Search

PurposeMethodsResultsConclusionThis multicenter study aimed to investigate the clinical characteristics and factors associated with specific viral pathogens in patients with acute retinal necrosis (ARN).A retrospective multicenter cohort study included ARN patients who underwent aqueous or vitreous polymerase chain reaction (PCR) testing. Multivariable mixed-effects Poisson regression was used to identify factors associated with viral pathogens.A total of 56 patients (65 eyes) with ARN were included, with a mean age was 39.9 ± 23.2 years. Anterior chamber cell showed significant inflammation in 89.2%, while vitreous haze was present in 100%. Multifocal retinitis was found in 92.3% of cases. Among these, 49.2% had diffuse or confluent patterns, 15.4% were circumferential, and 23.1% showed satellite lesions. Additionally, 18.5% were ameboid or scalloped shape, while 9.2% had wedge shapes. Varicella zoster virus (VZV) was the most common pathogen (30.8%), followed by Herpes simplex virus (HSV) (13.8%), Cytomegalovirus (CMV) (10.8%), Epstein-Barr virus (EBV) (9.2%), and human herpesvirus (HHV) (3.0%). Co-infections were observed in 20% of eyes. CMV-related ARN was significantly associated with wedge-shaped retinitis (aRR 4.19) and immunocompromised host (aRR 8.8). Younger age and optic disc edema (aRR 5.41) were correlated with HSV-related ARN.VZV was the predominant viral pathogen, with the increasing prevalence of CMV, EBV, and co-infection. Wedge-shaped retinitis and immunocompromised status were notably associated with CMV-related ARN, findings that may guide antiviral therapy decisions in settings where PCR diagnostics are either unavailable or delayed, ultimately improving visual outcomes. [ABSTRACT FROM AUTHOR]

The article focuses on the prevalence of herpesviruses among the Yanomami indigenous population and their association with Heck's disease. Topics include the detection of various herpesviruses (such as HSV-1, EBV, and HHV-6) in saliva, the clinical presentation of Heck's disease, and the demographic factors influencing viral excretion and disease manifestation.

Human cytomegalovirus (HCMV) is a ubiquitous pathogen that infects the majority of the world's population. Lytic HCMV replication in immunocompromised individuals or neonates can lead to severe disease in multiple organ systems and even death. The establishment of lytic replication is driven by the first viral proteins expressed upon infection, the immediate early proteins, which play a key role in creating an intracellular environment conducive to virus replication. Two immediate early proteins, the functional orthologs pTRS1 and pIRS1, stimulate immediate early gene expression by suppressing antiviral PKR/eIF2α signaling and enhance the translation of viral mRNAs independent of PKR antagonism. To better understand the molecular functions of pTRS1, we used proximity labeling proteomics to identify proteins that interact with pTRS1 in infected cells. Multiple novel host and viral interactors were identified, including the catalytic subunits of the protein phosphatase 1 (PP1) holoenzyme. Mutations to a PP1 catalytic subunit known to disrupt binding to PP1 regulatory subunits decreased binding to pTRS1. pTRS1 immune complexes contained phosphatase activity, and inhibition of phosphatase activity in transfected or infected cells reversed the ability of pTRS1 to inhibit the antiviral kinase PKR. Depletion of individual PP1 catalytic subunits decreased virus replication and increased the phosphorylation of the PKR substrate eIF2α. Taken together, our data suggest potential novel functions for pTRS1 and define a novel role for PP1 as an antagonist of the antiviral PKR/eIF2α signaling axis during HCMV infection. IMPORTANCE The human cytomegalovirus (HCMV) pTRS1 and pIRS1 proteins are critical regulators of HCMV replication, both during primary infection and during reactivation from viral latency. Thus, defining the molecular functions of pTRS1/pIRS1 is important for understanding the molecular events controlling HCMV replication and viral disease. These data provide new insights into potential pTRS1 functional roles, providing a starting point for others to understand new features of infected cell biology. Another important result of this study is the finding that specific protein phosphatase 1 (PP1) regulatory subunits are required to suppress PKR/eIF2α signaling, a critical cellular innate immune defense to viral infection. These data lay the groundwork for future efforts to discover therapeutics that disrupt pTRS1 interaction with PP1 allowing cellular defenses to limit HCMV replication and disease. [ABSTRACT FROM AUTHOR]

Aims: The objective of this study was to identify the presence of human herpesvirus (HHV) in the plasma and saliva of hepatic‐cirrhosis patients and correlate it with clinical data and laboratory tests. This is a pilot, observational, and cross‐sectional study. Methods and results: Specimens of plasma and saliva from 72 cirrhotic individuals were analyzed by means of polymerase chain reaction. The patient population had a mean age of 54.84 years old (SD ± 10) and was 70% males (51/72). Approximately 47% (n = 34) of the patients had leukopenia and HHV was not identified in the plasma specimens. The main species of HHV identified in the saliva were HHV‐7 (n = 42, 62%) and Epstein‐Barr virus (EBV) (n = 30, 41%). Moreover, there was a significant decrease in the total number of leukocytes and lymphocytes in saliva containing EBV (P =.038 and P =.047, respectively). Conclusion: The results show that the presence of EBV in the saliva of cirrhotic patients was correlated with their circulating immune status. It may be possible that the immune dysfunction displayed by the cirrhotic patients plays a role in the shedding of EBV into saliva. [ABSTRACT FROM AUTHOR]

Introduction: Human Herpesvirus 6B (HHV-6B) impedes host immune responses by downregulating class I MHC molecules (MHC-I), hindering antigen presentation to CD8+ T cells. Downregulation of MHC-I disengages inhibitory receptors on natural killer (NK) cells, resulting in activation and killing of the target cell if NK cell activating receptors such as NKG2D have engaged stress ligands upregulated on the target cells. Previous work has shown that HHV-6B downregulates three MHC-like stress ligands MICB, ULBP1, and ULBP3, which are recognized by NKG2D. The U20 glycoprotein of the related virus HHV-6A has been implicated in the downregulation of ULBP1, but the precise mechanism remains undetermined. Methods: We set out to investigate the role of HHV-6B U20 in modulating NK cell activity. We used HHV-6B U20 expressed as a recombinant protein or transduced into target cells, as well as HHV-6B infection, to investigate binding interactions with NK cell ligands and receptors and to assess effects on NK cell activation. Small-angle X-ray scattering was used to align molecular models derived from machine-learning approaches. Results: We demonstrate that U20 binds directly to ULBP1 with sub-micromolar affinity. Transduction of U20 decreases NKG2D binding to ULBP1 at the cell surface but does not decrease ULBP1 protein levels, either at the cell surface or in toto. HHV-6B infection and soluble U20 have the same effect. Transduction of U20 blocks NK cell activation in response to cell-surface ULBP1. Structuralmodeling of the U20 - ULBP1 complex indicates some similarities to the m152-RAE1g complex. [ABSTRACT FROM AUTHOR]

Background/Objectives: Ulcerative colitis (UC) and Crohn’s disease (CD) are the usual clinical forms of inflammatory bowel disease (IBD). Changes in the oral microbiota, especially the presence of emerging fungi and herpesviruses, have been shown to worsen the clinical aspects of IBD. The aim of this study was to screen for emerging pathogens in the oral yeast microbiota and the presence of herpesvirus in IBD patients. Methods: Oral swabs of seven UC or CD patients were collected. The samples were plated on Sabouraud Dextrose Agar and subcultured on CHROMagar Candida and CHROMagar Candida Plus. Polyphasic taxonomy was applied and identified using molecular tools, such as MALDI-TOF MS and ITS partial sequencing. Multiplex qPCR was used to identify the herpesvirus. Results: The mean age was 38.67 ± 14.06 years, 57.14% were female, and two had diabetes. The CD patients presented with Rhodotorula mucilaginosa, Candida orthopsilosis and Kodamaea jinghongensis, while the UC patients presented with Cutaneotrichosporon dermatis, Candida glabrata, Candida lusitanea and Candida tropicalis. Two UC individuals had at least one herpesvirus. In the first individual, a co-detection of Herpes Simplex Virus 1 (HSV-1) and C. lusitaniae was observed. The second presented with co-infections of Epstein–Barr virus (EBV), Human Herpesvirus 7 (HHV-7) and C. tropicalis. Conclusions: We identified rarely described yeasts and co-infections in IBD patients, highlighting the need to identify emerging pathogens in the oral microbiota, as they may contribute to opportunistic infections.

Background: Humoral memory and specific antibody levels depend on the kind of antigen and individual immunofactors. The presence of IgM antibodies or a fourfold rise in specific IgG levels are generally accepted as diagnostic factors in the serology of acute viral infections. This basic model is not adequate for the herpes virome, especially after hematopoietic stem cell transplantation (HSCT), due to continuous, usually multifocal antigenic stimulation, various donor serostatuses, immunosuppression, and individual immunoreconstitution. Methods: A case–control study was conducted to identify active infection cases of human herpesvirus (HHV) (from 300 diagnosed immunocompromised patients) and to evaluate historically associated humoral factors to look at outcomes. We considered only the data of patients with meticulous differential diagnosis to exclude other causes, and thereby to observe pathways and temporal relationships, not the statistical ones usually collected in cohorts. Despite the small number, such data collection and analysis methods avoid a number of biases and indicate cause and effect. Results: In this observational study, a retrospective analysis of data from 300 patients with clinical diagnosis of herpes simplex virus (HSV) and varicella zoster virus (VZV) reactivation showed a number of biases. Two well-differentiated cases (confirmed by a Tzanck test) with various diseases and conditioning evolutions of immune parameters showed an interesting pathway. Exponential decreases in specific IgGs after HSCT preceded virus replication were observed, with a cytopathic effect (shingles, VZV encephalitis and HSV-induced mucositis). The minima (lowest IgG levels) before herpesvirus reactivation were 234.23 mIU/mL and 94 RU/mL for VZV and HSV, respectively. This coincided with a low CD4 titer, but without other infectious processes. Other immune response parameters such as Treg, cytotoxic T cells, and complement and total IgG level were the same as they were before the transplant procedure. Interestingly, a second wave of immunoreconstitution with an anamnestic antibody response was not always observed. It coincided with prolonged herpes viral infection. A patient with lymphocyte depletion in conditioning showed an earlier second wave of immunoreconstitution (6th vs. 14th month). Conclusions: As is typical for infancy, the kinetics of the IgG level is unique after HSCT (the decline phase is first). Host microbiome factors (e.g., HHV1–3-serostatus) should be taken into account to predict risk of non-relapse mortality and survival after HSCT. The levels of specific antibodies help in predicting prognoses and improve disease management. A lack of differentiation and the confusing bias of the assessor (i.e., observer selection bias) are the main obstacles in statistical HHV1–3 research. Such time-lapse case studies may be the first to build evidence of a pathway and an association between immune parameters and HHV disease. [ABSTRACT FROM AUTHOR]

IntroductionHuman Herpesvirus 6B (HHV-6B) impedes host immune responses by downregulating class I MHC molecules (MHC-I), hindering antigen presentation to CD8+ T cells. Downregulation of MHC-I disengages inhibitory receptors on natural killer (NK) cells, resulting in activation and killing of the target cell if NK cell activating receptors such as NKG2D have engaged stress ligands upregulated on the target cells. Previous work has shown that HHV-6B downregulates three MHC-like stress ligands MICB, ULBP1, and ULBP3, which are recognized by NKG2D. The U20 glycoprotein of the related virus HHV-6A has been implicated in the downregulation of ULBP1, but the precise mechanism remains undetermined.MethodsWe set out to investigate the role of HHV-6B U20 in modulating NK cell activity. We used HHV-6B U20 expressed as a recombinant protein or transduced into target cells, as well as HHV-6B infection, to investigate binding interactions with NK cell ligands and receptors and to assess effects on NK cell activation. Small-angle X-ray scattering was used to align molecular models derived from machine-learning approaches.ResultsWe demonstrate that U20 binds directly to ULBP1 with sub-micromolar affinity. Transduction of U20 decreases NKG2D binding to ULBP1 at the cell surface but does not decrease ULBP1 protein levels, either at the cell surface or in toto. HHV-6B infection and soluble U20 have the same effect. Transduction of U20 blocks NK cell activation in response to cell-surface ULBP1. Structural modeling of the U20 – ULBP1 complex indicates some similarities to the m152-RAE1γ complex.

Abstract Background Cervical cancer (CC) is one of the most common gynecologic tumors among women around the world. Although the etiological role of human papillomavirus (HPV) in CC is well established, other factors in CC carcinogenesis remains unclear. Here, we performed a systematic review and meta-analysis to explore the association between infections of human herpesvirus (HHVs) and CC risk. Methods Embase and PubMed databases were utilized to search the relevant studies. The revised JBI Critical Appraisal Tool was used to assess the quality of the included studies. Prevalence and odds ratios (ORs) with 95% confidence intervals (CI) were calculated to evaluate the association between viral infection and CC or precancerous cervical lesions (PCL). Results Totally 67 eligible studies involving 7 different HHVs were included in meta-analysis. We found an increased risk of CC or PCL that was associated with the overall infection of HHVs (CC, OR = 2.74, 95% CI 2.13–3.53; PCL, OR = 1.95, 95% CI 1.58–2.41). Subgroup analysis showed a trend towards positive correlations between herpes simplex virus type 2 (HSV-2) infection and CC (OR = 3.01, 95% CI 2.24 to 4.04) or PCL (OR = 2.14, 95% CI 1.55 to 2.96), and the same is true between Epstein-Barr virus (EBV) infection and CC (OR = 4.89, 95% CI 2.18 to 10.96) or PCL (OR = 3.55, 95% CI 2.52 to 5.00). However, for HSV-1 and cytomegalovirus (HCMV), there was no association between viral infection and CC or PCL. By contrast, the roles of HHV-6, HHV-7, and Kaposi sarcoma–associated herpesvirus (KSHV) in cervical lesions were unclear due to the limited number of studies. Conclusions This study provided evidence that HHVs infection as a whole increase the risk of CC incidence. In addition, some types of HHVs such as EBV and HSV-2 may serve as potential targets in the development of new interventions or therapeutic strategies for cervical lesions.

Adult respiratory distress syndrome due to viral pneumonia occurs predominantly in immunodeficient populations; adult respiratory distress syndrome secondary to human herpesvirus HHV-6 and HHV-7 pneumonia is extremely rare. Whipple’s disease, caused by Tropheryma whipplei, a Gram-positive bacillus and obligate intracellular pathogen, is clinically challenging to diagnose. Whipple’s disease is a chronic multisystem infectious disease caused by T. whipplei, most often affecting the gastrointestinal tract and joints, seldom the lungs. Both pathogens are opportunistic. We report a case of mixed infectious pneumonia in a patient with type 2 diabetes mellitus. The patient presented with dyspnea and intermittent fever. Imaging revealed multiple large patchy consolidations in the left lung. Routine anti-infective therapy was ineffective. Metagenomic next generation sequencing of bronchoalveolar lavage fluid indicated HHV-6 and HHV-7 pneumonia concurrent with T. whipplei and Streptococcus co-infections. Meropenem was administered to improve treatment. This case represents a rare mixed lung infection by multiple uncommon pathogens, and is of particular clinical significance.

Background: Cervical cancer (CC) is one of the most common gynecologic tumors among women around the world. Although the etiological role of human papillomavirus (HPV) in CC is well established, other factors in CC carcinogenesis remains unclear. Here, we performed a systematic review and meta-analysis to explore the association between infections of human herpesvirus (HHVs) and CC risk. Methods: Embase and PubMed databases were utilized to search the relevant studies. The revised JBI Critical Appraisal Tool was used to assess the quality of the included studies. Prevalence and odds ratios (ORs) with 95% confidence intervals (CI) were calculated to evaluate the association between viral infection and CC or precancerous cervical lesions (PCL). Results: Totally 67 eligible studies involving 7 different HHVs were included in meta-analysis. We found an increased risk of CC or PCL that was associated with the overall infection of HHVs (CC, OR = 2.74, 95% CI 2.13–3.53; PCL, OR = 1.95, 95% CI 1.58–2.41). Subgroup analysis showed a trend towards positive correlations between herpes simplex virus type 2 (HSV-2) infection and CC (OR = 3.01, 95% CI 2.24 to 4.04) or PCL (OR = 2.14, 95% CI 1.55 to 2.96), and the same is true between Epstein-Barr virus (EBV) infection and CC (OR = 4.89, 95% CI 2.18 to 10.96) or PCL (OR = 3.55, 95% CI 2.52 to 5.00). However, for HSV-1 and cytomegalovirus (HCMV), there was no association between viral infection and CC or PCL. By contrast, the roles of HHV-6, HHV-7, and Kaposi sarcoma–associated herpesvirus (KSHV) in cervical lesions were unclear due to the limited number of studies. Conclusions: This study provided evidence that HHVs infection as a whole increase the risk of CC incidence. In addition, some types of HHVs such as EBV and HSV-2 may serve as potential targets in the development of new interventions or therapeutic strategies for cervical lesions. [ABSTRACT FROM AUTHOR]

ABSTRACT Human cytomegalovirus (HCMV) requires the robust expression of two immediate early proteins, IE1 and IE2, immediately upon infection to suppress the antiviral response and promote viral gene expression. While transcriptional control of IE1 and IE2 has been extensively studied, the role of post-transcriptional regulation of IE1 and IE2 expression is relatively unexplored. We previously found that the shared major immediate early 5′ untranslated region (MIE 5′ UTR) of the mature IE1 and IE2 transcripts plays a critical role in facilitating the translation of the IE1 and IE2 mRNAs. As RNA secondary structure in 5′ UTRs can regulate mRNA translation efficiency, we used selective 2′-hydroxyl acylation analyzed by primer extension and mutational profiling (SHAPE-MaP) to identify RNA structures in the shared MIE 5′ UTR. We found that the MIE 5′ UTR contains three stable stem loop structures. Using a series of recombinant viruses to investigate the role of each stem loop in IE1 and IE2 protein synthesis, we found that the stem loop closest to the 5′ end of the MIE 5′ UTR (SL1) is both necessary and sufficient for efficient IE1 and IE2 mRNA translation and HCMV replication. The positive effect of SL1 on mRNA translation and virus replication was dependent on its location within the 5′ UTR. Surprisingly, a synthetic stem loop with the same free energy as SL1 in its native location also supported wild type levels of IE1 and IE2 mRNA translation and virus replication, suggesting that the presence of RNA structure at a specific location in the 5′ UTR, rather than the primary sequence of the RNA, is critical for efficient IE1 and IE2 protein synthesis. These data reveal a novel post-transcriptional regulatory mechanism controlling IE1 and IE2 expression and reinforce the critical role of RNA structure in regulating HCMV protein synthesis and replication.IMPORTANCEThese results reveal a new aspect of immediate early gene regulation controlled by non-coding RNA structures in viral mRNAs. Previous studies have largely focused on understanding viral gene expression at the level of transcriptional control. Our results show that a complete understanding of the control of viral gene expression must include an understanding of viral mRNA translation, which is driven in part by RNA structure(s) in the 5′ UTR of viral mRNAs. Our results illustrate the importance of these additional layers of regulation by defining specific 5′ UTR RNA structures regulating immediate early gene expression in the context of infection and identify important features of RNA structure that govern viral mRNA translation efficiency. These results may therefore broadly impact current thinking on how viral gene expression is regulated for human cytomegalovirus and other DNA viruses.

Abstract While hundreds of thousands of human whole genome sequences (WGS) have been collected in the effort to better understand genetic determinants of disease, these whole genome sequences have less frequently been used to study another major determinant of human health: the human virome. Using the unmapped reads from WGS of over 1000 families, we present insights into the human blood DNA virome, focusing particularly on human herpesvirus (HHV) 6A, 6B, and 7. In addition to extensively cataloguing the viruses detected in WGS of human whole blood and lymphoblastoid cell lines, we use the family structure of our dataset to show that household drives transmission of several viruses, and identify the Mendelian inheritance patterns characteristic of inherited chromsomally integrated human herpesvirus 6 (iciHHV-6). Consistent with prior studies, we find that 0.6% of our dataset’s population has iciHHV, and we locate candidate integration sequences for these cases. We document genetic diversity within exogenous and integrated HHV species and within integration sites of HHV-6. Finally, in the first observation of its kind, we present evidence that suggests widespread de novo HHV-6B integration and HHV-7 integration and reactivation in lymphoblastoid cell lines. These findings show that the unmapped read space of WGS is a promising source of data for virology research.

Hydrolytic reactions taking place at the surface of a silicon nitride (Si3N4) bioceramic were found to induce instantaneous inactivation of Human herpesvirus 1 (HHV-1, also known as Herpes simplex virus 1 or HSV-1). Si3N4 is a non-oxide ceramic compound with strong antibacterial and antiviral properties that has been proven safe for human cells. HSV-1 is a double-stranded DNA virus that infects a variety of host tissues through a lytic and latent cycle. Real-time reverse transcription (RT)-polymerase chain reaction (PCR) tests of HSV-1 DNA after instantaneous contact with Si3N4 showed that ammonia and its nitrogen radical byproducts, produced upon Si3N4 hydrolysis, directly reacted with viral proteins and fragmented the virus DNA, irreversibly damaging its structure. A comparison carried out upon testing HSV-1 against ZrO2 particles under identical experimental conditions showed a significantly weaker (but not null) antiviral effect, which was attributed to oxygen radical influence. The results of this study extend the effectiveness of Si3N4's antiviral properties beyond their previously proven efficacy against a large variety of single-stranded enveloped and non-enveloped RNA viruses. Possible applications include the development of antiviral creams or gels and oral rinses to exploit an extremely efficient, localized, and instantaneous viral reduction by means of a safe and more effective alternative to conventional antiviral creams. Upon incorporating a minor fraction of micrometric Si3N4 particles into polymeric matrices, antiherpetic devices could be fabricated, which would effectively impede viral reactivation and enable high local effectiveness for extended periods of time. [ABSTRACT FROM AUTHOR]

The incidence of human herpesvirus (HHVs) is gradually increasing and has affected a wide range of population. HHVs can result in serious consequences such as tumors, neonatal malformations, sexually transmitted diseases, as well as pose an immense threat to the human health. The cGAS-STING pathway is one of the innate immune pattern-recognition receptors discovered recently. This article discusses the role of the cGAS-STING pathway in human diseases, especially in human herpesvirus infections, as well as highlights how these viruses act on this pathway to evade the host immunity. Moreover, the author provides a comprehensive overview of modulators of the cGAS-STING pathway. By focusing on the small molecule compounds based on the cGAS-STING pathway, novel targets and concepts have been proposed for the development of antiviral drugs and vaccines, while also providing a reference for the investigation of disease models related to the cGAS-STING pathway. HHV is a double-stranded DNA virus that can trigger the activation of intracellular DNA sensor cGAS, after which the host cells initiate a cascade of reactions that culminate in the secretion of type I interferon to restrict the viral replication. Meanwhile, the viral protein can interact with various molecules in the cGASSTING pathway. Viruses can evade immune surveillance and maintain their replication by inhibiting the enzyme activity of cGAS and reducing the phosphorylation levels of STING, TBK1 and IRF3 and suppressing the interferon gene activation. Activators and inhibitors of the cGAS-STING pathway have yielded numerous promising research findings in vitro and in vivo pertaining to cGAS/STING-related disease models. However, there remains a dearth of small molecule modulators that have been successfully translated into clinical applications, which serves as a hurdle to be overcome in the future. [ABSTRACT FROM AUTHOR]

More than one hundred herpesviruses have been isolated from different species so far, with nine infecting humans. Infections with herpesviruses are characterized by life-long latency and represent a significant challenge for human health. To investigate the consequences of infections and identify novel treatment options, in vivo models are of particular relevance. The mouse has emerged as an economical small animal model to investigate herpesvirus infections. However, except for herpes simplex viruses (HSV-1, HSV-2), human herpesviruses cannot infect mice. Three natural herpesviruses have been identified in mice: mouse-derived cytomegalovirus (MCMV), mouse herpesvirus 68 (MHV-68), and mouse roseolovirus (MRV). These orthologues are broadly used to investigate herpesvirus infections within the natural host. In the last few decades, immunocompromised mouse models have been developed, allowing the functional engraftment of various human cells and tissues. These xenograft mice represent valuable model systems to investigate human-restricted viruses, making them particularly relevant for herpesvirus research. In this review, we describe the various mouse models used to study human herpesviruses, thereby highlighting their potential and limitations. Emphasis is laid on xenograft mouse models, covering the development and refinement of immune-compromised mice and their application in herpesvirus research. [ABSTRACT FROM AUTHOR]

Background: Humoral memory and specific antibody levels depend on the kind of antigen and individual immunofactors. The presence of IgM antibodies or a fourfold rise in specific IgG levels are generally accepted as diagnostic factors in the serology of acute viral infections. This basic model is not adequate for the herpes virome, especially after hematopoietic stem cell transplantation (HSCT), due to continuous, usually multifocal antigenic stimulation, various donor serostatuses, immunosuppression, and individual immunoreconstitution. Methods: A case–control study was conducted to identify active infection cases of human herpesvirus (HHV) (from 300 diagnosed immunocompromised patients) and to evaluate historically associated humoral factors to look at outcomes. We considered only the data of patients with meticulous differential diagnosis to exclude other causes, and thereby to observe pathways and temporal relationships, not the statistical ones usually collected in cohorts. Despite the small number, such data collection and analysis methods avoid a number of biases and indicate cause and effect. Results: In this observational study, a retrospective analysis of data from 300 patients with clinical diagnosis of herpes simplex virus (HSV) and varicella zoster virus (VZV) reactivation showed a number of biases. Two well-differentiated cases (confirmed by a Tzanck test) with various diseases and conditioning evolutions of immune parameters showed an interesting pathway. Exponential decreases in specific IgGs after HSCT preceded virus replication were observed, with a cytopathic effect (shingles, VZV encephalitis and HSV-induced mucositis). The minima (lowest IgG levels) before herpesvirus reactivation were 234.23 mIU/mL and 94 RU/mL for VZV and HSV, respectively. This coincided with a low CD4 titer, but without other infectious processes. Other immune response parameters such as Treg, cytotoxic T cells, and complement and total IgG level were the same as they were before the transplant procedure. Interestingly, a second wave of immunoreconstitution with an anamnestic antibody response was not always observed. It coincided with prolonged herpes viral infection. A patient with lymphocyte depletion in conditioning showed an earlier second wave of immunoreconstitution (6th vs. 14th month). Conclusions: As is typical for infancy, the kinetics of the IgG level is unique after HSCT (the decline phase is first). Host microbiome factors (e.g., HHV1–3-serostatus) should be taken into account to predict risk of non-relapse mortality and survival after HSCT. The levels of specific antibodies help in predicting prognoses and improve disease management. A lack of differentiation and the confusing bias of the assessor (i.e., observer selection bias) are the main obstacles in statistical HHV1–3 research. Such time-lapse case studies may be the first to build evidence of a pathway and an association between immune parameters and HHV disease.

While hundreds of thousands of human whole genome sequences (WGS) have been collected in the effort to better understand genetic determinants of disease, these whole genome sequences have less frequently been used to study another major determinant of human health: the human virome. Using the unmapped reads from WGS of over 1000 families, we present insights into the human blood DNA virome, focusing particularly on human herpesvirus (HHV) 6A, 6B, and 7. In addition to extensively cataloguing the viruses detected in WGS of human whole blood and lymphoblastoid cell lines, we use the family structure of our dataset to show that household drives transmission of several viruses, and identify the Mendelian inheritance patterns characteristic of inherited chromsomally integrated human herpesvirus 6 (iciHHV-6). Consistent with prior studies, we find that 0.6% of our dataset's population has iciHHV, and we locate candidate integration sequences for these cases. We document genetic diversity within exogenous and integrated HHV species and within integration sites of HHV-6. Finally, in the first observation of its kind, we present evidence that suggests widespread de novo HHV-6B integration and HHV-7 integration and reactivation in lymphoblastoid cell lines. These findings show that the unmapped read space of WGS is a promising source of data for virology research. [ABSTRACT FROM AUTHOR]

Kaposi sarcoma is a tumor caused by Kaposi sarcoma herpesvirus, also known as human herpesvirus 8. Its occurrence is associated with an immunocompromised state. Kaposi sarcoma that occurs among people living with HIV (PLWH) is known as epidemic Kaposi sarcoma. Despite the decline in HIV-associated complications because of the introduction of combination antiretroviral therapy two decades ago, Kaposi sarcoma continues to affect PLWH worldwide. It affects young African American men more than other age and racial groups and can result in multiorgan dysfunction, leading to short-term and chronic debilitating symptoms as well as death. While some patients with epidemic Kaposi sarcoma are managed as outpatients, others may require higher levels of care and their acuity may fluctuate throughout their life span. Therefore, nurses, regardless of their specialty, may experience caring for a patient with epidemic Kaposi sarcoma at some point in their career. Learning about this condition and the needs of patients who have it will help nurses provide effective care. Here, the authors describe Kaposi sarcoma in general as well as the epidemiology, characteristics, and management of epidemic Kaposi sarcoma. They also describe specific nursing considerations in the care of PLWH who have the disease. This article provides an update on the incidence, characteristics, and management of Kaposi sarcoma, and outlines nursing considerations in the care of people living with HIV who have the disease. [ABSTRACT FROM AUTHOR]

Human herpesvirus, a specific group within the herpesvirus family, is responsible for a variety of human diseases. These viruses can infect humans and other vertebrates, primarily targeting the skin, mucous membranes, and neural tissues, thereby significantly impacting the health of both humans and animals. Animal models are crucial for studying virus pathogenesis, vaccine development, and drug testing. Despite several vaccine candidates being in preclinical and clinical stages, no vaccines are current available to prevent lifelong infections caused by these human herpesviruses, except for varicella-zoster virus (VZV) vaccine. However, the strict host tropism of herpesviruses and other limitations mean that no single animal model can fully replicate all key features of human herpesvirus-associated diseases. This makes it challenging to evaluate vaccines and antivirals against human herpesvirus comprehensively. Herein, we summarize the current animal models used to study the human herpesviruses including α-herpesviruses (herpes simplex virus type 1(HSV-1), HSV-2, VZV), β-herpesviruses (human cytomegalovirus (HCMV), γ-herpesviruses (Epstein-Barr virus (EBV)) and Kaposi's sarcoma herpesvirus (KSHV)). By providing concise information and detailed analysis of the potential, limitations and applications of various models, such as non-human primates, mice, rabbits, guinea pigs, and tree shrews, this summary aims to help researchers efficiently select the most appropriate animal model, offering practical guidance for studying human herpesvirus., (© 2025 The Author(s). Animal Models and Experimental Medicine published by John Wiley & Sons Australia, Ltd on behalf of The Chinese Association for Laboratory Animal Sciences.)

Objective: This review aims to consolidate available evidence, identify research gaps, and advocate for a more informed approach to the management of pityriasis rosea in pregnant individuals., Data Sources: PubMed, Web of Science, and Directory of Open Access Journals were systematically searched based on the keywords "pityriasis rosea," "pityriasis circinate," "roseola annulate," "herpes tonsurans maculosus," "herald patch," and "pregnancy" on January 25, 2024 for publications between 1950 to 2024., Study Selection: Studies containing outcomes data for pregnant patients with established PR were included. Studies must have been written or translated into English and published in a peer-reviewed journal. Studies which did not pertain to PR in the setting of pregnancy were excluded, as screened by two reviewers. Responses, general informational reviews, and letters to the editor without novel data were also excluded., Results: Eleven relevant articles were identified, encompassing data from 177 patients. Overall, 81% of patients had favorable outcomes while 19% experienced unfavorable outcomes. PR onset before 15 weeks gestation was associated with a higher rate of unfavorable outcomes (41%), including a 27% rate of spontaneous abortion (SA). Conversely, PR onset after 15 weeks had a lower unfavorable outcome rate (21%), and no instances of SA., Conclusion: Conflicting data exists regarding the impact of PR on pregnancy outcomes. However, PR onset within the first 15 weeks, widespread lesions, constitutional symptoms, and higher human herpesvirus 6 viral loads may increase the risk of unfavorable outcomes such as SA. Close follow-up and consideration of antiviral treatment are recommended for high-risk patients., Competing Interests: The authors made the following disclosures: M.K.P. receives royalties from UpToDate, is a member of the scientific advisory board of Proctor & Gamble, and has served as a consultant for Incyte. S.R.L. has served as a consultant for Moberg Pharmaceuticals, BelleTorus Corporation, Eli Lilly, and Ortho-Dermatologics. The other authors have no conflicts of interest., (Copyright © 2025 The Authors. Published by Wolters Kluwer Health, Inc. on behalf of Women’s Dermatologic Society.)

Knowledge about viral characteristics, mechanisms of entry into the host cell and multiplication/dissemination can help in the control and treatment of viral pathologies. Several nutritional factors linked to the host may favour viral multiplication and their control, may lead to new prophylactic alternatives and/or antiviral therapies. The objective of this review is to discuss the relationship between the amino acid L‐lysine and the control of viral infections, aiming at a possible therapeutic property. This research used databases such as PubMed, Web of Science, Scielo, Medline and Google Scholar, as well as searching for references cited by journals. The time frame covered the period between 1964 and January 2022. The observed studies have shown that the usual antiviral therapies are not able to interfere with the viruses in their latent state; however, they can interfere with the adhesion and fusion of viral particles or the production of proteins, which play an important role in viral epidemiology and control, particularly in the initial moment and in reactivation. Lysine is an amino acid that can interfere mainly in the formation of capsid proteins and DNA by a competitive antagonism with amino acid arginine, which is an essential amino acid for some viruses, and also by promoting the increase of arginase, increasing the catabolism of arginine. Although there is evidence of the importance of L‐lysine in viral control, more studies are needed, with a view to new antiviral therapies. [ABSTRACT FROM AUTHOR]

More than one hundred herpesviruses have been isolated from different species so far, with nine infecting humans. Infections with herpesviruses are characterized by life-long latency and represent a significant challenge for human health. To investigate the consequences of infections and identify novel treatment options, in vivo models are of particular relevance. The mouse has emerged as an economical small animal model to investigate herpesvirus infections. However, except for herpes simplex viruses (HSV-1, HSV-2), human herpesviruses cannot infect mice. Three natural herpesviruses have been identified in mice: mouse-derived cytomegalovirus (MCMV), mouse herpesvirus 68 (MHV-68), and mouse roseolovirus (MRV). These orthologues are broadly used to investigate herpesvirus infections within the natural host. In the last few decades, immunocompromised mouse models have been developed, allowing the functional engraftment of various human cells and tissues. These xenograft mice represent valuable model systems to investigate human-restricted viruses, making them particularly relevant for herpesvirus research. In this review, we describe the various mouse models used to study human herpesviruses, thereby highlighting their potential and limitations. Emphasis is laid on xenograft mouse models, covering the development and refinement of immune-compromised mice and their application in herpesvirus research.

Background Associations between human herpesviruses (HHVs) and cardiovascular disease/mortality have been reported, but evidence is inconsistent. We investigated associations between 3 common herpesviruses and (1) incident stroke or myocardial infarction (MI) and (2) all-cause mortality. Methods We included participants from the UK Biobank Infectious Disease pilot study with valid serum antibody (IgG) measurements taken at cohort entry (2006–2010) for herpes simplex virus type 1 (HSV1), varicella zoster virus (VZV), and cytomegalovirus (CMV). Linked hospital and mortality records up to December 30 2019 provided information on rates of (1) incident first stroke or MI and (2) all-cause mortality. Hazard ratios (HRs) from Cox proportional hazards regression models were used to assess relationships between (1) HHV seropositivity, (2) HHV titer and incident stroke/MI, and death outcomes. Fully adjusted models accounted for sociodemographic information (age, sex, ethnicity, education, deprivation quintile, birthplace, population density), baseline comorbidities (including diabetes and hypertension), smoking status, body mass index, and serum cholesterol. Results Of 9429 study participants (56% female, 95% White, median age 58 years), 41% were seropositive for all 3 HHVs. Human herpesvirus seropositivity was not associated with stroke/MI (fully adjusted HRs and 95% confidence intervals [CIs]: HSV1 = 0.93 [CI, 0.72–1.22], VZV = 0.78 [CI, 0.51–1.20], CMV = 0.91 [CI, 0.71–1.16]) or all-cause mortality (HSV1 = 1.21 [CI, 1.00–1.47], VZV = 0.79 [CI, 0.58–1.07], CMV = 0.90 [CI, 0.76–1.06]). Human herpesvirus titers were not associated with outcomes. Conclusions In this mostly White UK Biobank subset, neither HHV seropositivity nor titers were associated with stroke/MI or all-cause mortality. [ABSTRACT FROM AUTHOR]

Abstract Background In recent years, fluorescent quantitative polymerase chain reaction assays for detecting viral DNA are in widespread use throughout the world. However, considering the wide distribution of new herpesvirus among the population, we constructed a method to detect HHV-6, 7, and 8 simultaneously. Methods The blood samples of 74 blood donors and 45 pityriasis rosea patients were collected. The recombinant plasmids containing U67, U36, and orf65 were constructed to optimize the PCR reaction system. The forward and reverse primers and probe sequences of HHV-6 were as follows: TAAATATCGATGCCGCTCTG, ACGTTCTAGCCATCTTCTTTG, CGCAAACGACAAAGCCA. The forward and reverse primers and probe sequences of HHV-7 were as follows: TTAGACATCTTACACGACAGC, CAGCTTTTCGAACTTGTCAC, TTCATCGGGTACGTCCA. The forward and reverse primers and probe sequences of HHV-8 were as follows: GCGACATATTTCCCTGATCC, CCAACTTTAAGGTGAGAGACC, CATGCGAGCCACCAG. Through the detection of housekeeping genes, DNA sequencing, and optimization of the PCR reaction system, the triple fluorescent quantitative PCR detection system was constructed. Blood samples of blood transfusion staff and pityriasis rosea patients were detected. Results The correlations of HHV-6, 7, and 8 between single and multiplex PCR are 0.980, 0.987, 0.965, respectively. In 74 blood donor samples, 16.2% of HHV-6 and 55% of HHV-7 were positive (viral load > 3 log10 copies/ml) according to multiplex real-time PCR. In 45 patients suspected of pityriasis rosea (PR) infection, 40% HHV-6, 73.3% positive cases are found. Conclusion With the safety of blood transfusion being a major concern of the public, this method will show good specificity and sensitivity in blood transfusion screening.

This review presents the data on the spreading of all known human herpesviruses (НHVs) in female urogenital tract. According to the WHO almost 500 million people worldwide suffer from genital infection caused by НHVs. НHVs were detected in various inflammatory diseases of female upper and lower genital tract (vaginitis and cervicitis), in extrauterine pregnancy (in fallopian tubes), in infertility (cervical channel, endometrium and ovaries). Herpes simplex virus 1 (HSV‑1) was identified for the first time in oocytes after failed in vitro fertilization (IVF). НHVs produce negative effect on the entire reproductive process from conception to childbirth. It was established that HSV, cytomegalovirus (CMV) and human herpesvirus 6 (HHV-6) markedly increase the risk of spontaneous abortion, preterm birth and stillbirth. Intrauterine НHV infection is a major cause of congenital malformations. Data on humoral and cell immunity in genital herpesvirus infections (НHVI) are also reviewed. Intravaginal HSV‑2 infection changes cell composition of vaginal mucosa, i.e., together with cells mobilized from the blood, protective role is performed by resident memory T‑cells (TRM), natural killer cells (NK‑cells) and regulatory T‑cells (Treg) whose function consists in maintaining the balance of the activities of lymphocytes. Constant НHVI spreading is largely explained by transition of primary infection to potentially reactivating latent form, since latent virus is unavailable to immune recognition and medicines. The genome editing system CRISPR/Cas9 can recognize and modify not only active but also latent viruses. The promising pilot results with the use of this system offer the possibility of developing innovative technologies for НHV elimination and НHVI eradication.

Human roseolovirus U20 and U21 are type I membrane glycoproteins that have been implicated in immune evasion by interfering with recognition of classical and non-classical MHC proteins. U20 and U21 are predicted to be type I glycoproteins with extracytosolic immunoglobulin-like domains, but detailed structural information is lacking. AlphaFold and RoseTTAfold are next generation machine-learning-based prediction engines that recently have revolutionized the field of computational three-dimensional protein structure prediction. Here, we review the structural biology of viral immunoevasins and the current status of computational structure prediction algorithms. We use these computational tools to generate structural models for U20 and U21 proteins, which are predicted to adopt MHC-Ia-like folds with closed MHC platforms and immunoglobulin-like domains. We evaluate these structural models and place them within current understanding of the structural basis for viral immune evasion of T cell and natural killer cell recognition. [ABSTRACT FROM AUTHOR]

Human roseolovirus U20 and U21 are type I membrane glycoproteins that have been implicated in immune evasion by interfering with recognition of classical and non-classical MHC proteins. U20 and U21 are predicted to be type I glycoproteins with extracytosolic immunoglobulin-like domains, but detailed structural information is lacking. AlphaFold and RoseTTAfold are next generation machine-learning-based prediction engines that recently have revolutionized the field of computational three-dimensional protein structure prediction. Here, we review the structural biology of viral immunoevasins and the current status of computational structure prediction algorithms. We use these computational tools to generate structural models for U20 and U21 proteins, which are predicted to adopt MHC-Ia-like folds with closed MHC platforms and immunoglobulin-like domains. We evaluate these structural models and place them within current understanding of the structural basis for viral immune evasion of T cell and natural killer cell recognition.

Both human immunodeficiency virus (HIV) and human herpesvirus (HHV) infections persist lifelong, and almost all individuals infected with HIV are also infected with ≥1 HHV. These coinfections are not independent processes or benign. In this review, we discuss how HHVs, and cytomegalovirus in particular, interact with concurrent HIV infection, and we describe the next steps necessary to understand and address these connections.

Human cytomegalovirus (HCMV) is ubiquitous worldwide and elicits global health problems. The diseases associated with HCMV are a serious threat to humans, especially for the sick, infant, elderly and immunocompromised/immunodeficient individuals. Although traditional antiviral drugs (e.g., ganciclovir, valganciclovir, cidofovir, foscarnet) can be used to treat or prevent acute HCMV infections, their efficacy is limited because of toxicity, resistance issues, side effects and other problems. Fortunately, novel drugs (e.g., letermovir and maribavir) with less toxicity and drug/cross-resistance have been approved and put on the market in recent years. The nucleic acid-based gene-targeting approaches including the external guide sequences (EGSs)-RNase, the clustered regularly interspaced short palindromic repeats (CRISPRs)/CRISPRs-associated protein 9 (Cas9) system and transcription activator-like effector nucleases (TALENs) have been investigated to remove both lytic and latent CMV in vitro and/or in vivo. Cell therapy including the adoptive T cell therapy (ACT) and immunotherapy have been tried against drug-resistant and recurrent HCMV in patients receiving hematopoietic stem cell transplantation (HSCT) or solid organ transplant (SOT), and they have also been used to treat glioblastoma (GBM) associated with HCMV infections. These newly developed antiviral strategies are expected to yield fruitful results and make a significant contribution to the treatment of HCMV infections. Despite this progress, the nucleic acid-based gene-targeting approaches are still under study for basic research, and cell therapy is adopted in a small study population size or only successful in case reports. Additionally, no current drugs have been approved to be indicated for latent infections. Therefore, the next strategy is to develop antiviral strategies to elevate efficacy against acute and/or latent infections and overcome challenges such as toxicity, resistance issues, and side effects. In this review, we would explore the challenges, recent advances and perspectives in the treatment of HCMV infections. Furthermore, the suitable therapeutic strategies as well as the possibility for compassionate use would be evaluated.

Myalgic Encephalomyelitis/Chronic Fatigue Syndrome (ME/CFS) is a complex chronic condition affecting multiple body systems, with unknown cause, unclear pathogenesis mechanisms, and fluctuating symptoms which may lead to severe debilitation. It is frequently reported to have been triggered by an infection, but there are no clear differences in exposure to, or seroprevalence of, any particular viruses between people with ME/CFS and healthy individuals. However, herpes viruses have been repeatedly hypothesized to underlie the chronic relapsing/remitting form of MS/CFS due to their persistence in a latent form with periodic reactivation. It is possible that ME/CFS is associated with herpes virus reactivation, which has not been detectable previously due to insufficiently sensitive testing methods. Saliva samples were collected from 30 people living with ME/CFS at monthly intervals for 6 months and at times when they experienced symptom exacerbation, as well as from 14 healthy control individuals. The viral DNA load of the nine humanherpes viruses was determined by digital droplet PCR. Symptoms were assessed by questionnaire at each time point. Human herpesvirus (HHV) 6B, HHV-7, herpes simplex virus 1 and Epstein-Barr virus were detectable within the saliva samples, with higher HHV-6B and HHV-7 viral loads detected in people with ME/CFS than in healthy controls. Participants with ME/CFS could be broadly separated into two groups: one group displayed fluctuating patterns of herpesviruses detectable across the 6 months while the second group displayed more stable viral presentation. In the first group, there was positive correlation between HHV-6B and HHV-7 viral load and severity of symptom scores, including pain, neurocognition, and autonomic dysfunction. The results indicate that fluctuating viral DNA load correlates with ME/CFS symptoms: this is in accordance with the hypothesis that pathogenesis is related to herpesvirus reactivation state, and this should be formally tested. Herpesvirus reactivation might be a cause or consequence of dysregulated immune function seen in ME/CFS. The sampling strategy and molecular tools developed here permit such large-scale epidemiological investigations.

Aim: To investigate the impact of human herpes virus ( HHV ) carriage on lung microbiota, and its correlation with clinical features and laboratory indicators in patients. Methods: Retrospective analysis was conducted on 30 outpatient lung infection cases, which were divided into HHV (n = 15) and non- HHV (n = 15) groups. mNGS detected microbial composition. Microbial diversity and abundance were tested using Shannon and Chao1 indices. Their relationship with laboratory indicators were explored. Results: Significant differences in microbial abundance and distribution were found between two groups (p < 0.05). Moreover, HHV group showed negative correlations (p < 0.05) between Prevotella , Porphyromonas , Streptococcus and basophil/eosinophil percentages. Conclusion: HHV carriage impacts lung microbiota, emphasizing the need for clinicians to pay attention to HHV reactivation in outpatient lung infection patients.

Objective: The aim of this study is to provide guidance for refining medication protocols, developing alternative strategies, and enhancing protection against herpesvirus infections in personalized clinical settings., Methods: Adverse drug events (ADEs) data for anti-herpesvirus from the first quarter of 2004 to the fourth quarter of 2022 were collected from the FDA Adverse Event Reporting System (FAERS). Disproportionality analysis was performed using Reporting Odds Ratio (ROR), Proportional Reporting Ratio (PRR), and Bayesian Confidence Propagation Neural Network (BCPNN) methods for data mining., Results: A total of 18,591, 24,206, 6,150, and 419 reports of ADEs associated with acyclovir (ACV), valacyclovir (VACV), ganciclovir (GCV), and famciclovir (FCV) were screened and extracted from the FAERS. In this study, the report summarized the high frequency and strong correlation of ADEs for the four drugs at the Preferred Term (PT) level. Additionally, the analysis also identified the relationship between ADEs and factors such as age, gender, and severity of outcome at the System Organ Class (SOC) level., Conclusion: The safety reports for the four-nucleoside analogue anti-herpesvirus drugs are diverse and interconnected. Dosing for patients with herpesvirus infections should be tailored to their specific conditions and the potential risk of disease.