to resolve the complex mechanisms underlying high e-PL production by comparing WG-608 with the progenitor strain M-Z18. Results: Our results show that key genes in the glycolysis, pentose phosphate pathway, glyoxylate pathway, oxidative phosphorylation, and L-lysine biosynthesis pathways are differentially upregulated in WG-608, while genes in the biosynthetic pathways for fatty acids, various branched amino acids, and secondary metabolite by-products are downregulated. This regulatory pattern results in the introduction of more carbon atoms into L-lysine biosynthesis and e-PL production. In addition, significant changes in the regulation of DNA replication, transcription, and translation, two component systems, and quorum sensing may facilitate the adaptability to environmental pressure and the biosynthesis of e-PL. Overexpression of ppk gene and addition of polyP6 further enhanced the e-PL production. Discussion: This study enables comprehensive understanding of the biosynthetic mechanisms of e-PL in S. albulus WG-608, while providing some genetic modification and fermentation strategies to further improve the e-PL production. [ABSTRACT FROM AUTHOR]

Pseudomonas aeruginosa and Klebsiella pneumoniae are notorious for their resistance to antibiotics and propensity for biofilm formation, posing significant threats to human health. Epsilon-poly-L-lysine (ε-PL) emerges as a naturally occurring antimicrobial poly(amino acid), which positions it as a prospective agent for addressing challenges linked to multidrug resistance. ε-PL symbolizes a promising avenue in the pursuit of efficacious therapeutic strategies and warrants earnest consideration within the realm of clinical treatment. Thus, our objective was to determine the antibiotic susceptibility profiles of 38 selected P. aeruginosa and ESBL-producing K. pneumoniae clinical isolates and determine the ability of ε-PL to inhibit biofilm formation. After PCR analysis, detection of genes related to β-lactamases was observed among the selected isolates of P. aeruginosa [blaSPM (35.7%), blaKPC (35.7%), blaSHV (14.3%), blaCTX-M (14.3%), blaOXA (14.3%), blaTEM (7.1%), blaPER (7.1%), blaVIM (7.1%), and blaVIM-2 (7.1%)] and K. pneumoniae [blaCTX-M (91.7%), blaTEM (83.3%), blaKPC (16.7%), blaNDM (12.5%), and blaOXA (4.2%)]. The results of testing the activity of ε-PL against the clinical isolates showed relatively high minimum inhibitory concentrations (MICs) for the P. aeruginosa (range: 8–64 µg/mL) and K. pneumoniae isolates (range: 16–32 µg/mL). These results suggest the need for prior optimization of ε-PL concerning its viability as an alternative to antibiotics for treating infections caused by P. aeruginosa and K. pneumoniae of clinical origin. It is noteworthy that, in the context of a low antibiotic discovery rate, ε-PL could play a significant role in this quest, considering its low toxicity and the unlikely development of resistance. Upon exposure to ε-PL, P. aeruginosa and K. pneumoniae isolates exhibited a reduction in biofilm production, with ε-PL concentration showing an inverse relationship, particularly in isolates initially characterized as strong or moderate producers, indicating its potential as a natural antimicrobial agent with further research needed to elucidate optimal concentrations and application methods across different bacterial species. Further research is needed to optimize its use and explore its potential in various applications.

Both Gram-negative and Gram-positive bacteria can release vesicle-like structures referred to as bacterial extracellular vesicles (BEVs), which contain various bioactive compounds. BEVs play important roles in the microbial community interactions and host-microbe interactions. Markedly, BEVs can be delivered to host cells, thus modulating the development and function of the innate immune system. To clarify the compositions and biological functions of BEVs, we need to collect these vesicles with high purity and bioactivity. Here we propose an isolation strategy based on a broad-spectrum antimicrobial epsilon-poly-L-lysine (ϵ-PL) to precipitate BEVs at a relatively low centrifugal speed (10,000 × g). Compared to the standard ultracentrifugation strategy, our method can enrich BEVs from large volumes of media inexpensively and rapidly. The precipitated BEVs can be recovered by adjusting the pH and ionic strength of the media, followed by an ultrafiltration step to remove ϵ-PL and achieve buffer exchange. The morphology, size, and protein composition of the ϵ-PL-precipitated BEVs are comparable to those purified by ultracentrifugation. Moreover, ϵ-PL-precipitated BEVs retained the biological activity as observed by confocal microscopy studies. And THP-1 cells stimulated with these BEVs undergo marked reprogramming of their transcriptome. KEGG analysis of the differentially expressed genes showed that the signal pathways of cellular inflammatory response were significantly activated. Taken together, we provide a new method to rapidly enrich BEVs with high purity and bioactivity, which has the potential to be applied to BEVsrelated immune response studies. [ABSTRACT FROM AUTHOR]

Epsilon-Poly-L-lysine (ε-PL) is a non-toxic cationic homopolypeptide with unique bioactive properties. In this study, two novel polylysine producers, Paenibacillus polymyxa HS6 and Stenotrophomonas maltophilia YS8 were isolated from different soil samples and identified by 16S rDNA sequence analysis. To obtain pure cationic polypeptide from these bacteria, chemical precipitation with sodium tetraphenylborate was used. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis, High-performance liquid chromatography, and Fourier-transform infrared spectroscopy confirmed the purified cationic compound to be polylysine. The antioxidant activity of ε-PL was determined by the 2,2-diphenyl-1-picryl-hydrazyl-hydrate method. Moreover, the anticancer and cytotoxic effects were evaluated against MCF-7, HT-29, and L929 cells by thiazolyl blue tetrazolium bromide and flow cytometry. The maximum yields of 1.8 and 0.39 g/L polylysine were obtained by P. polymyxa HS6 and S. maltophilia YS8, respectively. The results showed that radical scavenging activity of polylysine at a minimum concentration (0.18 mg/mL) was at least 7% which increased to 90% at 8 mg/mL. Furthermore, the highest anticancer activity was observed against the MCF-7 cells (99.5%) at 0.5 mg/mL concentration, while almost no toxicity was observed towards L929 cells. Based on the results obtained in this study, it is suggested that the polylysine produced by P. polymyxa HS6 and S. maltophilia YS8 is a potential bioactive compound with significant anticancer and antioxidant properties. [ABSTRACT FROM AUTHOR]

Epsilon-poly-L-lysine (ε-PL) is an unusual biopolymer composed of L-lysine produced by several microorganisms, especially by the genus Streptomyces. Due to its excellent antimicrobial activity, good water solubility, high safety, and biodegradable nature, ε-PL with a GRAS status has been widely used in food and pharmaceutical industries. In the past years, studies have focused on the biotechnological production of ɛ-PL, the biosynthetic mechanism of microbial ɛ-PL, and its application. To provide new perspectives from recent advances, the review introduced the methods for the isolation of ɛ-PL producing strains and the biosynthetic mechanism of microbial ɛ-PL. We summarized the strategies for the improvement of ɛ-PL producing strains, including physical and chemical mutagenesis, ribosome engineering and gene engineering, and compared the different metabolic regulation strategies for improving ɛ-PL production, including medium optimization, nutrient supply, pH control, and dissolved oxygen control. Then, the downstream purification methods of ɛ-PL and its recent applications in food and medicine industries were introduced. Finally, we also proposed the potential challenges and the perspectives for the production of ε-PL. [ABSTRACT FROM AUTHOR]

ε-poly-L-lysine (ε-PL) is a naturally occurring poly(amino acid) of varying polymerization degree, which possesses excellent antimicrobial activity and has been widely used in food and pharmaceutical industries. To provide new perspectives from recent advances, this review compares several conventional and advanced strategies for the discovery of wild strains and development of high-producing strains, including isolation and culture-based traditional methods as well as genome mining and directed evolution. We also summarize process engineering approaches for improving production, including optimization of environmental conditions and utilization of industrial waste. Then, efficient downstream purification methods are described, including their drawbacks, followed by the brief introductions of proposed antimicrobial mechanisms of ε-PL and its recent applications. Finally, we discuss persistent challenges and future perspectives for the commercialization of ε-PL.

Ɛ-Poly-L-lysine is a potent antimicrobial produced through fermentation of Streptomyces and used in many Asian countries as a food preservative. It is synthesized and excreted by a special nonribosomal peptide synthetase (NRPS)-like enzyme called Pls. In this study, we discovered a gene from cheese bacterium Corynebacterium variabile that showed high similarity to the Pls from Streptomyces in terms of domain architecture and gene context. By cloning it into Streptomyces coelicolor with a Streptomyces albulus Pls promoter, we confirmed that its product is indeed Ɛ-poly-L-lysine. A comprehensive sequence analysis suggested that Pls genes are widely spread among coryneform actinobacteria isolated from cheese and human skin; 14 out of 15 Brevibacterium isolates and 10 out of 12 Corynebacterium isolates contain it in their genomes. This finding raises the possibility that Ɛ-poly-L-lysine as a bioactive secondary metabolite might be produced and play a role in the cheese and skin ecosystems. IMPORTANCE Every year, microbial contamination causes billions of tons of food wasted and millions of cases of illness. Ɛ-Poly-L-lysine has potent, wide-spectrum inhibitory activity and is heat stable and biodegradable. It has been approved for food preservation by an increasing number of countries. Ɛ-Poly-L-lysine is produced from soil bacteria of the genus Streptomyces, also producers of various antibiotic drugs and toxins and not considered to be a naturally occurring food component. The frequent finding of pls in cheese and skin bacteria suggests that Ɛ-poly-L-lysine may naturally exist in cheese and on our skin, and Ɛ-poly-L-lysine producers are not limited to filamentous actinobacteria. [ABSTRACT FROM AUTHOR]

The natural antimicrobial peptide, epsilon-poly- l -lysine (ε-PL), is widely acknowledged as a food preservative. However, its potential in managing bacterial brown blotch disease in postharvest edible mushrooms and the associated mechanism remain unexplored. In this study, concentrations of ε-PL ≥ 150 mg L−1 demonstrated significant inhibition effects, restraining over 80% of growth and killed over 99% of Pseudomonas tolaasii (P. tolaasii). This inhibition effect occurred in a concentration-dependent manner. The in vivo findings revealed that treatment with 150 mg L−1 ε-PL effectively inhibited P. tolaasii -caused brown blotch disease in Agaricus bisporus (A. bisporus) mushrooms. Plausible mechanisms underlying ε-PL's action against P. tolaasii in A. bisporus involve: (i) damaging the cell morphology and membrane integrity, and increasing uptake of propidium iodide and leakage of cellular components of P. tolaasii ; (ii) interaction with intracellular proteins and DNA of P. tolaasii ; (iii) inhibition of P. tolaasii -induced activation of polyphenol oxidase, elevation of antioxidative enzyme activities, stimulation of phenylpropanoid biosynthetic enzyme activities and metabolite production, and augmentation of pathogenesis-related protein contents in A. bisporus mushroom s. These findings suggest promising prospects for the application of ε-PL in controlling bacterial brown blotch disease in A. bisporus. [Display omitted] • ε-PL significantly inhibited the growth of Pseudomonas tolaasii in vitro. • ε-PL effectively reduced bacterial brown blotch disease in postharvest A. bisporus. • ε-PL disrupted membrane integrity and led to cellular leakage of P. tolaasii. • ε-PL could likely disturb intracellular DNA and proteins of P. tolaasii. • ε-PL induced disease resistance against P. tolaasii in postharvest A. bisporus. [ABSTRACT FROM AUTHOR]

Foodborne Enterobacteriaceae pathogens, especially Salmonella, still seriously threaten food safety. To establish a foundation for further developing phage- and endolysin-based methods combating these pathogens, in this study, the newly isolated Salmonella-virus-FelixO1 phage BPS15S6 for biocontrol purposes was characterised by genomic bioinformatic analysis, and then its endolysin LyS15S6 was obtained using a prokaryotic expression system, characterised in vitro and evaluated in the antibacterial efficacy. It was shown that BPS15S6 had an 87,609-bp genome with 130 open reading frames and does not appear to carry known lysogeny-associated genes and other damaging genetic determinants and is unlikely to perform generalised transduction. Furthermore, LyS15S6 was determined to possess the high enzymatic activity of 1,001,000 U mg−1 and the broad spectrum of lysing 56 tested Gram-negative strains. The assays of thermostability and optimum pH revealed that LyS15S6 was stable up to 40 °C and more active at pH 7. Notably, we demonstrate that edible ε-poly-l-lysine (EPL) can be used as an outer-membrane permeabiliser to improve the antibacterial performance of endolysins. When combined with 1 μg ml−1 EPL, 2 μM LyS15S6 could cause 3–4 log viable cell reductions of the three tested Enterobacteriaceae pathogens in vitro after 2 h of reaction at 25 °C and 2.56 and 3.14 log reductions of Salmonella ATCC13076 after 15 min of reaction at 25 °C and 2 h of reaction at 8 °C respectively. A new strategy, the combined application of endolysins and edible EPL for combating Enterobacteriaceae pathogens in food, is thus presented in this work. [ABSTRACT FROM AUTHOR]

Abstract The emergence of drug-resistant fungal strains remains a severe threat for the public health, which prompts strict restrictions on the uses of antifungal drugs. However, the majority of lipophilic fungistatic agents are poorly water soluble with a low oral adsorption characteristic posing challenges for the precise prescriptions. In this study, a natural antimicrobial cationic peptide of epsilon-poly- l -lysine (EPL) decorated ordered mesoporous silica (SBA-15) was facilely prepared for the efficient loading of antifungal itraconazole (ITZ) drugs. The characterized mesoporous SBA-15/EPL/ITZ composite exhibited remarkable antifungal performance against Aspergillus fumigatus as a model mold, which was attributed to synergistic antifungal activities of ITZ and EPL in the mesopores. Moreover, the in vitro release behaviors of ITZ in the composite nanoexcipients both in simulated gastric fluid and fasted state simulated intestinal fluid were studied. The observed release kinetics of ITZ demonstrated a contributing role of SBA-15/EPL to enhance the solubility of ITZ and thereby may promote its flux across the gastrointestinal epithelium, which is beneficial for the absorption of drugs. Additionally, SBA-15/EPL/ITZ composites showed desirable biocompatibility toward mammalian red blood cells, human cervical cancer cells (Hela) and human embryonic kidney cells (HEK-293T). Furthermore, the pharmacokinetic profiles of obtained nano-formulations were assessed in rats, among which the improved adsorption of SBA-15/EPL/ITZ composites (AUC 0–24h sum : 8381.7 nM·h) was identified compared with that of pure ITZ (525.1 nM·h) and the commercial drug of Sporanox (7516.6 nM·h). Collectively, the prepared SBA-15/EPL/ITZ provides an ecofriendly and integrated nanocomposite with enhanced solubility of lipophilic drugs to combat proliferations of infectious fungi. Graphic abstract Unlabelled Image Highlights • Natural epsilon-poly- l -lysine (EPL) coated mesoporous SBA-15 as nanocarriers • Itraconazole loaded SBA-15/EPL exhibits enhanced solubility and antifungal effect. • SBA-15/EPL/ITZ shows desirable biocompatibility and improved drug adsorption. [ABSTRACT FROM AUTHOR]

Penicillium expansum (P. expansum) is a harmful pathogenic mold responsible for huge postharvest losses in apples. Epsilon‐poly‐L‐lysine (ε-PL) is a non-toxic antiseptic peptide derived from Streptomyces albulus. Many food preservative strategies use ε-PL to suppress foodborne pathogens in condiments, cakes, fruit and vegetable juices. In the present research, ε-PL's inhibitory effects against P. expansum in vitro and in apples were investigated. The molecular mechanisms of ε-PL inhibiting P. expansum in apples were investigated by transcriptome analysis. Results showed that doses of 600 mg L−1 of ε-PL could prevent the development of P. expansum in vitro and control blue mold decay in apples. Plausible mechanisms of ε-PL against P. expansum in apples include: (i) reduction of antioxidant potential, including decreasing the expression of genes encoding superoxide dismutase (SOD), catalase (CAT), glutathione s-transferase (GST), xanthine dehydrogenase (XDH), D -amino-acid oxidase (DAO), weakening ROS scavenging ability of P. expansum cells and causing oxidative damage to cell, (ii) weakening its virulence towards apples, including reducing the expression of genes coding for cell wall degrading enzymes (CWDEs) such as pectinase and cellulase, (iii) disrupting mitochondrial function of P. expansum , including reducing expression of several rate-limiting enzyme coding genes of energy metabolic pathways such as EMP, TCA cycle and oxidative phosphorylation, which interfered with the cells' energy metabolism, leading to insufficient ATP synthesis, weakening P. expansum 's resistance to external stress, and finally slowing down the invasion process into apples, (ⅳ) damaging the membrane integrity of P. expansum , including reducing the expression of genes encoding diaphragm wall degradation enzymes, cytomembrane lipid and ergosterol synthetase, multi-drug transporter, and inhibiting the differentiation of conidia. • 600 mg L−1 of ε-PL can significantly inhibit P. expansum in vitro or in apples. • ε-PL decreased the expression of genes encoding antioxidant enzyme of P. expansum. • ε-PL reduced the expression of genes coding CWDEs, weakened its virulence to apples. • ε-PL interfered the mitochondrial function and energy metabolism of P. expansum. • ε-PL damaged the membrane integrity of P. expansum in apples. [ABSTRACT FROM AUTHOR]

Thermoplastic polyurethanes (TPUs) are extensively utilized in the biomedical field due to their exceptional mechanical properties and biocompatibility. However, the lack of antibacterial activity limits their application ranges. Nanoscopic particle-based additives with inherent antibacterial characteristics are regarded as promising strategies to prevent biomaterials-associated infection. Herein, a novel polymeric nanoparticle is prepared, which integrates chemically cross-linked epsilon-poly-l-lysine (CPL) and anionic surfactant-docusate sodium (DS). The cross-linked epsilon-poly-l-lysine/docusate sodium (CPL/DS) nanoparticle can be well dispersed in organic solvent and a polymer matrix, which is beneficial to endowing TPUs with synergistic miscibility and antibacterial properties. An antibacterial test showed that the CPL/DS nanoparticles have strong antibacterial activity against S. aureus . Moreover, the results of antibacterial experiments in vitro revealed that almost 100% of S. aureus could be killed by CPL/DS nanoparticle-embedded TPU film with a content of 0.5 wt %. In addition, all of the CPL/DS modified TPU films showed good cytocompatibility in vitro . Consequently, this kind of CPL/DS nanoplatform has great potential to serve as a safe and high-efficient bactericidal agent for endowing biomedical devices with bactericidal property.

ε-poly-l-Lysine (ε-PLL) peptide is a product of the marine bacterium Bacillus subtilis with antibacterial and anticancer activity largely used worldwide as a food preservative. ε-PLL and its synthetic analogue α,ε-poly-l-lysine (α,ε-PLL) are also employed in the biomedical field as enhancers of anticancer drugs and for drug and gene delivery applications. Recently, several studies reported the interaction between these non-canonical peptides and DNA targets. Among the most important DNA targets are the DNA secondary structures known as G-quadruplexes (G4s) which play relevant roles in many biological processes and disease-related mechanisms. The search for novel ligands capable of interfering with G4-driven biological processes elicits growing attention in the screening of new classes of G4 binders. In this context, we have here investigated the potential of α,ε-PLL as a G4 ligand. In particular, the effects of the incubation of two different models of G4 DNA, i.e., the parallel G4 formed by the Pu22 (d[TGAGGGTGGGTAGGGTGGGTAA]) sequence, a mutated and shorter analogue of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, and the hybrid parallel/antiparallel G4 formed by the human Tel22 (d[AGGGTTAGGGTTAGGGTTAGGG]) telomeric sequence, with α,ε-PLL are discussed in the light of circular dichroism (CD), UV, fluorescence, size exclusion chromatography (SEC), and surface plasmon resonance (SPR) evidence. Even though the SPR results indicated that α,ε-PLL is capable of binding with µM affinity to both the G4 models, spectroscopic and SEC investigations disclosed significant differences in the structural properties of the resulting α,ε-PLL/G4 complexes which support the use of α,ε-PLL as a G4 ligand capable of discriminating among different G4 topologies.

An optimal wound-healing hydrogel requires effective antibacterial properties and a favorable cell adhesion and proliferation environment. Although Bombyx mori silk fibroin (SF) possesses inherent wound-healing properties, it lacks these essential qualities. This study aimed to fabricate a novel photo-polymerizable hydrogel by utilizing SF's wound-healing efficiency and the epsilon-poly-L-lysine (EPL) antimicrobial activity. The SF was modified with three different concentrations of glycidyl methacrylate (GMA) to obtain SF-GMA(L), SF-GMA(M), and SF-GMA(H). A methacrylated EPL (EPL-GMA) was also produced. Then, SF-GMA was mixed with EPL-GMA to produce photo-crosslinkable SF-GMA-EPL hydrogels. The SF-GMA(L)-EPL, SF-GMA(M)-EPL, and SF-GMA(H)-EPL hydrogels, fabricated with 20% EPL-GMA, demonstrated maximum antimicrobial activity and mammalian cell adhesion ability. The hydroxyl radical (•OH) scavenging efficiency of the hydrogels was tested and shown to be between 69% and 74%. These hydrogels also exhibited 60% efficiency in removing bacterial lipopolysaccharides. The water absorption ability of the hydrogels was consistent with the size of their internal pores. The hydrogels exhibited a slow degradation fashion, and their degradation products appeared cytocompatible. Finally, the elastomeric properties of the hydrogels were determined, and a storage modulus (G') of 300-600 Pa was demonstrated. In conclusion, the hydrogels created in this study possess excellent biological and physical properties to support wound healing., (© 2023 IOP Publishing Ltd.)

Over the past decades, antibiotic resistance has become a major clinical problem, and searching for new therapeutic strategies seems to be necessary. Using novel natural compounds, antimicrobial peptides, and bacteriophages is the most promising solution. In this study, various cationic metabolite-producer bacteria were isolated from different soil samples. Two isolates were identified as Stenotrophomonas maltophilia HS4 (accession number: MW791428) and Paenibacillus polymyxa HS5 (accession number: MW791430) based on biochemical characteristics and phylogenetic analysis using 16S rRNA gene sequences. The cationic compound in the fermentation broth was precipitated and purified with sodium tetraphenylborate salt. The purified cationic peptide was confirmed to be epsilon-poly-l-lysine by structural and molecular analysis using High-Performance Liquid Chromatography, Sodium dodecyl-sulfate-polyacrylamide gel electrophoresis, and Fourier-transform infrared spectroscopy. The antibacterial activity of epsilon-poly-l-lysine was evaluated against Staphylococcus aureus ATCC 25923, Escherichia coli ATCC 25922, Enterococcus faecalis ATCC 29212, Serratia marcescens ATCC 13880, and Klebsiella pneumoniae ATCC 13883 by microdilution method. Furthermore, the antibacterial effects of purified epsilon-poly-l-lysine in combination with two long non-contractile tail bacteriophages against vancomycin-resistant Enterococcus faecalis and colistin-resistant Klebsiella pneumoniae were investigated. The results indicated great antibacterial activity of epsilon-poly-l-lysine which was produced by two novel bacteria. The epsilon-poly-l-lysine as a potent cationic antimicrobial peptide is demonstrated to possess great antimicrobial activity against pathogenic and also antibiotic-resistant bacteria.

Introduction: ε-poly-L-lysine (ε-PL) is a high value, widely used natural antimicrobial peptide additive for foods and cosmetic products that is mainly produced by Streptomyces albulus . In previous work, we developed the high-yield industrial strain S. albulus WG-608 through successive rounds of engineering., Methods: Here, we use integrated physiological, transcriptomic, and proteomics association analysis to resolve the complex mechanisms underlying high ε-PL production by comparing WG-608 with the progenitor strain M-Z18., Results: Our results show that key genes in the glycolysis, pentose phosphate pathway, glyoxylate pathway, oxidative phosphorylation, and L-lysine biosynthesis pathways are differentially upregulated in WG-608, while genes in the biosynthetic pathways for fatty acids, various branched amino acids, and secondary metabolite by-products are downregulated. This regulatory pattern results in the introduction of more carbon atoms into L-lysine biosynthesis and ε-PL production. In addition, significant changes in the regulation of DNA replication, transcription, and translation, two component systems, and quorum sensing may facilitate the adaptability to environmental pressure and the biosynthesis of ε-PL. Overexpression of ppk gene and addition of polyP 6 further enhanced the ε-PL production., Discussion: This study enables comprehensive understanding of the biosynthetic mechanisms of ε-PL in S. albulus WG-608, while providing some genetic modification and fermentation strategies to further improve the ε-PL production., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2023 Wang, Yang, Wu, Zhang, Zhang, Mao and Chen.)

Appropriate inhibitors might play important roles in achieving ammonia retention in biological wastewater treatment and its reuse in agriculture. In this study, the feasibility of epsilon-poly-l-lysine (ε-PL) as a novel natural ammonia oxidation inhibitor was investigated. Significant inhibition (ammonia oxidation inhibition rate was up to 96.83%) was achieved by treating the sludge with ε-PL (400 mg/L, 12 h soaking) only once and maintaining for six cycles. Meanwhile, the organic matter and nitrite removal was not affected. This method was effective under the common environmental conditions of biological wastewater treatment. Metatranscriptome uncovered the possible action mechanisms of ε-PL. The ammonia oxidation inhibition was due to the co-decrease of Nitrosomonas abundance, ammonia oxidation genes, and the cellular responses of Nitrosomonas . Thauera and Dechloromonas could adapt to ε-PL by stimulating stress responses, which maintained the organic matter and nitrite removal. Importantly, ε-PL did not cause the enhancement of antibiotic resistance genes and virulent factors. Therefore, ε-PL showed a great potential of ammonia retention, which could be applied in the biological treatment of wastewater for agricultural reuse.

• A modified epsilon-poly- l -lysine (EPL) with high photocuring efficiency was facilely synthesized. • The bioink composed of EPL-MA was suitable for DLP 3D printing. • Complex organ model structures can be built by using this bioink with reliable biocompatibility. In this work, we provided a photocurable bioink composed of modified epsilon-poly- l -lysine (EPL-MA) for digital light processing (DLP). The EPL-MA was facilely synthesized by grafting with the glycidyl methacrylate (GMA) via a nucleophilic amination ring-opening reaction and forming linkages between EPL and GMA. The photocuring efficiency of the optimized EPL-MA hydrogel could be modulated. Through the DLP technology, highly complex organ model structures can be built by using this EPL-MA bioink with excellent reliable biocompatibility. It indicates that this photocurable EPL-MA is promising bioink used for DLP 3D printing and may has potential application in tissue engineering. [ABSTRACT FROM AUTHOR]

Both Gram-negative and Gram-positive bacteria can release vesicle-like structures referred to as bacterial extracellular vesicles (BEVs), which contain various bioactive compounds. BEVs play important roles in the microbial community interactions and host-microbe interactions. Markedly, BEVs can be delivered to host cells, thus modulating the development and function of the innate immune system. To clarify the compositions and biological functions of BEVs, we need to collect these vesicles with high purity and bioactivity. Here we propose an isolation strategy based on a broad-spectrum antimicrobial epsilon-poly-L-lysine (ϵ-PL) to precipitate BEVs at a relatively low centrifugal speed (10,000 × g). Compared to the standard ultracentrifugation strategy, our method can enrich BEVs from large volumes of media inexpensively and rapidly. The precipitated BEVs can be recovered by adjusting the pH and ionic strength of the media, followed by an ultrafiltration step to remove ϵ-PL and achieve buffer exchange. The morphology, size, and protein composition of the ϵ-PL-precipitated BEVs are comparable to those purified by ultracentrifugation. Moreover, ϵ-PL-precipitated BEVs retained the biological activity as observed by confocal microscopy studies. And THP-1 cells stimulated with these BEVs undergo marked reprogramming of their transcriptome. KEGG analysis of the differentially expressed genes showed that the signal pathways of cellular inflammatory response were significantly activated. Taken together, we provide a new method to rapidly enrich BEVs with high purity and bioactivity, which has the potential to be applied to BEVs-related immune response studies., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2022 Wei, Jiao and Xing.)

Abstract: Hydrogels made from epsilon-poly-l-lysine-graft-methacrylamide (EPL-MA) have been found to have impressive wide spectrum antimicrobial activity against both bacteria (specifically Escherichia coli, Pseudomonas aeruginosa, Serratia marcescens and Staphylococcus aureus) and fungi (specifically Candida albicans and Fusarium solani). The EPL-MA hydrogel also possesses in vitro biocompatibility and EPL-MA solution is relatively non-hemolytic: the concentration needed for onset of human red blood cell (hRBC) hemolysis is 12,500 μg/mL so that the selectivity for the pathogenic microorganisms over hRBCs is 230–1560. Further, EPL-MA hydrogel can be conveniently ultraviolet-immobilized onto plasma-treated plastic surfaces to form thin highly adherent antimicrobial hydrogel coatings for medical devices and implants. [Copyright &y& Elsevier]

Abstract: To control the molecular mass of a natural polycationic, antimicrobial, Streptomyces-biosynthesized polymer, epsilon-poly-l-lysine, addition of polyanionic cyclodextrin derivatives to the culture medium was evaluated. Chemically modified cyclodextrins such as a sulfated cyclodextrin caused a notable shortening of the polymer length of epsilon-poly-l-lysine from 3.5 to 4.5kDa to less than 2.5kDa by the enforcing action of glycerol, which has a weak potential to inhibit polymer elongation by terminal esterification. Meanwhile, polyanionic cyclodextrin inhibited the shortening action with n-octanol, which has a strong ability to inhibit polymer elongation through an undetermined function. The design of chemical structures of polyanionic cyclodextrin, optimization of their addition concentrations, and selection of hydroxyl compounds coexisting with them are critical for this simple and easy method for polymer length control and terminal modification of epsilon-poly-l-lysine. [Copyright &y& Elsevier]

• Epsilon-poly- l -lysine grafted cellulose beads were prepared via TEMPO mediated oxidation. • Good antibacterial activities of grafted cellulose beads were achieved. • Biodegradability of cellulose beads is possible. In recent years, harmful microorganisms in water pose great harm to ecological environment and human health. To solve this problem, epsilon-poly- l -lysine (EPL) grafted cellulose beads were prepared via 2, 2, 6, 6-tetramethylpiperidine-1-oxyl (TEMPO) mediated oxidation and carbodiimide mediated cross-linking reaction. Hydroxyl groups on C6 of cellulose were oxidized to carboxyl groups by TEMPO and grafting reaction was achieved between newly formed carboxyl groups of cellulose and amino of EPL. The beads were characterized by FTIR, SEM, XRD and TGA. The crystalline form of cellulose transformed from cellulose I to cellulose II after being dissolved and regenerated. The grafted cellulose beads showed good antibacterial activities against Gram-negative Escherichia coli , Gram-positive Staphylococcus aureus and Alicyclobacillus acidoterrestris with 10 h. The beads could be biodegraded in soil after 28 days. It is expected that the bio-based composite beads could have potential applications in water purification and food treatment fields. [ABSTRACT FROM AUTHOR]

• ε -L-polylysine anchored cellulose beads were proposed via simple technology. • The biodegradable materials were fabricated mainly from renewable polymers. • Antimicrobial activities of modified cellulose beads were achieved. Pathogens in the food and environment pose a great threat to human health. To solve this problem, we described a novel route to synthesize antibacterial epsilon-poly-L-lysine (EPL) anchored dicarboxyl cellulose beads. Cellulose beads were prepared via a sol-gel transition method and oxidized by sodium periodate and sodium chlorite to form carboxyl groups. EPL was anchored on the beads using carbodiimide mediated amidation. The structure and morphology of beads were characterized by FTIR, XPS, XRD, SEM, and TGA. After dissolution and regeneration, the crystalline form of cellulose is transformed from cellulose I to cellulose II. The thermal degradation temperature of the beads is 200∼300 °C.The samples displayed excellent antimicrobial activity against Staphylococcus aureus , Alicyclobacillus acidoterrestris and Escherichia coli within 12 h. The beads could be biodegraded in soil after 20 days. The biodegradable beads exhibited great potential in food and environmental applications. [ABSTRACT FROM AUTHOR]

ε-poly-L-lysine (ε-PL) is a naturally occurring poly(amino acid) of varying polymerization degree, which possesses excellent antimicrobial activity and has been widely used in food and pharmaceutical industries. To provide new perspectives from recent advances, this review compares several conventional and advanced strategies for the discovery of wild strains and development of high-producing strains, including isolation and culture-based traditional methods as well as genome mining and directed evolution. We also summarize process engineering approaches for improving production, including optimization of environmental conditions and utilization of industrial waste. Then, efficient downstream purification methods are described, including their drawbacks, followed by the brief introductions of proposed antimicrobial mechanisms of ε-PL and its recent applications. Finally, we discuss persistent challenges and future perspectives for the commercialization of ε-PL., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2021 Wang, Zhang, Zhang, Rao, Xu, Mao and Chen.)

• ε-PL controlled the blue mold decay of apples effectively. • The inhibitory effects of ε-PL against P. expansum were confirmed in vitro. • ε-PL induced apples to produce enzymes including PPO, CAT, POD and PAL. • The genes expression levels of PPO , CAT , POD and PAL in apples was increased. • ε-PL destroyed the cell wall and membrane of P. expansum conidia. Penicillium expansum is a major postharvest fungal pathogen and is the causal agent of blue mold decay in apples. Epsilon-poly- l -lysine (ε-PL) is a naturally-occurring polypeptide that has strong antimicrobial activity. It is primarily used to suppress foodborne pathogens in bread, beverage, meat products, etc. The potential application of ε-PL in the management of fungal postharvest diseases of fruit, however, has not been explored. In the present study, the inhibitory effect of ε-PL against blue mold (P. expansum) disease of apples and its potential mechanism of action were investigated. Results indicated that 600 mg L−1 of ε-PL could effectively inhibit mycelial growth of P. expansum in apples. Concentrations of ε-PL > 200 mg L−1 also inhibited germination of conidia and germ tube growth of P. expansum in potato dextrose broth (PDB). The inhibitory effect increased with increasing concentrations of ε-PL concentration. Further studies indicated that the possible mechanisms involved of ε-PL inhibition of P. expansum included the activation of defense-related enzyme activity and gene expression in apple fruit tissues. This included polyphenol oxidase (PPO), catalase (CAT), peroxidase (POD) and phenylalanine ammonialyse (PAL). ε-PL stimulated the production of intracellular reactive oxygen species (ROS) and degraded the integrity of the cell wall and plasma membrane of conidia, resulting in the death of conidial spores of P. expansum or their germination. [ABSTRACT FROM AUTHOR]

ε-Poly-l-lysine is a potent antimicrobial produced through fermentation of Streptomyces and used in many Asian countries as a food preservative. It is synthesized and excreted by a special nonribosomal peptide synthetase (NRPS)-like enzyme called Pls. In this study, we discovered a gene from cheese bacterium Corynebacterium variabile that showed high similarity to the Pls from Streptomyces in terms of domain architecture and gene context. By cloning it into Streptomyces coelicolor with a Streptomyces albulus Pls promoter, we confirmed that its product is indeed ε-poly-l-lysine. A comprehensive sequence analysis suggested that Pls genes are widely spread among coryneform actinobacteria isolated from cheese and human skin; 14 out of 15 Brevibacterium isolates and 10 out of 12 Corynebacterium isolates contain it in their genomes. This finding raises the possibility that ε-poly-l-lysine as a bioactive secondary metabolite might be produced and play a role in the cheese and skin ecosystems. IMPORTANCE Every year, microbial contamination causes billions of tons of food wasted and millions of cases of illness. ε-Poly-l-lysine has potent, wide-spectrum inhibitory activity and is heat stable and biodegradable. It has been approved for food preservation by an increasing number of countries. ε-Poly-l-lysine is produced from soil bacteria of the genus Streptomyces , also producers of various antibiotic drugs and toxins and not considered to be a naturally occurring food component. The frequent finding of pls in cheese and skin bacteria suggests that ε-poly-l-lysine may naturally exist in cheese and on our skin, and ε-poly-l-lysine producers are not limited to filamentous actinobacteria., (Copyright © 2021 Jiang et al.)

ε-poly-l-Lysine (ε-PLL) peptide is a product of the marine bacterium Bacillus subtilis with antibacterial and anticancer activity largely used worldwide as a food preservative. ε-PLL and its synthetic analogue α,ε-poly-l-lysine (α,ε-PLL) are also employed in the biomedical field as enhancers of anticancer drugs and for drug and gene delivery applications. Recently, several studies reported the interaction between these non-canonical peptides and DNA targets. Among the most important DNA targets are the DNA secondary structures known as G-quadruplexes (G4s) which play relevant roles in many biological processes and disease-related mechanisms. The search for novel ligands capable of interfering with G4-driven biological processes elicits growing attention in the screening of new classes of G4 binders. In this context, we have here investigated the potential of α,ε-PLL as a G4 ligand. In particular, the effects of the incubation of two different models of G4 DNA, i.e., the parallel G4 formed by the Pu22 (d[TGAGGGTGGGTAGGGTGGGTAA]) sequence, a mutated and shorter analogue of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, and the hybrid parallel/antiparallel G4 formed by the human Tel22 (d[AGGGTTAGGGTTAGGGTTAGGG]) telomeric sequence, with α,ε-PLL are discussed in the light of circular dichroism (CD), UV, fluorescence, size exclusion chromatography (SEC), and surface plasmon resonance (SPR) evidence. Even though the SPR results indicated that α,ε-PLL is capable of binding with µM affinity to both the G4 models, spectroscopic and SEC investigations disclosed significant differences in the structural properties of the resulting α,ε-PLL/G4 complexes which support the use of α,ε-PLL as a G4 ligand capable of discriminating among different G4 topologies.

Hospital-acquired infections are common in burn patients and are the major contributors of morbidity and mortality. Bacterial infections such as Staphylococcus aureus ( S. aureus ) and Acinetobacter baumannii ( A. baumannii ) are difficult to treat due to their biofilm formation and rapidly acquiring resistance to antibiotics. This work presents a newly developed hydrogel that has the potential for treating bacterial wound infections. The hydrogel formulation is based on an antimicrobial peptide (AMP), epsilon-poly-l-lysine (EPL) and catechol, which was cross-linked via mussel-inspired chemistry between the amine and phenol groups. In vitro studies showed that EPL-catechol hydrogels possess impressive antimicrobial and antibiofilm properties toward multidrug-resistant A. baumannii (MRAB). In addition, cytotoxicity study with the clonal mouse myoblast cell line (C2C12) revealed the good biocompatibility of this hydrogel. Furthermore, we created a second-degree burn wound on the mice dorsal skin surface followed by contamination with MRAB. Our results showed that the hydrogel significantly reduced the bacterial burden by more than four orders of magnitude in infected burn wounds. Additionally, there was no significant histological alteration with hydrogel application on mice skin. Based on these results, we concluded that EPL-catechol hydrogel is a promising future biomaterial to fight against multidrug-resistant bacterial infections., (© 2019 The Author(s).)