Search

Accurate spatial decision-making models are increasingly needed for wind energy planning as the globe rushes towards carbon-neutral energy. This research aims to improve existing decision-making approaches by proposing an ensemble weight-based model for mapping the spatial suitability of onshore wind systems. The model addressed three weighting scenarios: subjective weighting derived from the Analytical Hierarchy Process (AHP), objective weighting derived from the Entropy Weighting Method (EWM), and Artificial Intelligence (AI) weighting based on real-world experiences. The weight sources were harnessed in weighted and fuzzy overlays in a GIS context to create multiple suitability indices. The model was applied to the Wasit governorate in Iraq, considering 10 evaluation criteria and 6 restrictions. The results highlight the dominance of techno-economic considerations, with wind speed being an important factor in all weighting scenarios. Suitability indices suggest that the western, central, and southern areas of Wasit are most suitable for wind farms, with ideal sites identified south of Al-Hay, south of Sheikh Saad, and west of Al-Kut, covering an area of 756 km2 and potentially providing more than 3.5 GW of clean electricity. The findings could encourage wind energy investment in developing countries like Iraq. [ABSTRACT FROM AUTHOR]

Listeriosis is a important abortive diseases in sheep , and is considered one of the most risky bacterial zoonotic disease worldwide.The study was carried out in 50 sheep flocks placed in the Nineveh governorate, Iraq during November and December 2022, a total of 300 specimens of blood , abomasum content and brain ( 100 each)were collected from local breed ovine aborted fetues(in the last stage of gestation) were obtained to be tested for molecular detection of Listeria monocytogenes . L monocytogenes DNA was detected in a total of 61(20.3%) specimens , distributed as: 35(57.4%) ,15(24.6% and 11(18.0%) strains from fetal brain, abomasum and blood specimens respectively using direct genus-specific conventional polymerase chain reaction (prfA gene) C- PCR. Two L. monocytogenes strains ( HMB1 listeriolysin, HMB 2 listeriolysin ) deposited in GenBank under accession numbers LC769365.1,and LC769366.1. All L. monocytogenes strains were positive for three genes (InlJ, InlA, and hlyA) except actA gene was detected in 46 (75.4%) strains. In conclusion , L. monocytogenes is one of the important causal agents of abortion in sheep flocks in Nineveh province , Iraq, and most of the brain specimens were positive for listeric infection compared to the other specimens.

The primary aim of this study was to analyze the nucleocapsid (N) gene of the Canine Distemper Virus (CDV) in infected canines within Baghdad, Iraq. A total of 50 samples, encompassing nasal swabs and fecal specimens, were obtained from canines of various ages and breeds. Utilizing a Rapid Test, nine of 50 samples tested positive for CDV. Subsequent to this, the RNA from the positively tested samples was extracted and subjected to Reverse ‎Transcription-‎Polymerase Chain Reaction (RT-PCR) for cDNA synthesis. The synthesized ‎cDNA was further amplified through conventional PCR targeting the N gene. Six of these amplified products were submitted to Macrogen, South Korea, for sequencing. Sequence analysis revealed multiple silent and missense point mutations within the N gene. Phylogenetic analysis indicated a 99% similarity of the N gene in the Iraqi strains to a known strain from the USA. Overall, this study identifies point mutations in the N gene of CDV in infected canines in Iraq and establishes that ‎the circulating strain exhibits high genetic resemblance to a USA strain. Therefore, it is imperative to formulate and implement high-efficacy vaccines and comprehensive control ‎strategies‎. This represents the first study in Iraq to focus on the N gene ‎analysis of CDV in infected dogs.

Introduction: To improve current practices and create the most effective healthcare waste treatment system, solid medical waste composition needs to be analyzed. This study aims to develop models to predict the rate of medical waste production in hospitals in Hilla city, Iraq. Predictive mode can be used to set standards, evaluate current methods for treating and disposing medical waste, and optimize healthcare solid waste management systems. Materials and Methods: Predictive models and long-term data on the composition and rate of solid medical waste generation were developed using a longitudinal study design. A standardized questionnaire and weighted scale were used to measure solid medical waste generated from the five public hospitals. Statistics were used to create models predicting the amount of waste generated at each hospital. Results: These models demonstrated a significant correlation between inpatient and outpatient numbers and waste generation. Different hospitals treat different numbers of inpatients and outpatients. Different models have been created based on various types of hospitals. Conclusion: Linear rule-based models accurately represent the weights of variables, identify the sources and implications of solid medical waste, and control waste levels by using a variety of parameters. The research model can help in the development of an effective strategic plan for setting up a medical solid waste (MSW) management system.

A total of 4754 snails were collected from four sites (Qandil, Kawergosk, Khabat, and Sufaia) on Greater Zab River, Kurdistan Region, Iraq, identified morphologically and the distribution results made up of 2764 (58.14%) of Physella acuta, 919 (19.33%) of Radix auricularia, 416 (8.75%) of Radix euphratica, 180 (3.79%) of Radix sp., 255 (5.36) of Melanopsis praemorsa and 220 (4.63%) of Gyraulus huwaizahensis. Statistical analysis of species distribution showed significant (p

Surface Air Temperature (SAT) is an important weather element affecting the climate and its nature, as it greatly affects the nature of the atmosphere prevailing in the city of Baghdad, as well as the main influence on the pressure systems affecting Iraq and thus the city of Baghdad. In this study, the annual SAT for three aspects of temperatures (mean, maximum, and minimum) for Baghdad city of approved 11 years had studied, analyzed and discussed. The sources of data came from two sources. First, Iraqi Meteorological Organization and Seismology (IMOS), which represented the arithmetic average annually of the SAT, maximum and minimum temperature for the period (2009 – 2019). Second source of data was from Mustansiriyah University, atmospheric sciences department of Atmospheric Sciences - college of Science, the data are supported as monthly average for SAT for Baghdad. Results shown Basrah was high annual of SAT than four selective cities in Iraq. The variation of annual SAT was in the end study period where reach to 7 oC in mean of SAT for Basrah city. The trend of SAT for Baghdad city was positive for Mean and maximum, while negative for minimum case. Mustansiriyah station was high than IMOS station by 2 oC for mean of SAT, and 5 oC for maximum SAT.

The COVId19 pandemic is a newly emerging infectious disease that needs to be understood thoroughly in order to be controlled. This study aimed to study the clinical and laboratory characteristics of the COVID19 patient . Patient and methods: A cross-sectional study was done in Iraq, at Salahadeen general hospital from the period 1st March to the end of May 2020 on patients diagnosed with COVID 19. A total of 75 COVID19 patients enrolled in the study. a full history was taken, a full physical examination was done, computerized tomography, and laboratory tests. Results: The age distribution of the COVID19 patient were commonly aged (30-50 years) 37(49.3%), and those aged

This paper investigated an Iraqi dataset from Korek Telecom Company as Call Detail Recorded (CDRs) for six months falling between Sep. 2020-Feb. 2021. This data covers 18 governorates, and it falls within the period of COVID-19. The Gravity algorithm was applied into two levels of abstraction in deriving the results as the macroscopic and mesoscopic levels respectively. The goal of this study was to reveal the strength and weakness of people migration in-between the Iraqi cities. Thus, it has been clear that the relationship between each city with the others is based on inflows and outflows of mobile people. However, the COVID-19 effects on the people’s migration needed to be explored. Whereas the main function of the gravity model is to clarify the migration flows through modeling spatial interaction. This was implemented using Python scripting language. It is concluded that the gravity model has a powerful ability to analyze the movement of people between cities. According to the mean of result between governorates, showing that the highest attraction was between Babil and Anbar governorates amounted to 99%, while the lowest attraction was between Wasit and Thi-Qar governorates with, and the others ranged between 86% - 98%. [ABSTRACT FROM AUTHOR]

Background: Systemic lupus erythematosus (SLE) is a chronic autoimmune disease with high morbidity and disability. The routines involved in taking medications, side effects, the nature of medicines, difficulties with the healthcare system, and disruptions to social activities all contribute to patients frequently experiencing medication-related burdens (MRB). The current study aimed to assess the perceived MRB among a sample of SLE patients from Iraq and to look for any possible relationship between MRB and disease activity. Methods: The current study was cross-sectional on diagnosed SLE patients who arrived at Baghdad Teaching Hospital/Medical City/Rheumatology department from September 2021 to January 2022. MRB was measured using the Living with Medicines Questionnaire (LMQ). Results: The study recruited 156 SLE patients. The patients were 35.8 ±11.7 years old on average. Great majority of them were women (96.8 %). The average LMQ score was 117.30± 18.37. The results showed that most patients (69.87%) experienced a moderate level of burden, followed by a low level (19.87%), high level (7.69%), and no burden at all (2.56%). No patients experienced an extremely high level of burden (0.0%). The mean burden scores for two LMQ domains—relationships with health care professionals (HCPs) and effectiveness of prescription medications—were the lowest (below average). Conclusions: Many of the SLE patients in this study reported experiencing MRB. Healthcare professionals should implement strategies to reduce this burden, particularly for low-income patients.

Objective This study is designed to assess the polypharmacy use by elderly patients having multimorbidity in Kirkuk, Iraq Methodology. This descriptive cross sectional study conducted over one year period (1 January - 31 December, 2017) with 105 adults (75 females and 30 males) aged ≥65 years, who attended outpatient clinic of the Geriatric Medicine Department in Azadi Teaching Hospital in Kirkuk Province in Iraq. Patients with ≥2 considered as multimorbidity subjects and patients taking >5 medications considered as polypharmacy subjects. Data were collected directly from the patients by face-to-face interview technique Results The mean age was 70.49±3.88 years. The most common diseases were Hypertension and diabetes mellitus (n: 105, 100%). It was determined that (n: 95, 90.5%) of patients aged 65 to 74 years and (n: 10, 9.5%) of patients aged 75 to 82 years had multimorbidity, the difference between the two age groups was statistically significant. The mean number of drugs used by participants was 7.3±1.1 drug/ day, the highest polypharmacy was 6,7 and 8 drugs per day (n: 31, 29.52%), (n: 30, 28.57%) and (n: 30, 28.57%) respectively. There was a statistical significant increase in polypharmacy with the increase in the multimorbidity. Conclusion The prevalence of polypharmacyin multimorbid elderly patients was very high.

Background: Systemic lupus erythematosus (SLE) is a chronic autoimmune disease with high morbidity and disability. The routines involved in taking medications, side effects, the nature of medicines, difficulties with the healthcare system, and disruptions to social activities all contribute to patients frequently experiencing medication-related burdens (MRB). The current study aimed to assess the perceived MRB among a sample of SLE patients from Iraq and to look for any possible relationship between MRB and disease activity. Methods: The current study was cross-sectional on diagnosed SLE patients who arrived at Baghdad Teaching Hospital/Medical City/Rheumatology department from September 2021 to January 2022. MRB was measured using the Living with Medicines Questionnaire (LMQ). Results: The study recruited 156 SLE patients. The patients were 35.8 ±11.7 years old on average. Great majority of them were women (96.8 %). The average LMQ score was 117.30± 18.37. The results showed that most patients (69.87%) experienced a moderate level of burden, followed by a low level (19.87%), high level (7.69%), and no burden at all (2.56%). No patients experienced an extremely high level of burden (0.0%). The mean burden scores for two LMQ domains—relationships with health care professionals (HCPs) and effectiveness of prescription medications—were the lowest (below average). Conclusions: Many of the SLE patients in this study reported experiencing MRB. Healthcare professionals should implement strategies to reduce this burden, particularly for low-income patients.

Background : pulmonary tuberculosis (PTB) is one of the most global dangerous infectious diseases worldwide, particularly in developing countries. Mycobacterium tuberculosis ( Mtb) is the most infectious agent that caused PTB transferred by air droplets from one person to other. In the present epidemiological study, we aimed to record the total numbers and percentages of patients infected with PTB caused by Mtb during 12 months in AL-Najaf Governorate, Iraq. Methods : This study has been done in 2019 from January to the end of December in the north and south region of AL-Najaf Governorate, Iraq. Sputum of PTB-patients has been stained by Ziehl–Neelsen to Mtb diagnosis according to World Health Organization (WHO) recommendation. Results : We recorded 174 PTB-patients in AL-Najaf Governorate 2019; 89 male and 85 female; 101 and 73 in the north and south sections respectively. The age group 16-24 was the highest infected. Quarter two recorded the highest numbers of PTB-patients; 33 (60%) in the north section and 22 (40%) in the south section. Conclusion : There was low PTB incidence in AL-Najaf Governorate 2019 but the Youngers were the most susceptible to infection. Infection in the north section was higher than in the south section and there were no high differences between genders. Seasons have no high effect on the number of infections.

Carbon dioxide intensity (CI) refers to carbon dioxide emissions from fossil fuel combustion that mainly used for electricity, heat, transport, and other life requirements. The objective of this paper is better to understand CI as an indicator of Global Warming, and compared its behavior with two other variables (total CO2 emissions, and CO2 emissions per capita). The main data sources an available and activity data from Carbon Dioxide Information Analysis Center (CDIAC). Three annual variables used in this study; CI, total CO2 emissions, and CO2 per capita for fossil fuel emissions during long time series from (1971 to 2018). The results of CI shown that the highest value found out at the beginning of the study in 1971 was (7.188 kg/kg oil equivalent), and then decreased till reach to lower value was (1.707 kg/kg oil equivalent) in 1997, after that slowly increased in the last decade near to (3.63 kg/kg oil equivalent). The total CO2 emissions were strongly related to oil prediction. The highest value for total CO2 emissions was (188.1 Mt) in 2018, with Iraqi oil production more than (4.78 million barrel/day). The total CO2 emissions increased by (65. 176%) during the study period. The total CO2 emissions were inversely proportional to CI. The level of CO2 emission per capita rate fluctuated around average (3.49 metric tons per capita); the maximum rate was (4.99 metric tons per capita) in 2013.

Shaema Amin,1 Sana Jalal,2 Kosar Ali,3 Luqman Rasool,4 Tara Osman,4 Omed Ali,5 Abdalhamid M-Saeed4 1Hiwa Hematology/Oncology Sulaymaniyah Cancer Center, Sulaymaniyah, Iraq; 2Department of Pathology, College of Medicine, University of Sulaymaniyah, Sulaymaniyah, Iraq; 3Department of Medicine, College of Medicine, University of Sulaymaniyah, Sulaymaniyah, Iraq; 4Thalassemia and Congenital Blood Disorders Center, Sulaymaniyah, Iraq; 5Otolaryngology Head and Neck Surgery Center, Sulaymaniyah Teaching Hospital, Sulaymaniyah, IraqCorrespondence: Shaema AminHiwa Hematology/Oncology Sulaymaniyah Cancer Center, Sulaymaniyah, IraqTel +964-7701499546Email shaema.salih.amin@gmail.comBackground: β-thalassemia is a significant problem in the northeastern part of Iraq, and has imposed a huge burden on the health authorities.Objective: To identify the molecular characterization and morbidity prevalence in transfusion-dependent thalassemia (TDT) and non-transfusion dependent thalassemia (NTDT) phenotypes in northeastern Iraq.Patients and Methods: This is a cross-sectional study conducted on 242 β-thalassemia patients from 162 families. Reverse hybridization technique and direct gene sequencing were used to characterize β-thalassemia mutations, and medical records of the patients were reviewed with a well-designed questionnaire.Results: A total of 22 β-globin mutations arranged in 53 different genotypes were identified: IVS-II-1 (G> A) (35.7%), followed by IVS-I-6 (T> C) (18.0%), and codon 8/9 (+G) (8.5%) were the most frequent. Among disease-related morbidities, bone disease amounted to (66.9%), followed by endocrinopathies (32.2%), hepatobiliary complications (28.9%), and pulmonary hypertension (9.9%), whereas thrombosis, extramedullary hemopoiesis, and leg ulcers were less frequent.Conclusion: The overall complications rate was 78.9%, with a growing probability of complications with advanced age, with evidently higher rates in patients with β0β0 and β0β+ genotypes that explain the role of underlying genetic defects in the pathophysiology of disease complications.Keywords: transfusion dependent thalassemia, non-transfusion dependent thalassemia, HBB mutations, morbidities, risk factors, Iraq

Presence of antibiotic residues in milk is increasingly recognized as a global health issue owing to associated health risks and emergence of antibiotic resistant bacteria. The aim of this study was to determine the prevalence of antibiotic residues in sheep raw milk sold in Erbil governorate. The screening tests performed were; yoghurt culture, acidification, and disc diffusion tests. Randomly selected farms and sale points within the city were sampled. Out of 450 collected samples, 15.8% and 14.4% of them contained antibiotic residues according to yoghurt culture and disc diffusion tests, respectively. However, acidification test showed insignificant (P = 0.384) slightly higher prevalence (17.3%). Minor association was found between increase of residue prevalence and progress of summer-autumn months. Raising awareness among farmers and sale workers regarding withdrawal periods and risks of antibiotic residues are highly recommended to mitigate the health issues associated with consumption of contaminated milk.

Pathogenic strains of Salmonella cause gastroenteritis in humans globally.This study aimed to determine the prevalence and antibiotic susceptibility pattern of Salmonellain raw milk sold in Erbil city, Kurdistanregion, Iraq. A total of 470 samples were collected from retail vendors between January and June 2019. Samples were cultured on selective media followed by serotyping and antibiotic sensitivity testing by disk diffusion assay.The results revealed that the overall prevalence of Salmonella was 7.9%. The isolates belonged to nine (9) different serotypes: S.Typhimurium 18.9%, S.Anatum 10.8%, S.Muenchen 13.6%, S.Enteritidis 10.8%, S.Senftenberg 8.1%, S. Newport 10.8%, S. Arizona 10.8%, S. Montevideo 8.1%, and S.Dublin 8.1%. The antibiotic resistance profile revealed that 67.6%, 62.2%, 56.8%,and 56.8% of isolates were resistant to levofloxacin, streptomycin, imipenem, and tetracycline respectively. This resistance among Salmonella maypose a public health threat that needs activesafety measures and response.

This study was conducted to identify genetic genotype patterns for the species Lophochloa berythea (Boiss. et Blanche) Bor, L. obtusiflora (Boiss.) Gontsch., L. phleoides (Vill.) Rchb., L. pumila (Desf.) Bor, Schismus arabicus Nees. and S. barbatus (L.) Thell. from family Poaceae in Iraq by using polymerase chain reaction (PCR) and sequencing of chloroplast gene trnL-F technique. The result of the analysis of sequences and drawing the phylogenetic tree showed cluster analysis of the species and descendant species of the genus Schismus in a single clade alone in the base of phylogenetic tree and associated as a sister clade to the Lophochloa clade. The Lophochloa clade also subdivided in to two secondary clades. The first one gathered the L. phleoides and L. obtusiflora while the second gathered L. pumila and L. berythea with high support (bootstrapping) for all clades in cladogram. It seems that the sequences technique of chloroplast trnL-F gene has highly efficient in determination, separation and comparison between the two genera under study and support their descendant from one common ancestral origin.

Copyright of Al-Mustansiriyah Journal of Science is the property of Republic of Iraq Ministry of Higher Education & Scientific Research (MOHESR) and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

The current study was planned to identify the prevalence of brucellosis caused by Brucellamelitensis in human and goats in Wasit province using an indirect ELISA. Totally, 200 blood samples were collected (100 humans and 100 goats) from different areas; Al-Numaniyah, Al-Kut, Badra and Al-Hai, in Wasit province, Iraq, during October to December / 2020. Overall results were revealed 61 (30.5%) positive sera including 23 (23%) humans and 38 (38%) goats. Concerned to titer of seropositive population, though the values of goats were elevated, no significant differences (P>0.072) were found between human and goats. Association between seropositivity and epidemiological factors (age, sex and region) was showed a significant variation (P<0.05). For region factor, significant highest (P<0.05) value was detected in Al-Hai for both human and goats; while the lowest significance seen in Al-Kut and Al-Numaniyah for human and goats. For period factor, no significant differences (P≤0.63) were detected in seropositive findings of human; however, significant increases (P≤0.02) in findings of goats were observed in November; while significant decreases in October. For sex factor, significant increases (P<0.05) in seropositivity were reported in females of both human and goats. For age factor, significant highest seropositivity was showed in >40 years and >15-40 years groups of human, and in >1-3 years and > 3 years groups of goats; whereas, the lowest significance was observed in ≤ 15 years and ≤ 1 year groups of human and goats. In conclusion, there a significant prevalence for B. melitensis among study population in particular goats that could play an important source for transmission of infection to the human, directly or indirectly. To establishment a data base, furthermore studies are required to identify the prevalence of B. melitensis in other farm animals as well as in other regions. [ABSTRACT FROM AUTHOR]

This study performed to investigate toxic effects of aflatoxin B1 (AFB1) through measurement of body weights, and histopathological examination of hepatic and renal tissues; with targeting thereutic role of camel milk in improving of health status. Totally, 32 male rabbits were prepared initially, divided equally to GC, GE1, GE2 and GE3 groups that received respectively water during the 1st (first 38 days) and 2nd (second 38 days) experiments, AFB1 in 1st and camel milk in 2nd, 130µg/ Kg AFB1 in 1st and water in 2nd and camel milk in 1st and AFB1 in 2nd experiment. In comparison to values of zero-time, there significant decrease in values of GE1 and GE2 in 1st experiment; but not in 2nd experiment that showed a significant improvement in values of GE1, and no significant changes in values GE2. For GE3, insignificant differences were showed in study experiments. Histopathologically, hepatic tissues for rabbits received AFB1 were showed severe fatty changes, apoptosis, MNCs infiltration, congestion and dilation of sinusoids, hepatic vein thrombosis, severe degenerative hydropic degeneration, dilation in bile duct, hyperplasia of lining epithelium, necrosis in some lining epithelium, and cellular debris with fibrosis; whereas, there vascular degeneration in epithelial cells, congestion of glomerular capillaries, and dilation with extensive necrosis in tubules of renal tissues. In animals treated by camel milk, hepatic tissues showed significant accumulation of macrophages and lymphocytes in parenchyma, granulomatous lesion and fibrosis; whereas, significant MNCs infiltration in cortex, moderate fibrinous exudates in vascular wall, and swelling of tubules were seen in renal tissues. [ABSTRACT FROM AUTHOR]

Bone tumours are rarely found in children and adolescents (0- 19 years old), but there are reports from some provinces in Iraq indicating possible increases in the incidence of childhood bone cancer. Since counts are very low and often zero, or near zero, we fitted zero-inflated Poisson, zero-inflated negative binomial, Poisson hurdle, and negative binomial hurdle regression models to investigate these changes. We used data covering the 2000-2015 period taking age, gender and province into account with the aim of identifying potential health disparities. The results indicate that the zero-inflated Poisson is the most appropriate approach. We also found that, the incidence rate ratio of bone tumours for age groups of 5-9, 10-14 and 15-19 years were 134%, 490% and 723% higher, respectively, compared to the 0-4 year olds. The incidence rate was higher by 49% higher in males compared to females. Compared to 2000-2004, the rate was higher during 2005-2009 and 2010-2015 by 23% and 50%, respectively. In addition, the provinces Al-Muthana and Al-Diwaniyah in the South were found to have a higher incidence rate than other provinces. Join point analysis showed that the age-adjusted incidence rate had a significant, increasing trend, with an average percentage change of 3.1% during 2000-2015. The study suggests that further research into childhood tumours, bone tumours in particular, is needed. Reference to the effect of environmental factors in this group of medical disorders would be of special interest.

The research aims to identify the definition and concept of sustainable development, to identify who started the idea of sustainable development and when did the idea of sustainable development began, to identify the strategic goals of sustainable development of the United Nations 2030, to identify the extent to which sustainable development was achieved in Iraqi university libraries, and to identify the obstacles that Challenge achieving sustainable development in Iraqi university libraries, and developing proposals that help achieve sustainable development in Iraqi university libraries. As for the method used: the two researchers used in this research the descriptive and analytical method. This is due to its relevance to the nature of the research and its objectives. As for the most important results: 1- Adding a sustainable development unit in the structure of central university libraries to follow-up and the progress of achieving sustainable development goals, present and future. 2- The Iraqi central university libraries should work to amend their strategic objectives in accordance with the requirements and vision of the 2030 Sustainable Development Goals. 3- The university central libraries, the research sample, should host experts and academic and non-academic specialists in the fields of sustainable development for the purpose of holding workshops or lectures in order to achieve a part of the sustainable development strategy such as combating poverty and ignorance, creating health awareness, preserving the environment, ... etc. 4- It was noted that the majority of the strategic objectives of the university central libraries, the study sample, did not address the concept of sustainable development, or at least they were not modified in accordance with the 2030 Sustainable Development Strategy, which entered into force in 2016. [ABSTRACT FROM AUTHOR]

During survey of different water bodies in Kurdistan Region, Iraq for the presence of leeches, only two distinct specimens with special morphological characters were found in the cave mouth of Ahmadawa Water source in February 2019. The morphological (Body size, oral and posterior suckers characters, coloration and body projections were studied) and molecular study (18S rDNA amplifying with a forward primer C1 (ACCCGCTGAATTTAAGCAT at position 25), and reverse primer C3 (CTCTTCAGAGTACTTTTCAAC at position 390) and sequencing of the amplicons) cleared that the present specimens were belonging to the erpobdillid leeches, Erpobdella mestrovi, and the present appearance regard as a first in Iraq and all over the Middle-East for this leech.

This study was conductn the zooplankton community from eight selected sites in the Alwand Rivers and Alwand Dam .Monthly samples of water, zooplankton and phytoplankton were collected for the period from June 2018 to February 2019 .The results of physico-chemical properties of water showed that the Air temperature ranged from 9-47 °C while water temperature ranged from 8-35.7 °C, hydrogen ion concentration in most of studied period was alkaline side above 7 , it was ranged between 7.6 -8.26, Turbidity ranged from 5.98 to 317.6 NTU, dissolved oxygen from 1.5 mg.l-1 to 3.13 mg.l-1 and electrical onductivity from 918 to 1782 µs.cm­¹. Regarding to zooplankton, 81 species belonging to Rotifera (70 species), Cladocera (6 species) and zcopopoda (4 species). Also total count of phytoplankton was ranged from 60000 to 145000 cells.l-1 while total count of zooplankton from 4566.758 to 32433.98 ind.m-3.

The present study was conducted in the province of Duhok (Northern Iraq) between 2011-2012. The study attempted to determine the use of certain indigenous and cultivated plants in Duhok province in alternative medicine and place of these plants in systematics. Thus, 49 taxa in 27 genera and 46 species were identified. Two taxa belonged to Coniferophyta, one belonged to Pteridophyta and 46 belonged to Magnoliophyta dividions. It was determined that the family with the most numerous taxa in the region was Rosaceae with 5 taxa, followed by the Fabaceae and Lamiaceae family with 4 taxa and Apiaceae, Asteraceae, Cucurbitaceae and Poaceae family with 3 taxa each. Certain ethnobotanical features of the identified taxa, such as systematics, habitats, flowering times, local names and alternative uses in medicine were presented.

The aim of this study was to investigate the percentage of opportunistic fungi and evaluate the diversity of yeasts and moulds associated with pulmonary diseases in camels in Wasit, Iraq. A total of 200 nasal cavity swabs (two swabs for each camel) were taken with sterile cotton swabs from 100 camels of different ages, sexes and areas. The results showed that 60 (60%) samples from 100 camels were positive for the occurrence of moulds and yeasts isolates, which classified into (16) species (37%) of moulds and (9) species (23%) of yeasts. In this study which revealed most frequent molds isolates were Asperigellius spp. specific A.fumigatus at percentage 7 (7%) followed by A.niger 5 (5%), 3(3%) for each A.flavus and A.terrus and Aspergillus spp 1(1%). On the other hand other molds Penicillum rubrum 3(3%), Penicillum spp.1(1%) followed by 2(2%) for Alternaria alternata ; Cladosporium; Mucor circinelloides; Mucor hiemalis and Mucor spp. and 1(1%) for Rizopus spp; Alternerria spp; Fusarium solani and Fusarium spp. were identifying. Also through this study shown the total isolation of yeasts were 23(%23) out of 100 camels revealed mainly frequent isolate were Candida spp. particular C.albicans at percentage 6 (6%) followed by 3(3%) for C.krusei; C. parapsilosis; C. tropicals and C. glabrata 1(1%). Other yeasts also can be identified such as Cryptococcus neoformans 2(2%); Geotricum candidum 2(2%) and 1(1%) for Malassezia spp. This study showed increases of moulds and yeasts isolation in camels with the increase age of animals. In conclusion: showed wide diversity of moulds and yeasts species isolated from camels, the most common molds isolate were Asperigellius spp. particular A.fumigatus while generally common yeasts isolate were Candida spp. specific C.albicans and increases of moulds and yeasts isolation in camels with the increase age of animals.

Trichomonas vaginalis is an extracellular flagellated parasitic protozoan. It adapts to live in anaerobic conditions of the women's vagina and causes Trichomoniasis, a non-viral, sexually transmitted disease (STD). This parasite spreads in all regions of the world, and the global prevalence rate of vaginal Trichomoniasis in women is higher than in men. It is considered a neglected disease in Iraq, as there are few studies about this parasite, especially in Maysan province, where researches are near absent. In this study, two hundred and twentysix vaginal swabs were collected from women who visited hospitals, health centers, and medical clinics in some areas of Maysan province (Amara district, Al-Kahla district, Al-Maymouna district, Al-Majar Al-Kabir district) during the period from November 10, 2019 to February 10, 2020. The microscopic examination of vaginal smears showed that the overall infection rate was 75.22% (170/226). AL-Kahla district had the highest rate of infection (96.15%), while the lowest was in the Maimouna district (60.00%). The age group 34-40 years had the highest infection rate (86.95%), while the age group < 15 years had the lowest infection rate (37.50%). Married women had a higher infection (80.92%) than unmarried women (40.62%). The infection rate among nonpregnant women was high (81.11%) than with pregnant women (78.57%). This study showed that vaginal pH has a significant role in protecting the women vagina from Trichomoniasis, once the highest rate of infection (96.63%) was recorded in the vagina with a pH 6, while no infection was recorded at pH 4. It can be concluded that Trichomoniasis is widely spread among women of the Maysan communities, and the condition was affected significantly by some demographic factors such as age, occupation, marital status, husband polygamous, vaginal secretions, and itching and pH of the vagina. [ABSTRACT FROM AUTHOR]

Background: Breast cancer is the commonly diagnosed cancer among women globally and the major reason of deaths related to cancer in developing world, although breast cancer in young women is less common and often overlooked, it is still considered a major health concern. This study aimed to study breast cancer among young Iraqi women. Methodology: A retrospective study done on 50 diagnosed breast cancer cases below 40 years during period of 2017 and 2018 among women records of attendees to women health center in AL-ELWYIA maternity teaching hospital. Result: Out of total diagnosed breast cancer case during period of 2017 and 2018 (264), 50(18.9%) patients were below 40 years. the peak age at presentation ranged from 35-39 years (50%),family history was detected in 24% of cases, early menarche before age of 12 years was detected in 26% of cases,68% of patients presented with painless palpable mass, stage 2 disease were recognized in 76% of the studied sample and 86% were ductal in origin. Conclusion: the breast cancer among young Iraqi women under 40 years had high incidence rate but might be less aggressive than what was reported in western countries. [ABSTRACT FROM AUTHOR]

In human gamete development, the important period is spermatogenesis, which is organized by specific genes on Y chromosome. In some cases, the infertile men have shown microdeletions on Y chromosome, which seemed as if the structural chromosome variance is linked to the reduction of sperm count. This study aimed to determine the frequency and patterns of Y chromosome microdeletions in azoospermia factor (AZF) of Iraqi infertile males. Here, 90 azoospermic infertile males as a study group and 95 normal fertile males as control group were investigated for the microdeletion of AZF loci using numerous sequence-tagged sites. Of these 90 infertile male patients, 43 (47.8%) demonstrated Y chromosome microdeletions, in which AZFb region was the most deleted section in azoospermia patients (33.3%) followed by deletions in the AZFc region (23%), while there were no microdeletion in the AZFa region. The largest microdeletion involved in both AZFb and AZFc was detected in six azoospermic patients (6.7%). The present study demonstrated a high frequency of Y chromosome microdeletions in the infertile Iraqi patients which is not reported previously. The high frequency of deletions may be due to the association of ethnic and genetic factors. PCR-based Y chromosome screening for microdeletions has a potential to be used in infertility clinics for genetic counselling and assisted reproduction. [ABSTRACT FROM AUTHOR]

Escherichia coli clones, designated as extraintestinal pathogenic E. coli (ExPEC), are responsible for extraintestinal infections. Phylogenetic analysis has shown that E. coli is composed of four main phylogenetic groups (A, B1, B2 and D) and six subgroups (i.e. A0, A1, B22, B23, D1 and D2). Group A and B1 are generally associated with commensals, whereas group B2,D is associated with extra-intestinal pathotypes. In the present study, a total of 53 E. coli isolates, isolated from human clinical samples, were used. Phylogenetic grouping was done based on the PCR method using primers targeted at three genetic markers, chuA, yjaA and TspE4.C2. According to PCR-based phylotyping, subgroup B23 contained the majority of the collected isolates ( 40 isolates, 75.47 %), followed by subgroups A1and B22 (4 isolates for each subgroup, 7.55 %), followed by subgroups D2( 3 isolates, 5.66 %) and A0, D1 (1 isolate for each subgroup, 1.88 %). No isolates were found to belong to group B1 . Based on the results, the majority of isolates were extra-intestinal pathotypes. Therefore, the role of E. coli in human infections including urinary tract infections, septicemia, vaginitis and meningitis should be considered for further research.

Highly productive milk cows suffer from increasing loss in body condition at early lactation, and are more prone to metabolic disorders. Recent Cowdition smartphone application has the ability to determine animal health situation and it is called body condition scoring (BCS) system. It can apply adequately for proper farming and management the animal performance. BCS is also helping to assure that all stages of annual cow cycle are in a good condition. Consequently, appropriate dietary changes can be done to prevent any deficiencies and metabolic diseases. Routinely, rectal body temperature and pulsation and respiratory rates are measured as suitable vital indicators for evaluation the health of the animals and recognize the clinical abnormalities. Therefore, this study intends to correlate between the animal body condition and vital physiological parameters measurements to assess cow health. A total of 30 cows at different stages of the reproduction period, raised at different farms location in Al Muthanna Governorate/ Iraq was nominated animal material of the present study. For each cow, Bayer smartphone Application/ BCS Cowdition was used to measure the body condition, and at the same time, body temperature and pulse and respiratory rates were also measured. Scores that collected from the Cowdition application system were compared with physiological vital indicators parameters. The overall means of BCS were found as 3.9 ± 0.068 and range from 2.5 to 5 for minimum and maximum values respectively. Moreover, 63.33 % (19 out of 30) cows showed the standard BCS ranged between 3.25-3.75 and revealed typical vital clinical parameters. Also, 30% (9 out of 30) cows showed fat BCS values ranged between 4- 4.25 accompanied with variation in the vital clinical parameters that increase with high BCS values. Only 6.66% (2 out of 30) cows showed extremist BCS values which were 2.5 and 5 for poor (emaciated) and grossly fat cow respectively. Moreover, these cows showed also variations in the vital clinical parameters. In conclusion, this study represented for the first time in Iraq the adoption of smartphone BCS Cowdition system to evaluate the animal health. Besides, to understand the relationship between BCS and physiological vital clinical parameters values (body temperature, pulse and respiratory rates), to evaluate and assess the cow body health that helps in the improving of animal nutrition and avoid the metabolic diseases that commonly occur in the highly productive cow. The authors recommend another future study that uses BCS Cowdition Smartphone Appication and correlates it with the animal’s metabolic diseases.